CN106399274B

CN106399274B - Esterase and application thereof

Info

Publication number: CN106399274B
Application number: CN201610807542.9A
Authority: CN
Inventors: 蔡宇杰; 王小梅; 陈佳君; 廖祥儒; 白亚军; 郑晓晖
Original assignee: Jiangnan University
Current assignee: Zhuohong Chaoyuan Biotechnology Zhengzhou Co ltd
Priority date: 2016-09-07
Filing date: 2016-09-07
Publication date: 2019-12-10
Anticipated expiration: 2036-09-07
Also published as: CN106399274A

Abstract

The invention relates to acquisition of an esterase gene and cloning expression and application thereof, belonging to the field of bioengineering. Its substrate properties are disclosed. The esterase has wide functions and important industrial application value.

Description

Esterase and application thereof

Technical Field

The invention clones and expresses esterase, and discloses a nucleotide sequence, an amino acid sequence, enzymatic properties and application thereof, belonging to the field of industrial microorganisms.

Background

Feruloyl esterases (FAEs), also known as cinnamates, are carboxylesterases that hydrolyze ester bonds in methyl ferulate, oligosaccharide esterases, and polysaccharide ferulate esters, releasing free ferulic acid. It can cut off the cross-linking between polysaccharide and lignin in cell wall, and is favorable to the degradation of polysaccharide and the release of lignin in cell wall matter, so that it has wide application foreground in food, feed and paper industry. In the food industry, esterase is used to degrade ferulic acid ester bonds in plant cell walls, and free ferulic acid with medicinal value and health care function can be obtained. The plant raw materials are treated by esterase to loosen cell walls, so that the plant raw materials as raw materials in the feed industry are easier to digest and utilize by livestock, and the plant raw materials as raw materials in the pulping and papermaking industry can reduce the use of chemical medicines in the pulping process, reduce pollution and facilitate the implementation of subsequent processes.

In 1987, feruloyl esterase was first discovered in Streptomyces olivochromogens. Researches show that fungi, bacteria and yeasts can secrete ferulic acid esterase, and currently discovered enzyme-producing microorganisms comprise Aspergillus niger (Aaspergillussniger), Streptomyces avermitilis (Streptomyces avermitilis), Clostridium (Clostridium thermocellum), Lactobacillus sp (Lactobacillus sp.), Pseudomonas fluorescens (Pseudomonas fluorescens) and the like, but most of the ferulic acid esterase is separated from the fungi. Some lactobacilli have been found to have strong esterase activity and from which genes for ferulic acid esterase have been cloned (Wang, X.K., et al (2004)' Purification and characterization of "Purification from the intracellular bacterial strains", "applied Microbiol Biot 70(4): 2367. sup.2372; Biochemical Properties of Two microbiological strains Purified from a Lactobacillus johnsoni Strain from an ethanol Samples of Diabetes-Resistant rates, applied Microbiol Biot, 2009, 5(15), 5018. sup.5024;). Bacillus has also been previously reported to have feruloyl esterase activity (J.Donaghy. P.F.Kelly. A.M.McKay (1998). "Detection of bacterial acid enzyme production by Bacillus sp. and Lactobacillus. lactis. Appl. Microbiol Biotechnol 50:257-260), but no related gene and protein sequences have been reported. We have previously disclosed sequences of related genes in Bacillus amyloliquefaciens in three patents (201610158987.9,201610154877.5,201610154846. X). The patent further discloses a novel feruloyl esterase in a strain of bacillus. The esterase was found to have the highest similarity to the putative esterase in Bacillus pumilus (Bacillus pumilus) when compared to the NCBI database.

Disclosure of Invention

The invention clones a novel esterase gene from bacillus, utilizes escherichia coli engineering bacteria heterologous expression and discloses related enzymological characteristics of the esterase gene. And the ferulic acid is extracted and applied by using the same.

The technical scheme of the invention is as follows:

1. Bacterial strains

The source strains of the esterase gene of the invention are as follows: bacillus sp.SYBC hb4 (preserved by China center for type culture Collection, with the preservation number of CCTCC NO: M2015018).

2. Cloning of esterase Gene

And extracting the total DNA of the Bacillus sp.SYBC hb4 thallus genome. Designing specific primer, applying PCR method to amplify full-length coding frame sequence of esterase gene. And constructing a recombinant plasmid.

3. Esterase expression and purification

The recombinant plasmid was introduced into e.coli BL21(DE3) to induce expression. Crushing the thallus to obtain a crude enzyme solution, purifying, and freeze-drying for later use.

4. Enzymatic Properties of esterases

the influence of pH on the enzyme activity of the esterase is researched by taking ferulic acid methyl ester as a substrate.

The influence of temperature on the enzyme activity of the esterase is researched by taking the ferulic acid methyl ester as a substrate.

The influence of Ca ²⁺, K ⁺, Na ⁺, Mn ²⁺, Zn ²⁺, Ni ⁺, Co ⁺, Cu ²⁺, Mg ²⁺, Fe ²⁺ and other ions on enzyme activity is measured by taking ferulic acid methyl ester as a substrate.

substrate characterization of esterase: the substrate used is ethyl acetate, ethyl butyrate, ethyl caproate, ethyl caprylate, ethyl caprate, vinyl acetate, vinyl pivalate, vinyl propionate, vinyl methacrylate, vinyl n-butyrate, vinyl crotonate, vinyl caprate, vinyl laurate, vinyl benzoate, isopropenyl acetate, isobutyl acetate, butyl acetate, geranyl acetate, phenyl acetate, 1-naphthyl acetate, 2-naphthyl acetate, tri-O-acetyl-D-glucal, alpha-D (+) pentaacetylglucose, methyl lactate, methyl caproate, methyl caprylate, methyl dihydrojasmonate, methyl bromoacetate, methyl 2-bromopropionate, methyl bromophenylacetate, methyl mandelate, (R) - (-) -mandelate, methyl caprylate, ethyl capryl-propyl acetate, ethyl caprylate, ethyl propionate, ethyl propyl bromide, 2, 6-dihydroxy-4-methyl benzoate, 4-nitro-phenylacetic acid, 4-nitrobenzene butyrate, 4-nitrophenyl caprylate, methyl ferulate, ethyl caffeate, phenethylcaffeate, methyl p-coumarate, chlorogenic acid and benzyl cinnamate.

The enzyme activity determination method comprises the following steps: 20mM phosphate buffer, 20ug/ml freeze-dried pure enzyme, 1mM substrate, temperature-controlled reaction in water bath for 30min, and heating in boiling water bath at 100 deg.C for 3 min to terminate the reaction. Detecting the reduction amount of the substrate by using high performance liquid chromatography, wherein the detection conditions of the high performance liquid chromatography are as follows: 10-100% acetonitrile, 90-0% water (0.1% formic acid) 0-15 min; 15-20min 100% acetonitrile, 0 water; 20-30min 10% acetonitrile, 90% water (0.1% formic acid), the detector is an Alltech 3300 type evaporative light scattering detector. The system is adopted for the influences of temperature, pH, ions and substrates.

5. The lipase activity on the native substrate, de-starchy bran, was studied.

The de-starched bran was prepared according to literature methods (Xylan-hydrolyzing enzymes from Streptomyces spp. enzyme Microb Tech, 1988, 10(7): 403-. The total amount of ferulic acid in bran was calculated from ferulic acid obtained by alkaline extraction (Preparation of mu lic acid from obtained mu ltural acids: Its improved extraction and purification. journal of agricultural mu ltural and food Chemistry, 2008, 56(17): 7644-7648.). The ferulic acid release rate is the percentage of the enzymolysis release amount of ferulic acid in the total amount of ferulic acid extracted by alkali

Detailed Description

Example 1

This example shows the cloning of the esterase gene and the construction of engineering bacteria of Escherichia coli.

1. Extraction of Bacillus sp.SYBC hb4DNA

Culturing a Bacillus sp.SYBC hb4 strain in an LB culture medium for 12 hours, centrifuging for 10 minutes at 12,000rmp/min to obtain thalli, extracting total DNA of Bacillus sp.SYBC hb4 thalli genome by using a bacterial genome DNA extraction kit (TaKaRa company) according to the operation, and placing the thalli in a refrigerator for later use.

2. Competent preparation of E.coli

(1) Coli DH5 a and BL21(DE3) were inoculated in 250mL flasks containing 20mL LB medium and incubated overnight at 37 ℃ and 200rpm/min, respectively.

(2) The cells were inoculated in 50mL of LB medium at an inoculum size of 1%, and cultured at 37 ℃ to an OD600 of about 0.6 (about 2 to 3 hours).

(3) Transferring the bacterial liquid into a 50mL precooled centrifuge tube, placing the centrifuge tube on ice for 30min, and centrifuging the centrifuge tube at 8000rpm/min and 4 ℃ for 5 min.

(4) The supernatant was discarded, 5mL of a precooled 0.1mol/L CaCl2 solution was added to suspend the cells, and the cells were left on ice for 20min and centrifuged at 8000rpm/min at 4 ℃ for 5 min. Repeat 2 times.

(5) The supernatant was discarded, 1.5mL of a pre-cooled 0.1mol/LCaCl2 solution containing 15% glycerol was added to the supernatant, and the cells were gently suspended, 100. mu.L of the suspension was dispensed into 1.5mL centrifuge tubes and stored in a refrigerator at-70 ℃ for further use.

3. Cloning of esterase Gene

(1) Primer design

the whole genome DNA of Bacillus sp.SYBC hb4 was analyzed, and compared with the known Lactobacillus johnsonii esterase in NCBI database, the primer sequence was designed as follows:

Primer 1: 5'GCCGGGATCC ATGAAAGTTGTTACACCAAAACC 3'

Primer 2: 5'GCCGTCTAGA TTAAATTGACCAATCGAGTGATTC 3'

(2) PCR amplification

PCR amplification was performed using the two primers synthesized above and genomic DNA of Bacillus sp.SYBC hb4 as a template.

The amplification system in this step is:

The amplification procedure was:

94℃，10min

94 ℃, 30 sec; 55 ℃ for 30 sec; reacting at 72 ℃ for 1min for 30 cycles

72℃，10min

The PCR product is sent to Huahua big gene for sequencing to obtain the gene sequence of the esterase, which is shown as SEQ ID NO. 1. The amino acid sequence obtained according to the gene sequence is shown as SEQ ID NO. 2.

(3) Double cleavage and ligation

Carrying out double enzyme digestion on the pCold-II plasmid and the PCR product, wherein the enzyme digestion system is as follows: 10 Xcut buffer 3. mu.l, DNA 4. mu.l, enzymes Bam H I and Xba I0.5. mu.l each, sterile water 2. mu.l for a total of 30. mu.l. Cutting in a water bath at 37 ℃ for 1 h. The DNA fragment was cloned into pCold-II Vector and transformed into E.coli DH5 alpha competent cells. A connection system: 10 XDNA ligasebuffer 2.5. mu.l, DNA fragment 8. mu.l, vector DNA 2. mu.l, T4 DNA ligase 1. mu.l, sterile water 11.5. mu.l in total 25. mu.l. Connecting for 12-16 h in water bath at 16 ℃.

(4) Transformation of

The method comprises the following steps:

1 Add 100. mu.l DH 5. alpha. competent bacteria to the linker system, mix gently, ice-wash for 30 min.

2, placing the mixture into a preheated water bath at 42 ℃ and placing the mixture for 90s for heat shock treatment.

3 immediately ice-bath for 2 min.

4 adding 1ml LB culture solution without antibiotic, culturing at 37 ℃ for 1h to recover the bacteria.

5 evenly spread on LB medium containing antibiotics.

6 culture 24h well. Selecting single colony for colony PCR, nucleic acid electrophoresis verification and recombinant plasmid extraction. The recombinant plasmid was introduced into BL21 E.coli competence and stored for use.

Example 2

This example shows the induced expression and isolation and purification of the esterase of the invention.

11. Add 500. mu.l of recombinant bacteria to a 50ml shake flask. Culturing at 37 deg.C for 2.5h, and standing at 15 deg.C for 0.5 h. Then 20. mu.l of 0.5M IPTG was added thereto, and the mixture was subjected to cold induction culture at 15 ℃ for 24 hours. The fermentation broth was centrifuged (8,000rmp/min, 10min) to obtain the cells, which were redissolved with disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (20mmol/L, pH7.0), disrupted with an ultrasonicator, and centrifuged (8,000rmp/min, 10min) to collect the supernatant to obtain a crude enzyme solution.

2. And (2) performing nickel column purification on the crude enzyme solution obtained in the step (1) by adopting an AKTA avant 150 protein purification system, wherein the elution method comprises the following steps: the four lines A1, A2, B1 and B2 were placed in water, and the system flow rate was set at 20ml/min for venting. Then setting system flow at 1ml/min, flow path (column position 3), delta pressure0.3, pre-pressure 0.5, Gradient 0, instet A1, loading the column after water drops flow out evenly, placing A1 into the binding solution after balancing ten minutes, placing B1 into the eluent, exhausting once again, balancing twenty minutes, then loading the crude enzyme solution, eluting the target protein with 500mM high concentration imidazole buffer solution B1 in a Gradient way, eluting the protein adsorbed on the ion column, collecting the eluent with enzyme activity, and concentrating the eluent with enzyme activity by an ultrafiltration tube (30-kDa) to obtain the purified enzyme. The purified enzyme is freeze-dried for later use.

Example 3

This example shows the optimum temperature and temperature stability of the esterase of the invention. Taking ferulic acid methyl ester as a substrate, carrying out water bath on the substrate and a phosphate buffer solution with the pH value of 7.0 for 1h at different temperatures of 25-70 ℃ to determine the enzyme activity of esterase, and determining the optimal reaction temperature of the enzyme to be 40 ℃.

Example 4

This example shows the optimum pH and pH stability of the esterase of the invention. The method is characterized in that ferulic acid methyl ester is used as a substrate, the substrate is subjected to water bath at 35 ℃ for 1h at the pH of 3-9 to determine the enzyme activity of esterase, and the result shows that the enzyme activity of the esterase is highest under the condition of the pH of 6.5.

Example 5

After the enzyme obtained by purification in the example is placed in 2ml of solution with different metal ions and the concentration of 1mM for 30 minutes, the enzyme activity loss is large after the enzyme is measured and the enzyme activity is 1 hour after the enzyme is treated by Fe ²⁺, Zn ²⁺, Cu ²⁺ and Ni ⁺, Ca ²⁺, K ⁺, Na ⁺, Mn ²⁺, Mg ²⁺ and Co ⁺ promote the enzyme activity to rise, and the results are shown in Table 1.

TABLE 1 Effect of Metal ions on the enzymatic Activity of BpFae07

Example 6

This example is a characterization of the reaction of esterases with different substrates, as shown in Table 2. As can be seen from Table 2, the esterase has wide substrates, shows strong activity on aromatic hydroxycinnamic acid aliphatic esters, and belongs to feruloyl esterase.

TABLE 2 BpFae07 esterase activity on different substrates

Example 7

This example is the use of esterase hydrolysis of de-starched bran to produce ferulic acid. 200g of bran, 40mg of esterase which is purified and freeze-dried is added, 1000ml of water is added, the pH is natural, the temperature is kept at 40 ℃ for 12 hours, and the release rate of ferulic acid is measured to be 63.2 percent.

Claims

1. A method for hydrolyzing ethyl acetate, ethyl decanoate, ethyl butyrate or ethyl octanoate by using esterase is characterized by comprising the following steps: 20mM phosphate buffer solution, 20ug/mL freeze-dried pure enzyme, 1mM substrate, controlling the temperature in a water bath for reaction for 30min, and heating in a boiling water bath at 100 ℃ for 3 min to terminate the reaction; the esterase is derived from bacillus, and the amino acid sequence of the esterase is represented by SEQID NO. 2; the substrate is ethyl acetate, ethyl decanoate, ethyl butyrate or ethyl octanoate.