CN110229929A - Identify specific molecular marker and its application of the alfalfa seed true and false - Google Patents
Identify specific molecular marker and its application of the alfalfa seed true and false Download PDFInfo
- Publication number
- CN110229929A CN110229929A CN201910661379.3A CN201910661379A CN110229929A CN 110229929 A CN110229929 A CN 110229929A CN 201910661379 A CN201910661379 A CN 201910661379A CN 110229929 A CN110229929 A CN 110229929A
- Authority
- CN
- China
- Prior art keywords
- seed
- alfalfa
- seq
- bur clover
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the specific molecular marker of the identification alfalfa seed true and false and its applications, it is related to agricultural technology field, specifically, molecular labeling is in the application in identification alfalfa seed, alfalfa seed is selected from least one of bur clover and alfalfa, and the molecular labeling includes at least one of the nucleotide sequence as shown in SEQ ID No.1 and the nucleotide sequence as shown in SEQ ID No.2.Bur clover seed and alfalfa seed can accurately and efficiently be identified by carrying out detection using molecular labeling provided by the present application, the technology has the advantages that accuracy rate is high, quick and easy, reproducible, provides good application prospect for the plantation of bur clover large area and industrialization.
Description
Technical field
The present invention relates to agricultural technology field, specific molecular marker in particular to the identification alfalfa seed true and false and
It is applied.
Background technique
Bur clover (Medicago polymorpha) also known as medicago hispida, seedling grass etc., 1 year or more year raw herbaceous plant.By
In it rich in the nutritional ingredients such as vitamin A, C, E and a variety of amino acid, and the drought resistance of bur clover, cold resistance and Resistant energy
Power is strong, so entire growth course controls insect pest without pesticide grown.Meanwhile bur clover also has higher pharmaceutical value, it is pre- according to carninomatosis
It is anti-research institute studies have shown that bur clover can or have auxiliary reducing blood lipid, anticoagulation, anti-bleeding, it is clear in heat, have suppression to tumour
Production use etc., therefore bur clover is that diabetes and the good of cardiac are dredged.In short, bur clover biomass is big, growth is rapid, battalion
It supports that abundant, Land use systems are extensive, can be used for the multiple uses such as dish use, green manure, medicinal and feed.
Alfalfa (Medicago sativa) is a kind of herbaceos perennial, and reproducibility is good, and yield is high, and winter is raw
Length is vigorous, is excellent food plant, can also make green manure, but Land use systems can not show a candle to bur clover multiplicity, seed price is also golden
Cauliflower seed is cheaper.
Alfalfa is perennial herb, and bur clover is annual herb, and Land use systems are more various compared with alfalfa, kind
Sub- price is also higher than alfalfa price.And both grass seeds, blade and seedling are all extremely similar on mode of appearance, very
Hardly possible is differentiated, once both grass seeds mix, by the plantation to bur clover and using causing irremediable loss.But at present
There are no a unification and effective identification methods.
Therefore accurate quickly to distinguish bur clover and alfalfa rapidly, guarantee seed purity, for producing and ensuring clover
Quality and yield be of great significance.
In consideration of it, the present invention is specifically proposed.
Summary of the invention
The object of the present invention is to provide molecular labeling identification alfalfa seed in application, for distinguish bur clover and
Primer pair, method and the kit of alfalfa.
The present invention is implemented as follows:
In a first aspect, application of the molecular labeling in identification alfalfa seed, the alfalfa seed are selected from bur clover and pale reddish brown
At least one of clover, the molecular labeling include the nucleotide sequence as shown in SEQ ID No.1 and such as SEQ ID No.2
Shown at least one of nucleotide sequence；
Preferably, the alfalfa seed is bur clover, and the molecular labeling is the nucleotides sequence as shown in SEQ ID No.1
Column；
Preferably, the alfalfa seed is alfalfa, and the molecular labeling is the nucleotide as shown in SEQ ID No.2
Sequence.
Further, molecular labeling can be following three kinds of situations: molecular labeling includes nucleosides shown in SEQ ID No.1
Acid sequence；Molecular labeling includes nucleotide sequence shown in SEQ ID No.2；Molecular labeling is core shown in SEQ ID No.1
Nucleotide sequence and the nucleotide sequence as shown in SEQ ID No.2.
Second aspect, the embodiment of the invention provides a kind of for identifying the primer pair of alfalfa seed, and alfalfa seed is selected from
At least one of bur clover and alfalfa, the primer pair can expand the nucleotide sequence as shown in SEQ ID No.1
At least one of with the nucleotide sequence as shown in SEQ ID No.2；
Preferably, the primer pair is including the upstream primer as shown in SEQ ID No.3 and as shown in SEQ ID No.4
Downstream primer.
The third aspect, the embodiment of the present invention provides a kind of method for identifying alfalfa seed, this method comprises: the clover kind
Son is selected from least one of bur clover and alfalfa, which comprises uses as above-mentioned for identifying alfalfa seed
Primer pair is expanded using being detected seed cdna group DNA as template, and amplified production determines the inspection in 150bp~200bp
Survey seed is alfalfa seed.
Preferably, before amplification further include: identify the formalness feature of detected seed.
Preferably, described in being carried out after the formalness feature that the formalness feature for being detected seed meets alfalfa seed
Amplification.
In alternative embodiments, when amplified production is less than 165bp, determine that the detected seed is alfalfa；
Amplified production determines that the detection seed is bur clover when being greater than 165bp.
In alternative embodiments, determine that the detected seed is golden flower when the size of amplified production is 173bp
Colza；Determine that the detected seed is alfalfa seed when the size of amplified production is 159bp.
In alternative embodiments, above-mentioned amplification is PCR amplification, the reaction system of the PCR are as follows:
8~12pmol/ of upstream primer μ L 0.8~1.2 the μ L, 8~12pmol/ of downstream primer μ L 0.8~1.2
0.8~1.2 μ L, Taq archaeal dna polymerase of 2.3~2.7mmol/L of μ L, dNTP 3.0~5.0 μ L, DNA profiling 48~52ng/ μ L
4.5~5.5U/ μ L, 0.1~0.3 μ L, 2 × PCR buffer 8~11 μ L, ddH26~8 μ L of O.
In alternative embodiments, upstream primer 10pmol/ μ L 1 the μ L, 1 μ of downstream primer 10pmol/ μ L
1 μ L, Taq archaeal dna polymerase 5U/ μ L of L, dNTP 2.5mmol/L 4.0 μ L, DNA profiling 50ng/ μ L, 0.2 μ L, 2 × PCR buffering
Liquid 10 μ L, ddH26~8 μ L of O.
In alternative embodiments, the condition of the PCR amplification are as follows: 93 DEG C~95 DEG C initial denaturation 3~5min, 93 DEG C~
95 DEG C of 28~32s of denaturation；58 DEG C~62 DEG C 28~32s of annealing；70 DEG C~74 DEG C 58~62s of extension；29~31 circulations of amplification,
Last 70~74 DEG C extend 10min eventually.
In alternative embodiments, the above method includes to amplified production using polyacrylamide gel electrophoresis through carrying out
Detection.
Preferably, when the electrophoresis detection, electrophoresis tank voltage is 190~210V.
Preferably, when the electrophoresis detection, the race glue time is 150~170min.
In alternative embodiments, the acquisition methods of the detected seed cdna group DNA include: by the tested of collection
Seed is surveyed in 20 DEG C~30 DEG C 70~74h of sprouting, extracts the genomic DNA for being detected seed.
Fourth aspect, the embodiment of the invention also provides for identifying the kit of alfalfa seed comprising above-mentioned implementation
What is provided in mode is used to identify the primer pair of alfalfa seed.
5th aspect, the embodiment of the invention also provides the methods for distinguishing bur clover and alfalfa comprising: in use
The primer pair for identifying alfalfa seed is stated, is expanded using being detected seed cdna group DNA as template, amplified production is less than
Determine that the detection seed is alfalfa when 165bp；Amplified production determines that the detection seed is golden flower when being greater than 165bp
Dish.
The invention has the following advantages:
The embodiment of the invention provides molecular labeling identification alfalfa seed in application, alfalfa seed be selected from bur clover and
At least one of alfalfa, the molecular labeling include the nucleotide sequence as shown in SEQ ID No.1 and such as SEQ ID
At least one of nucleotide sequence shown in No.2.Carrying out detection using molecular labeling provided by the present application can be accurate, high
Effect ground identification bur clover seed and alfalfa seed, the technology have the advantages that accuracy rate is high, quick and easy, reproducible,
Good application prospect is provided for the plantation of bur clover large area and industrialization.
In addition, the embodiment of the invention also provides, the primer pair for identifying alfalfa seed, for identifying alfalfa seed
Method, the kit for identifying alfalfa seed and the method for distinguishing bur clover and alfalfa.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is that bur clover and alfalfa are schemed in morphologic difference in the embodiment of the present invention 1, wherein in Fig. 1 A with
B is the single seed of bur clover (M.polymorpha) and alfalfa (M.sativa) in Fig. 1, and D is gold in C and Fig. 1 in Fig. 1
Cauliflower and the fresh blade of alfalfa, E is bur clover (Chuxiong medicago hispida) and the control of alfalfa (middle lucerne 1) seedling in Fig. 1
Figure；
The PCR qualification result of Fig. 2 single plant between the bur clover provided of the embodiment of the present invention 5 and alfalfa seed；
Fig. 3 is the PCR identification knot between the bur clover and alfalfa seed of the different germplasm that the embodiment of the present invention 6 provides
Fruit；
Fig. 4 is the PCR qualification result of the bur clover and alfalfa seed mixture in the embodiment of the present invention 7.
Specific embodiment
It in order to make the object, technical scheme and advantages of the embodiment of the invention clearer, below will be in the embodiment of the present invention
Technical solution be clearly and completely described.The person that is not specified actual conditions in embodiment, according to normal conditions or manufacturer builds
The condition of view carries out.Reagents or instruments used without specified manufacturer is the conventional production that can be obtained by commercially available purchase
Product.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The present embodiment provides a kind of for identifying the molecular labeling of bur clover and alfalfa seed comprising has SEQ ID
Nucleotide sequence shown in No.1 and the nucleotide sequence as shown in SEQ ID No.2.Bur clover seed or alfalfa kind
Son has similitude on morphology, specifically please refers to attached drawing 1.
Specifically, the molecular labeling of bur clover seed are as follows:
CGATCTGGTCAATGATGAATGATTGGTTATGTTATGATACTTAAATATTTTAGATATGAAATTTGTAT
TTTATATATAATTTTATATATATATAAAAGATTATGAAATGTTCATGTAGTTAAGAGTTGAGTTTCAAGATTCCTC
TTCTGGAGAAGTAACTCAGGTTTAAATGT(SEQ ID No.1)。
The molecular labeling of alfalfa seed are as follows:
CGATCTGGTCAATGATGAATGATTGGTTATGTTATGATACTTAAATATTCTAGAGATCGAATTTCTAT
TTTATATATATAAAAGATTATGAAATGTTCATGTAGTTAAGAGTTGAGTTTCAAGATTCCTCTTCTGGAGAAGTAA
CTCAGGTTTAGATGT(SEQ ID No.2)。
Embodiment 2
The present embodiment provides a kind of for identifying the primer pair of bur clover and alfalfa seed, which can expand
At least one of the nucleotide sequence as shown in SEQ ID No.1 and the nucleotide sequence as shown in SEQ ID No.2.
The primer pair includes: that the upstream primer as shown in SEQ ID No.3 and the downstream as shown in SEQ ID No.4 are drawn
Object.
Specifically, the sequence of upstream primer (Med.trnK-F) are as follows:
5'-CGATCTGGTCAATGATGAATGATTGG-3'(SEQ ID No.3)；
The sequence of downstream primer (Med.trnK-R) are as follows:
5’-ACATTTAAACCTGAGTTACTTCTCCA-3’(SEQ ID No.4)。
Embodiment 3
The kit that the present embodiment provides a kind of for identifying bur clover seed, the kit for identifying alfalfa seed or
For distinguishing the kit of bur clover seed and alfalfa seed comprising following reagent: including 2 × PCR Master
10 μ l of Mix, 1 μ l of upstream primer, downstream primer 1 μ l and ddH2O 7μl.Upstream primer and downstream primer are what embodiment 2 provided
Primer pair.
It should be noted that in other embodiments, the amount of reagent in kit can be 2 times of mentioned reagent, 5
Again, 10 times etc..
Embodiment 4
Present embodiments provide a kind of method for identifying alfalfa seed comprising following steps:
It extracts and is detected seed cdna group DNA:
Seed is collected, method is sprouted using double-layer filter paper, is sprouted 72 hours under the conditions of 25 DEG C, extracts the genome of germination seed
DNA is spare.
Detect the molecular labeling for being detected seed:
The kit provided using embodiment 3, to the bur clover seed cdna group DNA and alfalfa seed gene of collection
Group DNA carries out PCR detection.PCR amplification condition is equal are as follows: (1) 94 DEG C of initial denaturation 4min；(2) 94 DEG C of denaturation 30s；(3) 60 DEG C of annealing
30s；(4) 72 DEG C of extension 30s；(5) step (2)-(4) recycle 30 times；(6) 72 DEG C of extension 7min.
Electrophoresis:
By bur clover and alfalfa pcr amplification product in same 8% non denatured acrylamide film electrophoresis, electrophoresis
Voltage is 200V, runs glue 160min；Nucleic acid staining dye 5min takes a picture under ultraviolet lamp.
Standard of perfection: for its electrophoresis amplified band size between 150bp-200bp, amplified band 173bp's is bur clover；
Amplified band 159bp's is alfalfa.
Embodiment 5
Verify the effect of the method for the identification alfalfa seed that embodiment 4 provides.
A kind of germplasm is respectively extracted from 4 portions of bur clovers and 15 parts of alfalfa germplasm as participating in the experiment material (being shown in Table 1).Using
The method that embodiment 4 provides, extracts each 20 parts of single seeded genomic DNAs of the two seeds, and totally 40 parts.By its concentration dilution
For 50ng/ μ l, it is used as template, PCR amplification is carried out using upstream primer and downstream primer.
1 bur clover of table and alfalfa seed participate in the experiment germplasm information description
| Germplasm name | Latin name | The place of production |
| Chuxiong medicago hispida | M.polymorpha | Chinese yunnan saves |
| Middle lucerne 1 | M.sativva | China |
By the PCR product of 40 portions of bur clovers and alfalfa in same 8% non denatured acrylamide film electrophoresis,
For electrophoresis amplified band size all between 150bp-200bp, amplified band 173bp's is bur clover；Amplified band 159bp's is
Alfalfa, please refers to attached drawing 2, in Fig. 2: the 1-20 number of alfalfa (middle lucerne 1) indicates 20 single plants of alfalfa, gold
The 1-20 number of cauliflower (Chuxiong medicago hispida) indicates that 20 single plants of bur clover, " M " indicate the DNA Marker of DL500, " CK " table
Show with ddH2O is the negative control group of template.
Embodiment 6
The method that verifying embodiment 4 provides is used to identify the effect between the bur clover and alfalfa seed of multiple germplasm.
Material (being shown in Table 2, table 3) is participated in the experiment in the seed conduct for choosing 4 parts of bur clover germplasm and 15 parts of alfalfa germplasm.Using
The method that embodiment 4 provides extracts the seed cdna group DNA of bur clover and each germplasm of alfalfa, and each germplasm extracts portion,
Totally 19 parts.It is 50ng/ μ l by its concentration dilution, is used as template, using the upstream primer and downstream primer progress in embodiment 2
PCR amplification.
2 bur clover of table participate in the experiment germplasm information description
| Number | Germplasm name | Latin name | The place of production |
| 1 | Chuxiong medicago hispida | M.polymorpha | Chinese yunnan saves |
| 2 | River south bur clover | M.polymorpha | Sichuan Province China saves |
| 3 | Huaiyang bur clover | M.polymorpha | Jiangsu Province, China |
| 4 | Wenling bur clover | M.polymorpha | Jiangsu Province, China |
3 alfalfa of table participate in the experiment germplasm information description
The PCR product of 4 portions of bur clovers and 15 parts of alfalfas is electric in same 8% non denatured acrylamide film
Swimming, as a result please refers to attached drawing 3.In Fig. 3, the 1-4 number of bur clover (M.polymorpha) indicates 4, bur clover different germplasm
(being shown in Table 2), the 1-15 number of alfalfa (M.sativa) indicate alfalfa 15 different germplasm (being shown in Table 3), and " M " is indicated
The DNA Marker of DL500, " CK " are indicated with ddH2O is the negative control group of template.
Fig. 3 shows that using the genomic DNA of 4 parts of bur clover germplasm and 15 parts of alfalfa germplasm as template, electrophoresis expands
Stripe size is all between 150bp-200bp, and the electrophoresis amplified fragments of 4 parts of bur clover germplasm are greater than 15 parts of alfalfa kinds
The electrophoresis amplified fragments of matter.
Embodiment 7
The method that verifying embodiment 4 provides is used to distinguish the effect of bur clover and alfalfa seed mixture.
By the seed of bur clover and alfalfa respectively with 0:100,1:99,25:75,50:50,75:25,99:1,100:0
Ratio mixing, extract mixing after seed genomic DNA and be used as template, with ddH2O compares for template, using embodiment
4 methods provided are identified.
PCR product is detected through 8% non denatured acrylamide gel electrophoresis, and PCR qualification result please refers to attached drawing 4.In Fig. 4:
0:100,1:99,25:75,50:50,75:25,99:1,100:0 indicate bur clover and the mixing of alfalfa genomic DNA template
Ratio, " M " indicate DL500 DNA Marker, " CK " indicate with ddH2O is the negative control group of template.
Fig. 4 show hybrid template in, bur clover seed cdna group DNA concentration from left to right gradually rises, electrophoretic band by
Gradual change is bright, and is from left to right gradually decreased with alfalfa seed genomic DNA concentration, and electrophoretic band is also gradually dimmed, and
Bur clover electrophoresis amplified fragments are both greater than the electrophoresis amplified fragments of alfalfa.With ddH2O is the negative control group of template without electricity
Swimming amplified band.
Embodiment 8
The method that verifying embodiment 4 provides is used to identify the correctness of bur clover.
The method provided using embodiment 4, extracts the special DNA sequence of bur clover and alfalfa, then
Pcr amplification product is sequenced.
Using 50ng/ μ l bur clover genomic DNA as template, using the primer pair (upstream primer of the offer of embodiment 2
Med.trnK-F, downstream primer Med.trnK-R) carry out PCR amplification (amplification method is with embodiment 4).PCR product is through 2% agar
It is detected in sugar, recycles the DNA fragmentation of length about 170bp, conversion bacillus coli DH 5 alpha competence is thin after connecting pMD19-T carrier
Born of the same parents.
The Escherichia coli of the plasmid containing pMD19-T-Med.trnK are applied on the LB culture medium containing Amp, 37 DEG C are incubated overnight,
3 positive colony bacterial plaques of picking, 37 DEG C of overnight shaking bacterium cultivations in the LB liquid medium containing Amp.Bacterium solution detection after with it is expected that
Stripe size is consistent, and Lanzhou apocalypse gene biological Science and Technology Ltd. is sent to be sequenced, and send 3 positive colony bur clover pieces of survey
Duan Xulie is consistent.
The results show that bur clover and alfalfa primer special can amplify the dedicated base of bur clover 173bp well
Because of segment.
Embodiment 9
The method that verifying embodiment 4 provides is used to identify the correctness of alfalfa.
Using 50ng/ μ l alfalfa genomic DNA as template, using embodiment 2 provide Med.trnK-F and
Med.trnK-R primer carries out PCR amplification.
PCR system and method are the same as embodiment 4.PCR product recycles the DNA piece of length about 160bp through 2% agar sugar detection
Section converts bacillus coli DH 5 alpha competent cell after connecting pMD19-T carrier.By the large intestine of the plasmid containing pMD19-T-Med.trnK
Bacillus is applied on the LB culture medium containing Amp, and 37 DEG C are incubated overnight, 3 positive colony bacterial plaques of picking, in the LB liquid training containing Amp
Support 37 DEG C of overnight shaking bacterium cultivations in base.
With it is expected that stripe size is consistent after bacterium solution detection, Lanzhou apocalypse gene biological Science and Technology Ltd. is sent to be sequenced,
Send 3 positive colony alfalfa fragment sequences of survey consistent.The results show that bur clover and alfalfa primer special can be very
The special-purpose gene segment of alfalfa 159bp is amplified well.
To sum up, the application the embodiment of the invention provides molecular labeling in identification alfalfa seed, alfalfa seed are selected from gold
At least one of cauliflower and alfalfa, the molecular labeling is including the nucleotide sequence as shown in SEQ ID No.1 and such as
At least one of nucleotide sequence shown in SEQ ID No.2.Carrying out detection using molecular labeling provided by the present application can
Accurately and efficiently identify bur clover seed and alfalfa seed, which has accuracy rate high, quick and easy, reproducible
The advantages of, good application prospect is provided for the plantation of bur clover large area and industrialization.
In addition, the embodiment of the invention also provides, the primer pair for identifying alfalfa seed, for identifying alfalfa seed
Method, the kit for identifying alfalfa seed and the method for distinguishing bur clover and alfalfa.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
SEQUENCE LISTING
<110>Lanzhou University
<120>specific molecular marker and its application of the alfalfa seed true and false are identified
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 173
<212> DNA
<213> Medicago polymorpha
<400> 1
cgatctggtc aatgatgaat gattggttat gttatgatac ttaaatattt tagatatgaa 60
atttgtattt tatatataat tttatatata tataaaagat tatgaaatgt tcatgtagtt 120
aagagttgag tttcaagatt cctcttctgg agaagtaact caggtttaaa tgt 173
<210> 2
<211> 159
<212> DNA
<213> Medicago sativa
<400> 2
cgatctggtc aatgatgaat gattggttat gttatgatac ttaaatattc tagagatcga 60
atttctattt tatatatata aaagattatg aaatgttcat gtagttaaga gttgagtttc 120
aagattcctc ttctggagaa gtaactcagg tttagatgt 159
<210> 3
<211> 26
<212> DNA
<213>artificial sequence
<400> 3
cgatctggtc aatgatgaat gattgg 26
<210> 4
<211> 26
<212> DNA
<213>artificial sequence
<400> 4
acatttaaac ctgagttact tctcca 26
Claims (10)
1. application of the molecular labeling in identification alfalfa seed, which is characterized in that the alfalfa seed is selected from bur clover and pale reddish brown
At least one of clover, the molecular labeling include the nucleotide sequence as shown in SEQ ID No.1 and such as SEQ ID No.2
Shown at least one of nucleotide sequence；
Preferably, the alfalfa seed is bur clover, and the molecular labeling is the nucleotide sequence as shown in SEQ ID No.1；
Preferably, the alfalfa seed is alfalfa, and the molecular labeling is the nucleotides sequence as shown in SEQ ID No.2
Column.
2. a kind of for identifying the primer pair of alfalfa seed, which is characterized in that the alfalfa seed is selected from bur clover and pale reddish brown lucerne
At least one of Mu, the primer pair can expand the nucleotide sequence as shown in SEQ ID No.1 and such as SEQ ID No.2
Shown at least one of nucleotide sequence；
Preferably, the primer pair includes the upstream primer as shown in SEQ ID No.3 and the downstream as shown in SEQ ID No.4
Primer.
3. a kind of method for identifying alfalfa seed, which is characterized in that the alfalfa seed is in bur clover and alfalfa
It is at least one, which comprises primer pair as claimed in claim 2 to be used, to be detected seed cdna group DNA as template
It is expanded, amplified production determines that the detected seed is alfalfa seed in 150bp~200bp；
Preferably, before amplification further include: identify the formalness feature of detected seed；
Preferably, the expansion is carried out after the formalness feature that the formalness feature for being detected seed meets alfalfa seed
Increase.
4. the method for identification alfalfa seed according to claim 3, which is characterized in that when amplified production is less than 165bp, sentence
The fixed detected seed is alfalfa；Amplified production determines that the detection seed is bur clover when being greater than 165bp.
5. the method for identification alfalfa seed according to claim 4, which is characterized in that when the size of amplified production is
Determine the detected seed for bur clover seed when 173bp；The size of amplified production determines described detected kind when being 159bp
Son is alfalfa seed.
6. according to the method for the described in any item identification alfalfa seeds of claim 3~5, which is characterized in that the amplification is PCR
Amplification, the reaction system of the PCR are as follows:
8~12pmol/ of upstream primer μ L 0.8~1.2 μ L, 8~12pmol/ of downstream primer μ L, 0.8~1.2 μ L,
0.8~1.2 μ L, Taq archaeal dna polymerase 4.5 of 2.3~2.7mmol/L of dNTP 3.0~5.0 μ L, DNA profiling 48~52ng/ μ L
0.1~0.3 μ L, 2 × PCR buffer of~5.5U/ μ L 8~11 μ L, ddH2The μ of O6~8 L；
Preferably, the condition of the PCR amplification are as follows: 93 DEG C~95 DEG C initial denaturations 3~5min, 93 DEG C~95 DEG C 28~32s of denaturation；
58 DEG C~62 DEG C 28~32s of annealing；70 DEG C~74 DEG C 58~62s of extension；29~31 circulations of amplification, last 70~74 DEG C of ends prolong
Stretch 10min.
7. according to the method for the described in any item identification alfalfa seeds of claim 3~5, which is characterized in that the method includes
The amplified production is detected using polyacrylamide gel electrophoresis；
Preferably, when the electrophoresis detection, electrophoresis tank voltage is 190~210V；
Preferably, when the electrophoresis detection, the race glue time is 150~170min.
8. according to the method for the described in any item identification alfalfa seeds of claim 3~5, which is characterized in that described detected kind
The acquisition methods of subgenom DNA include: to extract the detected seed of collection tested in 20 DEG C~30 DEG C 70~74h of sprouting
Survey the genomic DNA of seed.
9. a kind of for identifying the kit of alfalfa seed, which is characterized in that it includes as claimed in claim 2 for identifying
The primer pair of alfalfa seed.
10. a kind of method for distinguishing bur clover and alfalfa, characterized in that it comprises: using as claimed in claim 2
Primer pair is expanded using being detected seed cdna group DNA as template, and amplified production determines the detection kind when being less than 165bp
Son is alfalfa；Amplified production determines that the detection seed is bur clover when being greater than 165bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910661379.3A CN110229929B (en) | 2019-07-22 | 2019-07-22 | Specific molecular marker for identifying authenticity of alfalfa seeds and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910661379.3A CN110229929B (en) | 2019-07-22 | 2019-07-22 | Specific molecular marker for identifying authenticity of alfalfa seeds and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110229929A true CN110229929A (en) | 2019-09-13 |
| CN110229929B CN110229929B (en) | 2020-08-11 |
Family
ID=67855818
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910661379.3A Active CN110229929B (en) | 2019-07-22 | 2019-07-22 | Specific molecular marker for identifying authenticity of alfalfa seeds and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110229929B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114231659A (en) * | 2022-01-05 | 2022-03-25 | 兰州大学 | Primer pair for detecting thistle plants in alfalfa, application and detection method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106521024A (en) * | 2017-01-15 | 2017-03-22 | 兰州大学 | Medicago-truncatula-gaertn microRNA-SSR molecular marker primer and application to alfalfa variety identification |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
-
2019
- 2019-07-22 CN CN201910661379.3A patent/CN110229929B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
| CN106521024A (en) * | 2017-01-15 | 2017-03-22 | 兰州大学 | Medicago-truncatula-gaertn microRNA-SSR molecular marker primer and application to alfalfa variety identification |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114231659A (en) * | 2022-01-05 | 2022-03-25 | 兰州大学 | Primer pair for detecting thistle plants in alfalfa, application and detection method thereof |
| CN114231659B (en) * | 2022-01-05 | 2023-06-23 | 兰州大学 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110229929B (en) | 2020-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740711B (en) | Indel marker linked with yellow flesh gene yf of cucmis sativus L. and application of Indel marker | |
| CN107779520A (en) | Soybean transgenic event MON 87708 and its application method | |
| CN105154550B (en) | A kind of method using 1217 purity of EST-SSR molecular labeling Rapid identification variety of watermelon treasure sweet tea | |
| CN113430300B (en) | SSR molecular marker of mulberry variety Yuehen 123, core primer group and kit thereof, and application of SSR molecular marker | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN113637794A (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN104928396B (en) | A kind of method using EST SSR molecular marker Rapid identification capsicum variety gold green pepper purity | |
| Makwana et al. | Morphological characterization and DNA finger printing of pearl millet (Pennisetum Glaucum (L.) germplasms | |
| CN110229929A (en) | Identify specific molecular marker and its application of the alfalfa seed true and false | |
| CN108384873A (en) | SSR marker and method for the green phoenix hybrid seed purity identification of watermelon | |
| CN106350591B (en) | Construct SSR primer, constructed finger-print and its application of coloured silk Ye Luanshu Variety fingerprinting | |
| CN104004749B (en) | Chain SSR labeled primer and the application thereof of cucumber black fruit Ci Jiyin B | |
| CN108384879A (en) | A kind of SSR primers and method for watermelon hybrid object innovation | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN110106271A (en) | SSR label primer pair and its application for assisted Selection large broad bean | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| CN104946644A (en) | Molecular marker for corn tripsacum monosome addition line nucleic male sterility genes and application thereof | |
| CN112746124B (en) | SSR primer and method for purity identification of cauliflower hybrid seeds | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN110453005A (en) | A kind of ISSR-SCAR label and its application method identifying low temperature stimulation type elegant precious mushroom | |
| CN108085404A (en) | Giant pumpkin female trait molecular marker and the primer pair of identification giant pumpkin female character by force by force | |
| KR101444178B1 (en) | A method for identifying hot pepper varieties using microsatellites markers | |
| CN105112542B (en) | A kind of method identified with SRAP molecular labelings rescuebrome kind | |
| CN105420235B (en) | Cucumber fruits paliform epidermal cell gene Pe Indel marks and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |