CN114231659A - Primer pair for detecting thistle plants in alfalfa, application and detection method thereof - Google Patents
Primer pair for detecting thistle plants in alfalfa, application and detection method thereof Download PDFInfo
- Publication number
- CN114231659A CN114231659A CN202210005685.3A CN202210005685A CN114231659A CN 114231659 A CN114231659 A CN 114231659A CN 202210005685 A CN202210005685 A CN 202210005685A CN 114231659 A CN114231659 A CN 114231659A
- Authority
- CN
- China
- Prior art keywords
- primer
- alfalfa
- msc1
- thistle
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer pair for detecting thistle plants in alfalfa, and an application and a detection method thereof, and belongs to the technical field of biology. The primer pair comprises a primer MSC1-F and a primer MSC 1-R; the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, the base sequence of the primer MSC1-R is shown as SEQ ID NO.2, the primer pair can specifically amplify a DNA fragment of a thistle plant, and whether the thistle plant is contained in a sample to be detected of the alfalfa can be detected through one-time amplification. The kit comprising the primer set can also have the above-mentioned effects.
Description
Technical Field
The invention relates to the technical field of biology, and particularly relates to a primer pair for detecting thrips plants in alfalfa, and an application and a detection method thereof.
Background
Alfalfa (Medicago sativa L.) is widely planted in more than 80 countries, and the planting area reaches 3500 kilohm2The forage grass is also one of the high-quality forage grasses with the largest planting area in China. The alfalfa leaf powder is developed to provide high-quality and cheap protein feed raw materials for the feed industry, and has important significance for developing the feed industry.
There are 250-350 species of Asteraceae (Compositae) Cirsium (Cirsium Adans.) plants worldwide, widely distributed in Europe, Asia, North America, and North Africa. More than 50 varieties of Chinese are distributed and widely distributed in China. The plants are mostly used as medicines with whole herbs, overground parts or roots, and have the effects of cooling blood, stopping bleeding, removing stasis and relieving swelling. The Chinese medicinal composition is mainly used for treating hemoptysis, hematemesis, hemoptysis, hematuria, traumatic hemorrhage and other symptoms in clinic, and has important medicinal value. The application history of thistle plants is long, and the folk habit of using the juice of thistle plants to treat diseases such as traumatic hemorrhage, hematemesis, hematuria and the like is used up to now. In recent years, research on thistle plants is intensive, and not only are flavonoids, volatile oils, organic acids and other types of compounds separated from the thistle plants, but also a large number of pharmacological experiments prove that the thistle plants have various pharmacological effects of protecting liver, stopping bleeding, resisting inflammation and the like.
Although thistle has good medicinal value, thistle growing in full body is used for the oral cavity and stomach of cattle and sheep to race swallow knife. If the thistle plants are smashed and added into the alfalfa grass product, the quality of the grass product is reduced, the oral cavity and the stomach of cattle and sheep can be damaged, and the rights and interests of consumers are further damaged. At present, it has been announced that Cirsium arvense L (also known as Cipangopyrum arvense L.) is specifically classified as a "quarantine pest".
When the alfalfa is beaten into grass powder to be used for making grass products, whether the thistle plants are contained in the alfalfa cannot be distinguished by naked eyes, a large amount of manpower, material resources and financial resources are consumed for detecting the quality of the alfalfa products by using a conventional chemical analysis method, and a method for accurately and quickly detecting whether the thistle plants are contained in the alfalfa particles does not exist at present.
In view of this, the invention is particularly proposed.
Disclosure of Invention
One of the purposes of the invention is to provide a primer pair for detecting the thistle plants in the alfalfa, which can realize accurate and rapid detection of whether the alfalfa sample to be detected contains the thistle plants.
The second purpose of the present invention is to provide an application of the primer pair.
The third object of the present invention is to provide a kit comprising the primer set.
The fourth purpose of the invention is to provide an application of the kit.
The fifth purpose of the invention is to provide a method for detecting whether the alfalfa plant product contains the thistle plants or not by using the primer pair.
The application can be realized as follows:
in a first aspect, the application provides a primer pair for detecting thrips plants in alfalfa, wherein the primer pair comprises a primer MSC1-F and a primer MSC 1-R;
the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
In a second aspect, the present application provides the use of a primer pair as in the previous embodiments for detecting whether a alfalfa plant product contains thrips.
In a third aspect, the present application provides a kit comprising a primer pair of the preceding embodiments.
In alternative embodiments, the kit further comprises Mg2+Dntps, DNA polymerase and PCR buffer.
In a fourth aspect, the present application provides the use of the kit according to the previous embodiment for detecting if the alfalfa plant product contains thrips.
In a fifth aspect, the present application provides a method for detecting whether alfalfa products contain thistle plants, comprising the following steps: carrying out PCR amplification on DNA of the alfalfa product, and detecting whether the amplified product contains a DNA fragment of the thistle plant or not, wherein if the product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant;
the primers used in PCR amplification include the primer pairs of the previous embodiments.
In an alternative embodiment, the alfalfa product is alfalfa pellet feed.
In an alternative embodiment, the PCR amplification system comprises 2 XPCR Master, DNA template, primer MSC 1-F1, primer MSC1-R and ddH2O；
Wherein the 2 XPCR Master comprises MgCl2dNTP, Taq enzyme and 2 × PCR buffer.
In an alternative embodiment, each 20. mu.L PCR amplification system contains 10. mu.L of 2 XPCR Master, 1. mu.L of DNA template at a concentration of 50 ng/. mu.L, 1. mu.L of primer MSC1-F at a concentration of 10nM, 1. mu.L of primer MSC 1-R1. mu.L at a concentration of 10nM, and 7. mu.L of ddH2O；
In 2 XPCR Master, MgCl2The concentration of (2) was 3mmol/L, the concentration of dNTP was 0.2mmol/L, and the concentration of Taq enzyme was 0.1U/. mu.L.
In alternative embodiments, the PCR amplification conditions include:
step a, pre-denaturation at 94 ℃ for 4 min; b, denaturation at 94 ℃ for 30 s; c, annealing at 56 ℃ for 30 s; d, stretching for 20s at 72 ℃; the steps b to d are circulated for 25 to 40 times; step e, extension for 10min at 72 ℃.
In an alternative embodiment, steps b through d are cycled 30-38 times; preferably, steps b to d are cycled 32-36 times.
In an alternative embodiment, the amplification product is detected using gel electrophoresis.
In an alternative embodiment, the gel electrophoresis is performed at a voltage of 180-220V for 90-120min, and the gel used is polyacrylamide gel with a concentration of 6-10 wt%.
The beneficial effect of this application includes:
the primer pair provided by the application can only specifically amplify the DNA fragment of the thistle plant (the length of the amplified DNA fragment of the thistle plant is 132bp), but cannot amplify the DNA fragment of the alfalfa, so that whether the alfalfa sample contains the thistle plant or not can be known according to the amplified product. By adopting the primer pair, whether the alfalfa grass product contains the thistle plants or not can be distinguished by amplifying a sample to be detected for one time, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided. The kit containing the primer pair has the effect of the primer pair, and even if the sample to be detected contains less thistle plants, the thistle plants can be detected. The corresponding detection method can detect whether the alfalfa grass granulated feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the alfalfa grass granulated feed is difficult to distinguish by naked eyes in the prior art, and has the characteristics of high detection speed, high efficiency, high flux, high sensitivity and high accuracy.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is an electrophoretogram of PCR amplification products provided in example 4 of the present application;
FIG. 2 is an electrophoretogram of PCR amplification products provided in example 6 of the present application.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The primer pair for detecting the thistle plants in the alfalfa, the application and the detection method thereof provided by the application are specifically described below.
The application provides a primer pair for detecting thistle plants in alfalfa, and the primer pair comprises a primer MSC1-F and a primer MSC 1-R;
wherein the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
It should be noted that, the primer pair provided by the present application can only specifically amplify the DNA fragment of the thistle plant (the length of the amplified DNA fragment of the thistle plant is 132bp), but cannot amplify the DNA fragment of alfalfa, so that it can be known whether the alfalfa sample contains the thistle plant or not according to the amplified product.
By adopting the primer pair, whether the alfalfa grass product contains the thistle plants or not can be distinguished by amplifying a sample to be detected for one time, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided.
In some alternative embodiments, the primer MSC1-F can be modified, and similarly, the primer MSC1-R can be modified. Note that the modification of the primer MSC1-F and the modification of the primer MSC1-R are independent of each other and are not restricted. That is, in some embodiments, only primer MSC1-F may be modified; in other embodiments, only the primer MSC1-R may be modified; in other embodiments, both primer MSC1-F and primer MSC1-R can be modified.
In reference, the modification may be the addition of a label at the 5 'end and/or 3' end of the primer. That is, the label may be added only to the 5 'end or the 3' end, or may be added to both the 5 'end and the 3' end. The label may include, for example, but not limited to, a biotin label, a fluorescent label, or a digoxigenin label. Wherein, if the primer is modified by using a fluorescent label, the primer modified by the fluorescent label can be used for fluorescent quantitative PCR.
The modification may be phosphorylation, thio-modification, deoxyuracil-modification, deoxyhypoxanthine-modification, or the like. Any modification means can be applied to the present application as long as it complies with the conventional experimental principle of molecular biology experiments.
In addition, the application also provides a kit, which comprises the primer pair. Through setting up the kit, applicable in various occasions, the convenient detection improves detection efficiency.
By reference, the kit may further comprise Mg2+Dntps, DNA polymerase and PCR Buffer (PCR Buffer).
Referable to, Mg2+Can be prepared from MgCl2As provided, the DNA polymerase can be Taq enzyme. MgCl contained in the kit2The concentration of (2) can be illustratively 3mmol/L, the concentration of dNTP can be illustratively 0.2mmol/L, and the concentration of Taq enzyme can be illustratively 0.1U/. mu.L.
The kit has the effect of the primer pair, and can detect the thistle plants even if the sample to be detected contains less thistle plants.
Further, the application also provides a method for detecting whether the alfalfa products contain the thistle plants, which mainly comprises the following steps: and carrying out PCR amplification on the DNA of the alfalfa product, and detecting whether the amplified product contains the DNA fragment of the thistle plant or not, wherein if the product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant.
The primers used in PCR amplification include the primer pair described above (i.e., primer MSC1-F and primer MSC 1-R). On the basis, other primer pairs can be simultaneously contained for carrying out composite PCR so as to achieve the purpose of simultaneously amplifying other target fragments. However, the other primers need not adversely affect the amplification of the primers MSC1-F and MSC 1-R.
In an alternative embodiment, the alfalfa product described above may be, by way of example and not limitation, a alfalfa pellet feed.
The method can detect whether the alfalfa grass granulated feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the alfalfa grass granulated feed is difficult to distinguish by naked eyes in the prior art, and has the characteristics of high detection speed, high efficiency, high flux, high sensitivity and high accuracy.
For reference, P is as described aboveThe CR amplification system comprises 2 XPCR Master, a DNA template, a primer MSC 1-F1, a primer MSC1-R and ddH2And O. Wherein the 2 XPCR Master comprises MgCl2dNTP, Taq enzyme and 2 × PCR buffer.
In some alternative embodiments, each 20. mu.L PCR amplification system may contain 10. mu.L of 2 XPCR Master, 1. mu.L of DNA template at a concentration of 50 ng/. mu.L, 1. mu.L of primer MSC1-F at a concentration of 10nM, 1. mu.L of primer MSC 1-R1. mu.L at a concentration of 10nM, and 7. mu.L of ddH2O。
In 2 XPCR Master, MgCl2The concentration of (2) may be 3mmol/L, the concentration of dNTP may be 0.2mmol/L, and the concentration of Taq enzyme may be 0.1U/. mu.L.
The amount of the substance contained in the PCR amplification system can be adjusted as appropriate according to the actual circumstances.
In the present application, the PCR amplification conditions can be set by referring to the following manner:
step a, pre-denaturation at 94 ℃ for 4 min; b, denaturation at 94 ℃ for 30 s; c, annealing at 56 ℃ for 30 s; d, stretching for 20s at 72 ℃; the steps b to d are circulated for 25 to 40 times; step e, extension for 10min at 72 ℃.
The specific number of cycles of steps b to d may be 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40.
In some preferred embodiments, steps b to d may be cycled between 30-38 times, such as 30 times, 31 times, 32 times, 33 times, 34 times, 35 times, 36 times, 37 times, or 38 times. In some preferred embodiments, steps b through d may be cycled 32-36 times, such as 32 times, 33 times, 34 times, 35 times, or 36 times.
The PCR amplification step and conditions may be appropriately adjusted according to the actual conditions.
In the present application, the detection of the amplification product may be performed by gel electrophoresis. The method has low cost and high speed, and does not need to additionally modify the primer.
The gel electrophoresis can be carried out for 90-120min at a voltage of 180-220V, and the gel used is polyacrylamide gel with a concentration of 6-10 wt%.
Specifically, the voltage may be 180V, 185V, 190V, 195V, 200V, 205V, 210V, 215V, or 220V, etc., or may be any other value within the range of 180V and 220V. Preferably 200V.
The electrophoresis time can be 90min, 95min, 100min, 105min, 110min, 115min or 120min, and can also be any other value within the range of 90-120 min. Preferably 100 min.
The gel concentration is 6 wt%, 6.5 wt%, 7 wt%, 7.5 wt%, 8 wt%, 8.5 wt%, 9 wt%, 9.5 wt%, or 10 wt%, etc., and may be any other value within the range of 6 to 10 wt%. Preferably 8 wt%.
By performing gel electrophoresis under the above-mentioned conditions, a clear band can be obtained, and by performing gel electrophoresis under the above-mentioned preferred conditions, the clearest band can be obtained.
In other embodiments, the PCR amplification product may be detected by agarose gel electrophoresis, capillary gel electrophoresis, or the like, or the PCR product may be directly sequenced, or the product may be displayed simultaneously with PCR amplification by fluorescence quantitative PCR, HRM, or the like.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
This example provides a primer pair for detecting plants of genus Cirsium in alfalfa.
The primer pair comprises a primer MSC1-F and a primer MSC1-R, wherein the primer MSC1-F has a sequence shown as SEQ ID NO.1, and the primer MSC1-R has a sequence shown as SEQ ID NO. 2.
MSC1-F(5′-3′)：ACACGTAATCACAGCCGGGCG。
MSC1-R(5′-3′)：CCGGGGTTTGTTTAGGTGCCG。
Example 2
The embodiment provides a kit for detecting the thistle plants in alfalfa products.
The kit comprises the following components: primers MSC1-F and MSC1-R, 2 XPCR Master and ddH2O；
Wherein the 2 XPCR Master contains 3mM MgCl20.2mM dNTP, 0.1U/. mu.L Taq enzyme and 2 XPCR Buffer.
Example 3
The embodiment provides a method for detecting the thistle plants in the alfalfa grass granulated feed.
The method comprises the following steps:
A) collecting the alfalfa grass granulated feed, and extracting the genomic DNA of a grass product for later use;
B) performing PCR amplification on the genomic DNA extracted in the step A) by using a primer MSC1-F and a primer MSC 1-R;
the PCR amplification system is a 20-mu-L system, which comprises 2 XPCR Master 10 mu L, DNA template 1 mu L with concentration of 50 ng/mu L, primer MSC 1-F1 mu L with concentration of 10nM, primer MSC1-R1 mu L with concentration of 10nM and ddH2O7 mu L; wherein the 2 XPCR Master comprises 3mM MgCl20.2mM dNTP, 0.1U/. mu.L Taq enzyme and 2 XPCR Buffer;
the PCR amplification procedure was: step a, pre-denaturation at 94 ℃ for 4 min; b, denaturation at 94 ℃ for 30 s; c, annealing at 56 ℃ for 30 s; d, stretching for 20s at 72 ℃; circulating the steps b to d for 35 times; e, extending for 10min at 72 ℃;
C) and (3) detecting a PCR product:
detection was performed using 8 wt% PAGE gel, 100mL system, 53.0mL H2O, 26.3mL of polypropylene, 20mL of 5 XTBE, 700 μ L of 35% ammonium persulfate, 70 μ L of TEMED, solidification for 50min, electrophoresis at 200V for 100min in a riser electrophoresis apparatus, staining with a nucleic acid dye, and photography on a gel imager;
if the amplification product contains the DNA fragment of the thistle plant, the alfalfa product to be detected is doped with the thistle plant.
Example 4
This example was used to verify the effectiveness of primer MSC1-F and primer MSC 1-R.
Extracting 18 parts of medicago sativa with different germplasms, 4 parts of medicago falcata with different germplasms and 8 parts of medicago sativa with different germplasms, wherein the total amount of 31 parts of genome DNA is obtained, diluting the concentration of the genome DNA to 50 ng/mu L, and using the diluted genome DNA as a DNA template in PCR (polymerase chain reaction), wherein the material information is shown in Table 1;
extracting 9 parts of genomic DNA of the thistle plants, and diluting the concentration of the genomic DNA to 50 ng/mu L; used as a DNA template in PCR, the material information is shown in Table 2;
TABLE 1 information description of alfalfa cultivars reference material
Note: the PI is firstly numbered by the American germplasm resource library, and the CF is firstly numbered by the germplasm resource library of China department of agriculture.
TABLE 2 information description of reference materials of thistle species
PCR amplification is carried out on the extracted alfalfa genome DNA and the thrips plant genome DNA by using a primer MSC1-F and a primer MSC 1-R;
the PCR amplification system is a 20 mu L system, which comprises 10 mu L of 2 XPCR Master (Shanghai biological products code: SK2082), 1 mu L of DNA template with the concentration of 50 ng/mu L, 1 mu L of primer MSC 1-F1 mu L with the concentration of 10nM, 1-R1 mu L of primer MSC with the concentration of 10nM and ddH2O 7μL；
The PCR amplification procedure was: step a, pre-denaturation at 94 ℃ for 4 min; b, denaturation at 94 ℃ for 30 s; c, annealing at 56 ℃ for 30 s; d, stretching for 20s at 72 ℃; circulating the steps b to d for 35 times; e, extending for 10min at 72 ℃;
detection was performed using 8 wt% PAGE gel, 100mL system, 53.0mL H2O, 26.3mL polypropylene, 20mL 5 XTBE, 700. mu.L 35% ammonium persulfate, 70. mu.L TEMED, 50min for coagulation, electrophoresis at 200V for 100min in a riser electrophoresis apparatus, followed by staining with a nucleic acid dye and photographing on a gel imager, the results are shown in FIG. 1, wherein each lane represents samples as shown in Table 1 and Table 1As shown in Table 2, lane M represents Marker;
the lanes 1-18 of the alfalfa show that the DNA of the alfalfa is taken as a template, the lanes 19-22 of the alfalfa show that the DNA of the yellow alfalfa is taken as a template, and the lanes 23-31 of the alfalfa show that the DNA of the miscellaneous flower alfalfa is taken as a template; lanes 1-9 of Cirsium represent 9 different DNA fragments of Cirsium as templates; lane "M" represents Marker, "CK" represents ddH2O is the negative control group of the template.
FIG. 1 shows that the electrophoresis bands using 9 parts of genomic DNA of Cirsium as template are clear and bright, and are substantially consistent with the predicted band sizes; and when 31 parts of alfalfa genome DNA are taken as a template, a band is not amplified, so that alfalfa and thistle plants can be obviously distinguished.
Example 5
This example was used to verify the amplification products of primer MSC1-F and primer MSC 1-R.
To further verify the effectiveness of primer MSC1-F and primer MSC1-R, the amplified product fragments of the thrips DNA were sequenced. The results showed that the amplification product of the thrips DNA contained the primer MSC1-F and the primer MSC 1-R.
50 ng/. mu.L of thistle plant genome DNA is used as a template, and a primer MSC1-F and a primer MSC1-R are adopted for PCR amplification. The PCR system and method were the same as in example 4. Detecting the PCR product in 2% agarose, recovering DNA segment of about 130bp length, connecting pGEM-T vector to obtain recombinant plasmid pGEM-T-MSC 1-thrips plant, and transforming the plasmid into colibacillus DH5 alpha competent cell. Coating the Escherichia coli containing pGEM-T-MSC 1-thrips plant plasmid on LB culture medium containing Amp, IPTG and X-Gal, culturing overnight at 37 ℃, picking 3 positive clone bacterial plaques, and culturing overnight in LB liquid culture medium containing Amp at 37 ℃ with shaking. After the detection of the bacterial liquid, the size of the bacterial liquid is consistent with the size of an expected strip, the bacterial liquid is sent to Shanghai biological engineering company Limited for sequencing, and 3 positive cloned thistle plant fragments are sent for detection.
The results show that the primers MSC1-F and MSC1-R can well amplify the gene fragment of the thrips plant.
Example 6
This example mainly examines the alfalfa and thistle plant genomes at different ratios.
The DNA of the alfalfa and the thistle plants are mixed according to the mass ratio of 100:0, 99:1, 75:25, 50:50, 25:75, 1:99 and 0:100 respectively, then PCR and electrophoresis are carried out according to the detection method provided by the example 4, the result is shown in figure 2, and the primer MSC1-F and the primer MSC1-R can clearly distinguish that the alfalfa DNA contains 1% of the thistle plant DNA, so that the quality of the alfalfa product can be detected accurately. In the figure, 100:0, 99:1, 75:25, 50:50, 25:75, 1:99 and 0:100 respectively represent the mixing ratio of alfalfa and Cirsium plant DNA, lane "M" represents Marker, "CK" represents ddH2O is the negative control group of the template.
In summary, the primer pair provided by the present application can only specifically amplify the DNA fragment of the thistle plant (the length of the amplified DNA fragment of the thistle plant is 132bp), and cannot amplify the DNA fragment of alfalfa, so that whether the alfalfa sample contains the thistle plant can be known according to the amplified product. By adopting the primer pair, whether the alfalfa grass product contains the thistle plants or not can be distinguished by amplifying a sample to be detected for one time, and the primer pair has high sensitivity, so that the accuracy of a detection result is effectively improved, and the occurrence of a false positive or false negative result is avoided. The kit containing the primer pair has the effect of the primer pair, and even if the sample to be detected contains less thistle plants, the thistle plants can be detected. The corresponding detection method can detect whether the alfalfa grass granulated feed contains the thistle plants or not at the level of 1%, can effectively solve the defect that the alfalfa grass granulated feed is difficult to distinguish by naked eyes in the prior art, and has the characteristics of high detection speed, high efficiency, high flux, high sensitivity and high accuracy.
The above is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and changes will occur to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Lanzhou university
<120> primer pair for detecting thistle plants in alfalfa, application and detection method thereof
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
acacgtaatc acagccgggc g 21
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
ccggggtttg tttaggtgcc g 21
Claims (10)
1. A primer pair for detecting thistle plants in alfalfa is characterized by comprising a primer MSC1-F and a primer MSC 1-R;
the base sequence of the primer MSC1-F is shown as SEQ ID NO.1, and the base sequence of the primer MSC1-R is shown as SEQ ID NO. 2.
2. A kit comprising the primer pair of claim 1;
preferably, the kit further comprises Mg2+Dntps, DNA polymerase and PCR buffer.
3. Use of the primer pair according to claim 1 or the kit according to claim 2 for detecting whether the alfalfa product contains thrips.
4. A method for detecting whether alfalfa products contain thistle plants or not is characterized by comprising the following steps: carrying out PCR amplification on DNA of the alfalfa product, and detecting whether the amplified product contains a DNA fragment of the thistle plant or not, wherein if the product contains the DNA fragment of the thistle plant, the alfalfa product contains the thistle plant;
the primers used in the PCR amplification include the primer set according to claim 1 or 2.
5. The method of claim 4, wherein the alfalfa product is alfalfa pellet feed.
6. The method of claim 4 or 5, wherein the PCR amplification system comprises 2 XPCR Master, DNA template, primers MSC 1-F1, primers MSC1-R and ddH2O；
Wherein the 2 XPCR Master comprises MgCl2dNTP, Taq enzyme and 2 × PCR buffer.
7. The method of claim 6, wherein each 20 μ L of PCR amplification system comprises 10 μ L of said 2 XPCR Master, 1 μ L of said DNA template at a concentration of 50ng/μ L, 1 μ L of said primer MSC1-F at a concentration of 10nM, 1 μ L of said primer MSC1-R1 μ L at a concentration of 10nM, and 7 μ L of said ddH2O；
In the 2 XPCR Master, the MgCl2The concentration of the Taq enzyme is 3mmol/L, the concentration of the dNTP is 0.2mmol/L, and the concentration of the Taq enzyme is 0.1U/muL.
8. The method of claim 7, wherein the PCR amplification conditions comprise:
step a, pre-denaturation at 94 ℃ for 4 min; b, denaturation at 94 ℃ for 30 s; c, annealing at 56 ℃ for 30 s; d, stretching for 20s at 72 ℃; the steps b to d are circulated for 25 to 40 times; step e, extension for 10min at 72 ℃.
9. The method of claim 8, wherein steps b through d are cycled 30-38 times;
preferably, steps b to d are cycled 32-36 times.
10. The method of claim 4, wherein the amplification product is detected by gel electrophoresis;
preferably, the gel electrophoresis is carried out for 90-120min at a voltage of 180-220V, and the gel used is polyacrylamide gel with a concentration of 6-10 wt%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210005685.3A CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210005685.3A CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114231659A true CN114231659A (en) | 2022-03-25 |
| CN114231659B CN114231659B (en) | 2023-06-23 |
Family
ID=80745859
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210005685.3A Active CN114231659B (en) | 2022-01-05 | 2022-01-05 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114231659B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108441577A (en) * | 2018-05-25 | 2018-08-24 | 兰州大学 | Primer pair, kit and purposes and detection alfalfa product in whether the method containing soybean |
| CN108676904A (en) * | 2018-05-25 | 2018-10-19 | 兰州大学 | Primer pair, reagent and kit and its application and identification alfalfa product in whether the method containing peanut |
| CN110229929A (en) * | 2019-07-22 | 2019-09-13 | 兰州大学 | Identify specific molecular marker and its application of the alfalfa seed true and false |
-
2022
- 2022-01-05 CN CN202210005685.3A patent/CN114231659B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN106893773A (en) * | 2017-01-13 | 2017-06-27 | 兰州大学 | Identification alfalfa seed carries the kit and detection method of Semen Cuscutae seed |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108441577A (en) * | 2018-05-25 | 2018-08-24 | 兰州大学 | Primer pair, kit and purposes and detection alfalfa product in whether the method containing soybean |
| CN108676904A (en) * | 2018-05-25 | 2018-10-19 | 兰州大学 | Primer pair, reagent and kit and its application and identification alfalfa product in whether the method containing peanut |
| CN110229929A (en) * | 2019-07-22 | 2019-09-13 | 兰州大学 | Identify specific molecular marker and its application of the alfalfa seed true and false |
Non-Patent Citations (1)
| Title |
|---|
| XU,Y ET AL: "Cirsium arvense voucher Q629 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence", 《GENBANK: MH711487.1》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114231659B (en) | 2023-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861642B (en) | A kind of acipenser schrencki gender gap opposite sex molecular labeling and detection acipenser schrencki property method for distinguishing | |
| Linacre et al. | Species determination: the role and use of the cytochrome b gene | |
| CN111808975B (en) | Deer species source identification primer pair of deer antler product and identification method thereof | |
| CN103436611A (en) | PCR-RFLP rapid detection method for common sturgeons | |
| CN110724762B (en) | LAMP detection primer and detection method for African swine fever virus | |
| KR102009712B1 (en) | Primer set for discriminating Zizyphus jujuba 'Bokjo' cultivar and uses thereof | |
| CN105907852A (en) | Nested fluorescent PCR detection primer, probe, kit and detection method of donkey-origin, horse-origin, swine-origin and bovine-origin in donkey-hide gelatin, and applications thereof | |
| CN105734156A (en) | Nest-type fluorescence PCR detection primers, probe composition and kit for donkey and pig-sourced ingredients in colla corii asini and detection method and application | |
| CN114231659A (en) | Primer pair for detecting thistle plants in alfalfa, application and detection method thereof | |
| CN110029172B (en) | Double PCR detection kit for equine and donkey-derived components | |
| CN108411030B (en) | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula | |
| CN116179725A (en) | Primer pair combination for multiple PCR detection of Nocardia seriolae and detection method | |
| CN111139312B (en) | Identification method of QITECAO based on micro molecular marker and application thereof | |
| CN105969907B (en) | Kit for detecting ST251 type pathogenic aeromonas hydrophila and application thereof | |
| CN104263821B (en) | Old animal specimen Species estimation test kit and preparation method | |
| CN112126697B (en) | Micro-droplet digital PCR detection primer probe set and kit for agrobacterium tumefaciens and application thereof | |
| CN108441577B (en) | Primer pair, kit and application thereof, and method for detecting whether alfalfa product contains soybeans | |
| CN108676904B (en) | Primer pair, reagent and kit, application thereof and method for identifying whether alfalfa product contains peanuts | |
| CN112501320A (en) | Snake origin component rapid detection kit and application thereof | |
| JP6853523B2 (en) | PCR using helicase | |
| CN114672571B (en) | Specific primer pair for identifying processed auxiliary material turtle blood, kit and application | |
| JP2010011764A (en) | Method for judging kind of raw material tea of green tea extract | |
| CN110923331A (en) | Primer pair and application thereof in identification of limnodrilus | |
| CN110592275A (en) | RAA constant temperature fluorescence detection method and reagent for Infectious Spleen and Kidney Necrosis Virus (ISKNV) of mandarin fish | |
| Oboma et al. | Effect of formalin fixation on DNA purity and quantity, nucleic acid, and amplicon size in cervical human papilloma virus detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |