CN114231659B - Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method - Google Patents
Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method Download PDFInfo
- Publication number
- CN114231659B CN114231659B CN202210005685.3A CN202210005685A CN114231659B CN 114231659 B CN114231659 B CN 114231659B CN 202210005685 A CN202210005685 A CN 202210005685A CN 114231659 B CN114231659 B CN 114231659B
- Authority
- CN
- China
- Prior art keywords
- alfalfa
- msc1
- primer
- thistle
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer pair for detecting a thistle plant in alfalfa and application and a detection method thereof, belonging to the technical field of biology. The primer pair comprises primers MSC1-F and primers MSC1-R; the primer MSC1-F has a base sequence shown as SEQ ID NO.1, the primer MSC1-R has a base sequence shown as SEQ ID NO.2, the primer pair can specifically amplify the DNA fragment of the thistle plant, whether the alfalfa to-be-detected sample contains the thistle plant or not can be detected through one-time amplification, the corresponding detection method is simple and convenient, the detection of a large number of alfalfa products can be carried out, and the sensitivity, the accuracy and the repeatability of the detection result are high. The kit containing the primer set can also have the above-mentioned effects.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer pair for detecting a thistle plant in alfalfa, and application and a detection method thereof.
Background
Alfalfa (Medicago sativa L.) is widely planted in more than 80 countries, and the planting area reaches 3500 ten thousand hm 2 The method is also one of high-quality pastures with the largest planting area in China. The alfalfa leaf powder is developed, provides high-quality and low-cost protein feed raw materials for the feed industry, and has important significance for developing the feed industry.
Plants of the genus Cirsium (Cirsium Adans) of the family Compositae (Compositae) are 250-350 species worldwide, widely distributed in Europe, asia, north America and North America. The distribution of China is more than 50, and the distribution is widely distributed in the whole country. The plant belongs to the genus of plant, which is mainly prepared from whole herb, overground part or root, and has the effects of cooling blood, stopping bleeding, removing blood stasis and relieving swelling. The traditional Chinese medicine composition is mainly used for treating hemoptysis, hematemesis, hemoptysis, hematuria, traumatic hemorrhage and other symptoms clinically, and has important medicinal value. The application history of the thistle plant is long, and the habit of using the juice of the thistle plant for treating traumatic hemorrhage, hematemesis, hematuria and other diseases is always used up to the present. In recent years, the research on the plant of the genus thistle is in progress, not only flavonoid, volatile oil, organic acid and other types of compounds are separated from the plant of the genus thistle, but also a large number of pharmacological experiments prove that the plant of the genus thistle has various pharmacological effects of protecting liver, stopping bleeding, resisting inflammation and the like.
Although the thistle has good medicinal value, the thistle overgrown with the spiny flower can cross the knife for the mouth and the stomach of the cattle and sheep. If the thistle plant is smashed and added into the alfalfa grass product, the quality of the grass product is reduced, and the mouth and stomach of the cattle and sheep are injured, so that the rights and interests of consumers are injured. Currently, there are announcements that explicitly list the silk thistle (also known as field thistle) as "quarantine pest".
When alfalfa is beaten into grass powder to be used for manufacturing grass products, whether the grass products contain the thistle plants cannot be distinguished by naked eyes, and a large amount of manpower, material resources and financial resources are consumed in detecting the quality of the alfalfa products by using a conventional chemical analysis method, so that a method for accurately and rapidly detecting whether the thistle plants are contained in the alfalfa particles is not available at present.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a primer pair for detecting the thistle plants in alfalfa, which can accurately and rapidly detect whether the alfalfa to-be-detected sample contains the thistle plants.
The second object of the present invention is to provide an application of the primer pair.
The third object of the present invention is to provide a kit comprising the above primer pair.
The fourth object of the invention is to provide an application of the kit.
The fifth object of the present invention is to provide a method for detecting whether the alfalfa herb product contains a plant of the genus thistle by using the primer set.
The application can be realized as follows:
in a first aspect, the present application provides a primer pair for detecting a plant of the genus thistle in alfalfa, the primer pair comprising primers MSC1-F and primers MSC1-R;
the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
In a second aspect, the present application provides the use of a primer pair as in the previous embodiments for detecting whether or not a plant of the genus thistle is contained in an alfalfa grass product.
In a third aspect, the present application provides a kit comprising the primer pair of the foregoing embodiments.
In an alternative embodiment, the kit further comprises Mg 2+ Dntps, DNA polymerase and PCR buffer.
In a fourth aspect, the present application provides the use of a kit according to the previous embodiments for detecting whether or not a plant of the genus thistle is contained in an alfalfa grass product.
In a fifth aspect, the present application provides a method of detecting the presence of a plant of the genus thistle in an alfalfa grass product, comprising the steps of: performing PCR amplification on the DNA of the alfalfa product, detecting whether the amplified product contains the DNA fragment of the thistle plant, and if the amplified product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant;
the primers used in PCR amplification include the primer pairs of the foregoing embodiments.
In an alternative embodiment, the alfalfa product is alfalfa meal pellet feed.
In an alternative embodiment, the PCR amplification system comprises a 2 XPCR Master, a DNA template, primers MSC 1-F1, primers MSC1-R and ddH 2 O；
Wherein 2 XPCR MastThe er comprises MgCl 2 dNTPs, taq enzyme and 2 XPCR buffer.
In an alternative embodiment, each 20. Mu.L of PCR amplification system contains 10. Mu.L of 2 XPCR Master, 1. Mu.L of DNA template at a concentration of 50 ng/. Mu.L, 1. Mu.L of primer MSC1-F at a concentration of 10nM, 1. Mu.L of primer MSC 1-R1. Mu.L at a concentration of 10nM, and 7. Mu.L of ddH 2 O；
MgCl in 2 XPCR Master 2 The concentration of dNTP was 3mmol/L, the concentration of dNTP was 0.2mmol/L, and the concentration of Taq enzyme was 0.1U/. Mu.L.
In an alternative embodiment, the PCR amplification conditions include:
step a, pre-denaturation at 94 ℃ for 4min; step b, denaturation at 94 ℃ for 30s; step c, annealing at 56 ℃ for 30s; step d, extending at 72 ℃ for 20s; cycling the steps b to d for 25-40 times; and e, extending for 10min at 72 ℃.
In an alternative embodiment, steps b to d are cycled 30-38 times; preferably, steps b to d are cycled 32-36 times.
In an alternative embodiment, the amplification product is detected using a gel electrophoresis method.
In an alternative embodiment, the gel electrophoresis is performed at a voltage of 180-220V for 90-120min, and the gel used is a polyacrylamide gel having a concentration of 6-10 wt%.
The beneficial effects of this application include:
the primer pair provided by the application can specifically amplify the DNA fragment of the thistle plant (the length of the amplified DNA fragment of the thistle plant is 132 bp) and cannot amplify the DNA fragment of the alfalfa, so that whether the alfalfa sample contains the thistle plant or not can be obtained according to the amplified product. By adopting the primer pair, whether the alfalfa grass product contains the thistle plant or not can be distinguished by amplifying the sample to be detected once, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided. The kit containing the primer set has the effect of the primer set, and can detect the Cirsium plant even if the sample to be measured contains less Cirsium plant. The corresponding detection method can detect whether the alfalfa grass pellet feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the prior art is difficult to distinguish by naked eyes, and has the characteristics of high detection speed, high efficiency, high flux, high sensitivity and accuracy.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is an electrophoresis chart of PCR amplification products provided in example 4 of the present application;
FIG. 2 is an electrophoresis chart of PCR amplification products provided in example 6 of the present application.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The primer pair for detecting the plants of the genus thistle in the alfalfa, and application and detection method thereof are specifically described below.
The application proposes a primer pair for detecting a plant of the genus thistle in alfalfa, the primer pair comprising primers MSC1-F and primers MSC1-R;
wherein, the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
It should be noted that, the primer pair provided in the present application can specifically amplify only the DNA fragment of the plant of the genus thistle (the length of the amplified DNA fragment of the plant of the genus thistle is 132 bp), and cannot amplify the DNA fragment of the alfalfa, so that whether the alfalfa sample contains the plant of the genus thistle or not can be known from the amplified product.
By adopting the primer pair, whether the alfalfa grass product contains the thistle plant or not can be distinguished by amplifying the sample to be detected once, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided.
In some alternative embodiments, primer MSC1-F may be modified, and similarly primer MSC1-R may be modified. It should be noted that the modifications of the primers MSC1-F and MSC1-R are independent of each other and are not constrained by each other. That is, in certain embodiments, only primers MSC1-F may be modified; in other embodiments, only primer MSC1-R may be modified; in other embodiments, both primers MSC1-F and primers MSC1-R may be modified.
For reference, the modification may be the addition of a label at the 5 'and/or 3' end of the primer. That is, the tag may be added only to the 5 'end or the 3' end, or the tag may be added to both the 5 'end and the 3' end. The label may include, by way of example and not limitation, a biotin label, a fluorescent label, or a digoxin label. Wherein, if the primer is modified by fluorescent label, the primer modified by fluorescent label can be used for fluorescent quantitative PCR.
In addition, the modification mode can be phosphorylation, thio modification, deoxyuracil modification, deoxyhypoxanthine modification and the like. Modification methods conforming to the conventional experimental principles of molecular biology experiments can be applied to the present application.
In this case, the present application also provides a kit comprising the primer pair described above. Through setting up the kit, applicable in various occasions, conveniently detect, improve detection efficiency.
The kit may also include Mg 2+ dNTPs, DNA polymerase and PCR Buffer.
Referring to ground, mg 2+ Can be made of MgCl 2 The DNA polymerase may be Taq enzyme. MgCl contained in the kit 2 The concentration of dNTP may be 3mmol/L, and the concentration of Taq enzyme may be 0.2mmol/LThe concentration may be, for example, 0.1U/. Mu.L.
The kit has the effect of the primer pair, and the thistle plant can be detected even if the sample to be detected contains less thistle plant.
Further, the present application also provides a method for detecting whether a herba Medicaginis product contains a plant of the genus Cirsium, mainly comprising the following steps: PCR amplification is performed on the DNA of the alfalfa product, and whether the amplified product contains the DNA fragment of the thistle plant is detected, and if the amplified product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant.
The primers used in PCR amplification include the aforementioned primer pairs (i.e., primers MSC1-F and primers MSC 1-R). On the basis, the primer pair can also contain other primer pairs for composite PCR so as to achieve the purpose of amplifying other target fragments simultaneously. However, the other primers should not adversely affect the amplification of primers MSC1-F and primers MSC1-R.
In alternative embodiments, the alfalfa meal product described above may be, by way of example and not limitation, alfalfa meal pellet feed.
The method can detect whether the alfalfa grass pellet feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the prior art is difficult to distinguish by naked eyes, and has the characteristics of high detection speed, high efficiency, large flux, high sensitivity and accuracy.
As a reference, the PCR amplification system described above includes a 2 XPCR Master, a DNA template, primers MSC 1-F1, primers MSC1-R and ddH 2 O. Wherein the 2 XPCR Master comprises MgCl 2 dNTPs, taq enzyme and 2 XPCR buffer.
In some alternative embodiments, 10. Mu.L of 2 XPCR Master, 1. Mu.L of 50 ng/. Mu.L of DNA template, 1. Mu.L of 10nM primer MSC1-F, 1. Mu.L of 10nM primer MSC 1-R1. Mu.L, and 7. Mu.L of ddH may be included per 20. Mu.L of PCR amplification system 2 O。
MgCl in a 2 XPCR Master 2 The concentration of dNTP may be 3mmol/L, the concentration of dNTP may be 0.2mmol/L, and the concentration of Taq enzyme may be 0.1U/. Mu.L.
The amount of the substance contained in the PCR amplification system may be appropriately adjusted according to the actual situation.
In this application, PCR amplification conditions may be set by reference to the following modes:
step a, pre-denaturation at 94 ℃ for 4min; step b, denaturation at 94 ℃ for 30s; step c, annealing at 56 ℃ for 30s; step d, extending at 72 ℃ for 20s; cycling the steps b to d for 25-40 times; and e, extending for 10min at 72 ℃.
The specific number of cycles from step b to step d may be 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40.
In some preferred embodiments, steps b-d may be cycled 30-38 times, such as 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, or 38 times. In some preferred embodiments, steps b through d may be cycled 32-36 times, such as 32 times, 33 times, 34 times, 35 times, or 36 times.
The PCR amplification steps and conditions may be appropriately adjusted according to the actual conditions.
In the present application, gel electrophoresis may be used for detecting the amplification product. The method has low cost and high speed, and does not need to additionally modify the primer.
The gel electrophoresis can be carried out for 90-120min under 180-220V, and the gel is polyacrylamide gel with the concentration of 6-10wt%.
Specifically, the voltage may be 180V, 185V, 190V, 195V, 200V, 205V, 210V, 215V, 220V, or the like, or any other value within the range of 180 to 220V. Preferably 200V.
The electrophoresis time can be 90min, 95min, 100min, 105min, 110min, 115min or 120min, etc., or can be any other value within the range of 90-120 min. Preferably 100min.
The gel concentration is 6wt%, 6.5wt%, 7wt%, 7.5wt%, 8wt%, 8.5wt%, 9wt%, 9.5wt% or 10wt%, etc., and may be any other value within the range of 6 to 10 wt%. Preferably 8wt%.
By performing gel electrophoresis under the above conditions, a clear band can be obtained, and by performing gel electrophoresis under the above preferred conditions, the sharpest band can be obtained.
In other embodiments, the PCR amplified product may be detected by agarose gel electrophoresis or capillary gel electrophoresis, or the PCR product may be directly sequenced, or the PCR amplified product may be displayed simultaneously with the PCR amplification by fluorescence quantitative PCR or HRM.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
This example provides a primer pair for detecting the presence of a plant of the genus thistle in alfalfa.
The primer pair comprises a primer MSC1-F and a primer MSC1-R, wherein the primer MSC1-F has a sequence shown as SEQ ID NO.1, and the primer MSC1-R has a sequence shown as SEQ ID NO. 2.
MSC1-F(5′-3′)：ACACGTAATCACAGCCGGGCG。
MSC1-R(5′-3′)：CCGGGGTTTGTTTAGGTGCCG。
Example 2
The present example provides a kit for detecting the presence of a plant of the genus thistle in alfalfa products.
The kit comprises the following components: primers MSC1-F and primers MSC1-R, 2 XPCR Master and ddH 2 O；
Wherein the 2 XPCR Master comprises 3mM MgCl 2 0.2mM dNTP, 0.1U/. Mu.L Taq enzyme and 2 XPCR Buffer.
Example 3
The present example provides a method for detecting the presence of a plant of the genus Cirsium in alfalfa meal pellet feed.
The method comprises the following steps:
a) Collecting alfalfa grass pellet feed, and extracting genome DNA of grass products for later use;
b) PCR amplifying the genomic DNA extracted in the step A) using primers MSC1-F and primers MSC1-R;
PCR amplification System of 20. Mu.mL system comprising 2 XPCR Master 10. Mu.L, DNA template 1. Mu.L at 50 ng/. Mu.L, primer MSC 1-F1. Mu.L at 10nM, primer MSC 1-R1. Mu.L at 10nM and ddH 2 O7 μl; wherein the 2 XPCR Master comprises 3mM MgCl 2 0.2mM dNTP, 0.1U/. Mu.L Taq enzyme and 2 XPCR Buffer;
the PCR amplification procedure was: step a, pre-denaturation at 94 ℃ for 4min; step b, denaturation at 94 ℃ for 30s; step c, annealing at 56 ℃ for 30s; step d, extending at 72 ℃ for 20s; cycling the steps b to d for 35 times; step e, extending for 10min at 72 ℃;
c) And (3) PCR product detection:
detection was performed with 8wt% PAGE gel, 100mL system, 53.0mL H 2 O,26.3mL polypropylene, 20mL 5 XTBE, 700. Mu.L 35% ammonium persulfate, 70. Mu.L TEMED, coagulated for 50min, electrophoresed for 100min at 200V voltage in a vertical plate electrophoresis apparatus, then stained with nucleic acid dye, and photographed on a gel imager;
if the amplified product contains a DNA fragment of a plant of the genus Cirsium, the alfalfa product to be tested is doped with a plant of the genus Cirsium.
Example 4
This example is mainly used to verify the effectiveness of primers MSC1-F and MSC1-R.
Extracting 18 parts of alfalfa with different germplasm, 4 parts of alfalfa with different germplasm and 8 parts of alfalfa with different germplasm, diluting the total genome DNA with the concentration of 50 ng/mu L, and using the genome DNA as a DNA template in PCR, wherein the material information is shown in table 1;
extracting 9 parts of genomic DNA of a plant of the genus Cirsium, and diluting the concentration thereof to 50 ng/. Mu.L; used as DNA template in PCR, material information is shown in table 2;
TABLE 1 information description of alfalfa variety reference materials
Note that: PI is the number of the American germplasm resource pool, and CF is the number of the agricultural germplasm resource pool.
TABLE 2 information description of test materials for plant varieties of the genus Cirsium
PCR-amplifying the above-extracted alfalfa genomic DNA and the genomic DNA of the plant of the genus Cirsium using primers MSC1-F and MSC1-R;
the PCR amplification system was a 20. Mu.L system comprising 2 XPCR Master (Shanghai Biotechnology product number: SK 2082) 10. Mu.L, 50 ng/. Mu.L DNA template 1. Mu.L, primers MSC 1-F1. Mu.L at 10nM, primers MSC 1-R1. Mu.L at 10nM and ddH 2 O 7μL；
The PCR amplification procedure was: step a, pre-denaturation at 94 ℃ for 4min; step b, denaturation at 94 ℃ for 30s; step c, annealing at 56 ℃ for 30s; step d, extending at 72 ℃ for 20s; cycling the steps b to d for 35 times; step e, extending for 10min at 72 ℃;
detection was performed with 8wt% PAGE gel, 100mL system, 53.0mL H 2 O,26.3mL polypropylene, 20mL 5 XTBE, 700. Mu.L 35% ammonium persulfate, 70. Mu.L TEMED, coagulated for 50min, electrophoresed for 100min at 200V in a vertical plate electrophoresis apparatus, then stained with a nucleic acid dye, and photographed on a gel imager, the results being shown in FIG. 1, wherein the samples represented by each lane are shown in tables 1 and 2, and lane M represents a Marker;
lanes 1-18 of alfalfa represent alfalfa DNA as a template, lanes 19-22 of alfalfa represent alfalfa DNA as a template, and lanes 23-31 of alfalfa represent alfalfa DNA as a template; lanes 1-9 of the Cirsium plants represent 9 different Cirsium plant DNA templates; lanes "M" represent markers, "CK" represents ddH 2 O is a negative control of the template.
FIG. 1 shows that the electrophoresis bands with 9 parts of genomic DNA of the genus Cirsium as templates are clear and bright, substantially consistent with the predicted band sizes; the 31 alfalfa genomic DNA is used as a template, and no band is amplified, so that alfalfa and thistle plants can be distinguished obviously.
Example 5
This example was used to verify primer MSC1-F and primer MSC1-R amplification products.
To further verify the effectiveness of primers MSC1-F and MSC1-R, the amplified product fragments of the Cirsium plant DNA were sequenced. The results showed that the amplification product of the DNA of the plant of the genus Cirsium contained primers MSC1-F and primers MSC1-R.
PCR amplification was performed using 50 ng/. Mu.L of genomic DNA from the Cirsium plant as template, with primers MSC1-F and MSC1-R. The PCR system and method were the same as in example 4. The PCR product is detected by 2% agarose, a DNA fragment with the length of about 130bp is recovered, a recombinant plasmid pGEM-T-MSC 1-thistle plant is obtained after the PCR product is connected with a pGEM-T vector, and then the plasmid is transformed into escherichia coli DH5 alpha competent cells. E.coli containing pGEM-T-MSC 1-thistle plant plasmids was spread on LB medium containing Amp, IPTG and X-Gal, cultured overnight at 37℃and 3 positive clone plaques were picked up and cultured overnight at 37℃in LB liquid medium containing Amp. After the bacterial liquid is detected, the bacterial liquid accords with the expected band size, and is sent to Shanghai biological engineering Co., ltd for sequencing, and 3 positive cloning thistle plant fragments are sent to be detected.
The results show that primers MSC1-F and MSC1-R can amplify gene fragments of the plant of the genus Cirsium very well.
Example 6
The present example is directed to the examination of alfalfa and thistle genomes in different proportions.
The alfalfa and the thistle plant DNA are mixed according to the mass ratio of 100:0, 99:1, 75:25, 50:50, 25:75, 1:99 and 0:100 respectively, and then PCR and electrophoresis are carried out according to the detection method provided in example 4, and the result is shown in figure 2, which shows that primers MSC1-F and MSC1-R can clearly distinguish that 1% of the alfalfa DNA contains 1% of the thistle plant DNA, so that the quality of the alfalfa product can be accurately detected. In the figure, 100:0, 99:1, 75:25, 50:50, 25:75, 1:99 and 0:100 represent the mixing ratios of alfalfa and plant DNA of the genus Cirsium, respectively, and lane "M" represents Marker, "CK" represents ddH 2 O is a dieNegative control group of plates.
In summary, the primer pair provided by the application can specifically amplify only the DNA fragment of the thistle (the length of the amplified DNA fragment of the thistle is 132 bp), and cannot amplify the DNA fragment of the alfalfa, so that whether the alfalfa sample contains the thistle or not can be obtained according to the amplified product. By adopting the primer pair, whether the alfalfa grass product contains the thistle plant or not can be distinguished by amplifying the sample to be detected once, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided. The kit containing the primer set has the effect of the primer set, and can detect the Cirsium plant even if the sample to be measured contains less Cirsium plant. The corresponding detection method can detect whether the alfalfa grass pellet feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the prior art is difficult to distinguish by naked eyes, and has the characteristics of high detection speed, high efficiency, high flux, high sensitivity and accuracy.
The above is only a preferred embodiment of the present invention, and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> university of Lanzhou
<120> primer pair for detecting thistle plants in alfalfa, application thereof and detection method
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> artificial sequence
<400> 1
acacgtaatc acagccgggc g 21
<210> 2
<211> 21
<212> DNA
<213> artificial sequence
<400> 2
ccggggtttg tttaggtgcc g 21
Claims (10)
1. A primer pair for detecting a plant of the genus thistle in alfalfa, characterized in that the primer pair comprises primers MSC1-F and primers MSC1-R;
the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
2. A kit comprising the primer pair of claim 1;
the kit further comprises Mg 2+ Dntps, DNA polymerase and PCR buffer.
3. Use of a primer pair according to claim 1 or a kit according to claim 2 for detecting whether or not a plant of the genus thistle is contained in an alfalfa grass product.
4. A method for detecting the presence of a plant of the genus thistle in an alfalfa herb product, comprising the steps of: performing PCR amplification on the DNA of the alfalfa product, and detecting whether the amplified product contains a DNA fragment of the thistle plant with the length of 132pb, wherein if the product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant; the alfalfa product is alfalfa granulated feed;
the primer used in the PCR amplification is the primer pair of claim 1.
5. The method of claim 4, wherein the PCR amplification system comprises a 2 XPCR Master, a DNA template, primers MSC1-F, primers MSC1-R, and ddH 2 O；
Wherein the 2 XPCR Master comprises MgCl 2 dNTPs, taq enzyme and 2 XPCR buffer.
6. The method according to claim 5, wherein each 20 [ mu ] L PCR amplification system comprises a 10 [ mu ] L2 XPCR Master, a 1 [ mu ] L DNA template with a concentration of 50 ng/[ mu ] L, a 1 [ mu ] L primer MSC1-F with a concentration of 10nM, a 1 [ mu ] L primer MSC1-R with a concentration of 10nM and a 7 [ mu ] L ddH 2 O；
In the 2 XPCR Master, the MgCl 2 The concentration of dNTP is 3mmol/L, the concentration of dNTP is 0.2mmol/L, and the concentration of Taq enzyme is 0.1U/mu L.
7. The method of claim 6, wherein the PCR amplification conditions comprise:
step a, pre-denaturation at 94 ℃ for 4min; step b, denaturation at 94 ℃ for 30s; step c, annealing at 56 ℃ for 30s; step d, extending at 72 ℃ for 20s; cycling the steps b to d for 25-40 times; and e, extending for 10min at 72 ℃.
8. The method of claim 7, wherein steps b-d are cycled 30-38 times.
9. The method of claim 8, wherein steps b through d are cycled 32-36 times.
10. The method of claim 4, wherein the amplification product is detected using a gel electrophoresis method;
gel electrophoresis is carried out at 180-220V for 90-120min, and the gel is polyacrylamide gel with concentration of 6-10wt%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210005685.3A CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210005685.3A CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114231659A CN114231659A (en) | 2022-03-25 |
| CN114231659B true CN114231659B (en) | 2023-06-23 |
Family
ID=80745859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210005685.3A Active CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114231659B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108441577A (en) * | 2018-05-25 | 2018-08-24 | 兰州大学 | Primer pair, kit and purposes and detection alfalfa product in whether the method containing soybean |
| CN108676904A (en) * | 2018-05-25 | 2018-10-19 | 兰州大学 | Primer pair, reagent and kit and its application and identification alfalfa product in whether the method containing peanut |
| CN110229929A (en) * | 2019-07-22 | 2019-09-13 | 兰州大学 | Identify specific molecular marker and its application of the alfalfa seed true and false |
-
2022
- 2022-01-05 CN CN202210005685.3A patent/CN114231659B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108441577A (en) * | 2018-05-25 | 2018-08-24 | 兰州大学 | Primer pair, kit and purposes and detection alfalfa product in whether the method containing soybean |
| CN108676904A (en) * | 2018-05-25 | 2018-10-19 | 兰州大学 | Primer pair, reagent and kit and its application and identification alfalfa product in whether the method containing peanut |
| CN110229929A (en) * | 2019-07-22 | 2019-09-13 | 兰州大学 | Identify specific molecular marker and its application of the alfalfa seed true and false |
Non-Patent Citations (3)
| Title |
|---|
| and large subunit ribosomal RNA gene, partial sequence.《GenBank: MH711487.1》.2019,全文. * |
| internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence * |
| Xu,Y et al.Cirsium arvense voucher Q629 small subunit ribosomal RNA gene, partial sequence * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114231659A (en) | 2022-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551853B (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN112301157B (en) | RDA method and kit for rapidly detecting cat parvovirus (FPV) | |
| CN111676278A (en) | Primer and probe for detecting novel coronavirus N gene, kit and method thereof | |
| CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
| CN113151567A (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN101831506B (en) | Kit for authenticating deletion of vaccine strain and wild strain of PRVgE | |
| CN118147314A (en) | Method for identifying biogas digester by PCR (polymerase chain reaction) detection | |
| CN112359135B (en) | Indel labeled primer of fritillaria taipaiensis and application thereof | |
| CN108251553B (en) | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof | |
| CN114231659B (en) | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method | |
| CN110029172B (en) | Double PCR detection kit for equine and donkey-derived components | |
| CN110804677B (en) | Nested double PCR detection primer and kit for distinguishing wild strain and gene deletion strain of African swine fever virus | |
| CN108411030B (en) | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula | |
| CN116622909A (en) | Isothermal amplification detection reagent and detection method for feline herpesvirus I type | |
| CN113652496B (en) | Kit and method for identifying pholidota chinensis | |
| CN104263821B (en) | Old animal specimen Species estimation test kit and preparation method | |
| CN108441577B (en) | Primer pair, kit and application thereof, and method for detecting whether alfalfa product contains soybeans | |
| CN108676904B (en) | Primer pair, reagent and kit, application thereof and method for identifying whether alfalfa product contains peanuts | |
| CN113684294A (en) | SSR molecular marker primer and method for identifying wild buckwheat in Sichuan area | |
| CN111944919B (en) | Banana fusarium wilt tropical No.4 small species visual detection technology system capable of being operated in field and at normal temperature | |
| CN114507741B (en) | Molecular biological method for rapidly identifying five animal medicinal materials in Hippocampus multi-penis pill | |
| CN114672571B (en) | Specific primer pair for identifying processed auxiliary material turtle blood, kit and application | |
| CN110592275A (en) | RAA constant temperature fluorescence detection method and reagent for Infectious Spleen and Kidney Necrosis Virus (ISKNV) of mandarin fish | |
| CN107475457A (en) | Duck batai virus ring mediated isothermal amplification detection primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |