CN108411030B - Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula - Google Patents
Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula Download PDFInfo
- Publication number
- CN108411030B CN108411030B CN201810532326.7A CN201810532326A CN108411030B CN 108411030 B CN108411030 B CN 108411030B CN 201810532326 A CN201810532326 A CN 201810532326A CN 108411030 B CN108411030 B CN 108411030B
- Authority
- CN
- China
- Prior art keywords
- primer
- medicago truncatula
- primer pair
- nst480
- ecological
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention provides a primer pair, a kit containing the primer pair, an application of the primer pair and a method for detecting the ecotypes A17 and R108 of medicago truncatula, and relates to the technical field of biology. The primer pair comprises a primer NST480-F and a primer NST480-R which have sequences shown in SEQ ID NO.1 and SEQ ID NO.2 respectively, and can simultaneously amplify DNA fragments with different fragment lengths of the ecological type A17 and R108 of the medicago truncatula, so that whether a sample to be detected contains the ecological type A17 and R108 of the medicago truncatula can be distinguished by one-time amplification. The primer pair is used for detecting the ecological types A17 and R108 of the medicago truncatula, has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness, convenience and the like, and solves the problem that the ecological types A17 and R108 of the medicago truncatula are detected and identified by a rapid and accurate method in the prior art.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer pair, a kit containing the primer pair, an application of the primer pair and a method for detecting the ecotypes A17 and R108 of medicago truncatula.
Background
The Medicago truncatula (Medicago truncatula) as a leguminous model plant has the characteristics of drought resistance, cold resistance, high yield and high quality, can improve soil, and has the advantages of short growth cycle, small genome, high genetic transformation rate and self-pollination. Medicago truncatula, most leguminous plants including medicago sativa (m.sativa), is genetically similar. The information obtained from medicago truncatula can be used for reference to other legumes. Therefore, Medicago truncatula is of great interest in plant molecular biology and genomics research.
With the development of animal husbandry, the demand of pasture is larger and larger, and the safety requirement is higher and higher. Molecular biology means have more and more remarkable effects on pasture, and leguminous pasture, which is one of the two most important families in pasture, provides a large amount of protein resources for livestock, so that gene improvement on the leguminous pasture is an important subject in the pasture field.
As for the field of leguminous plant molecular biology, the medicago truncatula is taken as a model plant of leguminous pasture and provides excellent experimental materials for researching whether other excellent genes are expressed in leguminous plants. Accurate and high-quality medicago truncatula seeds guarantee the safety of the experiment, so that different ecotypes of the medicago truncatula can be accurately and rapidly identified, and the method has very important significance for improving the molecular biological research of leguminous forage grass in China.
The different ecotypes a17 and R108 of medicago truncatula are quite common in the laboratory, but the two ecotypes of medicago truncatula do not have the same use in the laboratory. A17 Medicago truncatula genome sequence is obtained by single seed progeny sequencing and is commonly used for T-DNA insertion analysis; the alfalfa R108 ecotype has the characteristics of small genome, high seed yield, short seed maturation time and the like, so the alfalfa R108 ecotype is often used for researching related molecular genetic processes.
The two ecotypes of seeds are extremely similar in appearance and form and very difficult to distinguish, and once mixed, irreparable loss is caused to the research on the gene function of the medicago truncatula, and a unified and effective identification method does not exist at home and abroad at present. Only by visual observation, the results are inaccurate.
Therefore, a rapid and accurate method for detecting and identifying the ecotypes A17 and R108 of medicago truncatula is quite needed at present.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The first purpose of the invention is to provide a primer pair for detecting the ecological A17 and R108 of medicago truncatula, which alleviates the technical problem of the prior art that the technologies for detecting the ecological A17 and R108 of medicago truncatula are not sufficient, the primer pair can amplify DNA fragments of the ecological A17 and the ecological R108, and the lengths of the fragments of the amplified products are different, so that whether the ecological A17 and R108 of medicago truncatula are contained in a sample to be detected or not can be detected at the same time.
The second purpose of the invention is to provide a kit containing the primer pair, and the kit has wide application in matching with other reagents commonly used in molecular biology experiments.
The third purpose of the present invention is to provide an application of the primer pair or the kit in detecting the ecological types a17 and R108 of medicago truncatula, which is very wide, and for example, the primer pair or the kit can be applied to detecting whether a sample to be detected contains the components of the ecological types a17 and/or R108 of medicago truncatula, and for example, can also be applied to identifying the ecological types a17 and R108 of medicago truncatula; the primer pair or the kit is also suitable for detecting or identifying the mutant strains of the alfalfa ecotypes A17 and R108, so that the application is very wide.
The fourth purpose of the invention is to provide a method for detecting the ecological types A17 and R108 of medicago truncatula, which alleviates the problem of the prior art that a quick and accurate method for detecting and identifying the ecological types A17 and R108 of medicago truncatula is lacked.
In order to solve the technical problems, the invention adopts the following technical scheme:
a primer pair for detecting the ecotypes A17 and R108 of medicago truncatula, wherein the primer pair comprises a primer NST480-F and a primer NST 480-R;
wherein the primer NST480-F has a sequence shown as SEQ ID NO.1, and the primer NST480-R has a sequence shown as SEQ ID NO. 2.
Further, a primer NST480-F and a primer NST480-R are modified;
further, the modification comprises adding a label at the 5 'end and 3' end of the primer;
further, the label includes a fluorescent label, a biotin label or a digoxigenin label.
The invention also provides a kit containing the primer pair.
Further, the kit also comprises Mg2+dNTP, DNA polymerase and PCR Buffer.
The invention also provides an application of the primer pair or the kit in detection of the alfalfa ecotypes A17 and R108.
The invention also provides a method for detecting the ecotypes A17 and R108 of medicago truncatula, which comprises the following steps: performing PCR amplification on DNA of a sample to be detected, and judging whether the sample to be detected contains components of the ecological A17 and/or R108 of the medicago truncatula through detecting whether the amplification product contains DNA fragments of the ecological A17 and/or R108 of the medicago truncatula; wherein the primer used in the PCR amplification comprises the primer pair.
Further, the sample to be detected is a seed.
Furthermore, the genome DNA of the seeds is extracted after the seeds germinate.
Further, the seed genome DNA is extracted after the seed is germinated for 60 to 84 hours on filter paper at the temperature of 22 to 27 ℃.
Further, the PCR amplification conditions are a) pre-denaturation at 94 ℃ for 4 minutes; b) denaturation at 94 ℃ for 30 seconds; c) annealing at 50-56 deg.C for 30 s; d) extension at 72 ℃ for 30 seconds; the steps b) to d) are circulated for 25 to 40 times; e) extension at 72 ℃ for 7 min;
wherein steps b) to d) are preferably cycled 30 to 38 times; more preferably from 32 to 36 cycles;
the annealing temperature is preferably 51-55 ℃; more preferably from 51 to 53 ℃.
Compared with the prior art, the invention has the following beneficial effects:
the primer pair for detecting the ecological types A17 and R108 of the medicago truncatula provided by the invention can simultaneously amplify DNA fragments of the ecological types A17 and R108 of the medicago truncatula, and the amplification products for amplifying the two ecological types of the medicago truncatula are different in length, so that whether a sample to be detected contains the ecological types A17 and R108 can be distinguished by amplifying the sample to be detected once, false positive or false negative caused by difference of amplification efficiency or error of personnel operation during separate amplification is avoided, and the primer pair can also amplify mutant strains of the ecological types A17 and R108 of the medicago truncatula.
The kit containing the primer pair provided by the invention can be widely used by matching with other common reagents in molecular biology experiments.
The primer pair or the kit provided by the invention is used for detecting the ecological type A17 and R108 of the medicago truncatula, the primer pair not only can detect whether the component of the ecological type A17 and/or the ecological type R108 of the medicago truncatula is contained in a sample to be detected, but also can identify the seeds of the ecological type A17 and the ecological type R108 of the medicago truncatula, and the seeds of the two ecological types of the medicago truncatula are extremely similar in appearance and form and are very difficult to distinguish. However, the two ecotypes of medicago truncatula have different functions in the field of molecular biology research, and ecotype A17 is commonly used for T-DNA insertion analysis; ecotype R108 is often used to study related molecular genetic processes because of its small genome, high seed yield, and short seed maturation time. Therefore, if the seeds of ecotype A17 and ecotype R108 are confused, the research on the gene function of medicago truncatula cannot be recovered. Therefore, the identification of the seeds of the two ecotypes has application value and significance.
The method for detecting the ecological types A17 and R108 of the medicago truncatula provided by the invention is time-saving and labor-saving, is simple and convenient to operate, can be well completed in a short time under laboratory conditions, and has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness, convenience and the like. The method is applied to identifying the ecological seeds A17 and R108 of the medicago truncatula, is beneficial to distinguishing the seeds A17 and R108 by seed inspectors, and enables the medicago truncatula to better serve the molecular research of leguminous plants.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a gel electrophoresis chart of the PCR product in example 4 of the present invention;
FIG. 2 is a gel electrophoresis chart of the PCR product in example 4 of the present invention.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the accompanying drawings, and it should be understood that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The invention provides a primer pair for detecting the ecotypes A17 and R108 of medicago truncatula, which comprises a primer NST480-F and a primer NST 480-R; wherein the primer NST480-F has a sequence shown as SEQ ID NO.1, and the primer NST480-R has a sequence shown as SEQ ID NO. 2.
It can be understood that when the sample to be tested only contains ecotype A17, the primer pair can be used for amplifying the DNA fragment of ecotype A17; when the sample to be detected only contains the ecotype R108, the DNA fragment of the ecotype R108 can be amplified by using the primer pair; when the sample to be detected contains both ecotype A17 and ecotype R108, the primer pair can amplify DNA fragments of ecotype A17 and ecotype R108 simultaneously, and the amplified products of ecotype A17 and ecotype R108 have different fragments, and the two amplified products of the primer pair can be distinguished after amplification, so that the sample to be detected can be known to contain both ecotype A17 and ecotype R108 from the amplified products of the primer pair.
The primer NST480-F and the primer NST480-R can simultaneously amplify DNA fragments of the ecological types A17 and R108 of the medicago truncatula, and the lengths of amplification products for amplifying the two ecological types of the medicago truncatula are different, so that whether the ecological type A17 and/or R108 is contained in a sample to be detected or not can be distinguished by amplifying the sample to be detected once, false positive or false negative caused by difference of amplification efficiency or error of manual operation during separate amplification is avoided, and the primer pair can also amplify mutant strains of the ecological types A17 and R108 of the medicago truncatula.
In an amplification product of the primer pair, a DNA fragment of the alfalfa ecotype A17 of the tribulus terrestris amplified by the primer NST480-F and the primer NST480-R has a sequence shown as SEQ ID NO.3, the length of the sequence fragment is 176bp, and a complementary sequence of the sequence fragment is shown as SEQ ID NO. 4; the DNA fragment of the alfalfa ecotype R108 amplified by the primer NST480-F and the primer NST480-R has a sequence shown as SEQ ID NO.5, the length of the sequence fragment is 167bp, and the complementary sequence of the sequence fragment is shown as SEQ ID NO. 6.
In some alternative embodiments, primer NST480-F and primer NST480-R are modified; the modification may be, for example, but not limited to, phosphorylation, biotin labeling, digoxigenin labeling, fluorophore labeling, thio-modification, deoxyuracil modification, or deoxyhypoxanthine modification. It is to be understood that the present invention is not limited to the modification of the primer as long as it complies with the conventional experimental principles of molecular biology experiments. In some preferred embodiments, the primers are modified using fluorescent labels, and the primers modified with fluorescent labels can be used for fluorescent quantitative PCR.
The invention also provides a kit containing the primer pair. The primer pair is prepared into a kit in advance, so that the experimental efficiency can be improved, and the kit can be widely used by matching with other common reagents in molecular biology experimentsIts application is disclosed. For example, the kit optionally includes Mg2+PCR reagents such as dNTPs and DNA polymerases can be used as a PCR amplification kit, and when a fluorescent dye is further included, the PCR reagent can be used as a fluorescent quantitative PCR kit. It can be understood that the kit can be used for detecting whether the sample to be detected independently contains the Medicago truncatula ecological type A17 or the Medicago truncatula ecological type R108 or whether the sample to be detected simultaneously contains the Medicago truncatula ecological type A17 or the Medicago truncatula ecological type R108; when the kit also comprises primers for detecting other species, the kit can also be used for simultaneously detecting samples of multiple species.
The invention also provides an application of the primer pair or the kit in detection of the alfalfa ecotypes A17 and R108. The primer pair can detect whether the components of the alfalfa ecotype A17 and/or the alfalfa ecotype R108 are contained in a sample to be detected, and more importantly, the primer pair can identify the seeds of the alfalfa ecotype A17 and the alfalfa ecotype R108, and the seeds of the alfalfa of the two ecotypes are extremely similar in appearance and form and are very difficult to distinguish. However, the two ecotypes of medicago truncatula have different functions in the field of molecular biology research, and ecotype A17 is commonly used for T-DNA insertion analysis; ecotype R108 is often used to study related molecular genetic processes because of its small genome, high seed yield, and short seed maturation time. Therefore, if the seeds of ecotype A17 and ecotype R108 are confused, the research on the gene function of medicago truncatula cannot be recovered. Therefore, the identification of the seeds of the two ecotypes has application value and significance.
The invention also provides a method for detecting the ecotypes A17 and R108 of medicago truncatula, which comprises the following steps: carrying out PCR amplification on DNA of a sample to be detected, and judging whether the sample to be detected contains components of the alfalfa ecotype A17 and/or R108 or not by detecting whether the amplified product contains DNA fragments of the alfalfa ecotype A17 and/or R108 or not; wherein the primers used for PCR amplification comprise the primer pair, namely a primer NST480-F and a primer NST 480-R. It is understood that the primers used in the PCR amplification may comprise other primer pairs in addition to the primer NST480-F and the primer NST480-R, so as to achieve the purpose of simultaneously amplifying other target fragments. For example, when it is required to detect whether the Medicago truncatula ecotypes A17 and R108 are doped with other species and other ecotypes, corresponding primers can be added to perform composite PCR, the invention does not limit the addition of other primer pairs, and it can be understood that the addition of another primer pair should not affect the amplification efficiency of the primer pair of the invention. It is understood that the PCR may be, for example, but not limited to, general PCR, fluorescence quantitative PCR, or high resolution solubility curve (HRM), and the invention is not limited to the type of PCR, as long as the chain polymerase reaction can be performed using the primer pair provided by the invention; the invention can also further improve the PCR system and the used reagent to enhance the reaction efficiency of PCR, but the improvement is based on the primer pair provided by the invention when in amplification.
The method for detecting the ecological types A17 and R108 of the medicago truncatula provided by the invention is time-saving and labor-saving, is simple and convenient to operate, can be well completed in a short time under laboratory conditions, and has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness, convenience and the like.
In some preferred embodiments, the sample to be tested is the seed of medicago truncatula. The method can effectively identify the seeds of the medicago truncatula with different ecotypes A17 and R108, is beneficial to distinguishing the seeds A17 and R108 by seed inspectors, enables the medicago truncatula to better serve the molecular research of leguminous plants, has the characteristics of strong sensitivity, high accuracy, strong repeatability, rapidness, convenience and the like, can also identify the authenticity of a large batch of medicago truncatula seeds, and provides a feasible basis for ensuring the purity detection of the medicago truncatula seeds.
In some preferred embodiments, the genomic DNA of the seed is extracted after the seed has germinated. In some alternative embodiments, the seed genomic DNA is extracted after germinating the seeds on filter paper for 60-84h at 22-27 ℃. Alternatively, the temperature at which the seeds germinate may be, for example, but not limited to, 22 ℃, 23 ℃, 24 ℃, 25 ℃, 26 ℃ or 27 ℃, preferably 25 ℃; alternatively, the time for seed germination may be, for example, but not limited to, 60h, 62h, 65h, 70h, 72h, 75h, 78h, 80h or 84h, preferably 72 h; preferably, the seeds are germinated by a double-layer filter paper germination method. Because the seed coat is thick and is not easy to break, the seed is germinated first, which is convenient for extracting the DNA of the seed subsequently, and the method of SDS is preferably adopted to extract the DNA of the seed.
In some alternative embodiments, the PCR amplification system is a 20. mu.l system comprising TaKaRa 2 XPCR TaqMix 10. mu.l, primer NST 480-F1. mu.l at a concentration of 50 ng/. mu.l DNA template, primer NST 480-R1. mu.l at a concentration of 10nM and ddH2O7 μ l; in the PCR amplification reaction for detection, 20 mul system can meet the requirement of the detection dosage of the amplified product. It will be appreciated that the PCR system described above can be adapted and optimised to the actual experimental and testing conditions.
In some alternative embodiments, the PCR amplification conditions are a) pre-denaturation at 94 ℃ for 4 minutes; b) denaturation at 94 ℃ for 30 seconds; c) annealing at 50-56 deg.C for 30 s; d) extension at 72 ℃ for 30 seconds; e) extension at 72 ℃ for 7 min; wherein steps b) -d) are cycled 25-40 times. Alternatively, the annealing temperature may be, for example, but not limited to, 50 ℃, 51 ℃, 52 ℃, 53 ℃, 54 ℃, 55 ℃ or 56 ℃, preferably 50 to 56 ℃, more preferably 52 ℃; alternatively, the number of cycles of steps b) -d) may be, for example but not limited to, 25, 28, 30, 32, 35, 38 or 40, preferably 32-36. The PCR amplification conditions can be adjusted and optimized according to the change of the PCR system.
In some alternative embodiments, for example, but not limited to, detecting the PCR amplification product by using polyacrylamide gel electrophoresis, agarose gel electrophoresis, capillary gel electrophoresis, or the like, directly sequencing the PCR product, or optionally detecting the PCR amplification product without using additional technical means when using a method such as fluorescence quantitative PCR or HRM, or the like, which can display the product during PCR amplification, and thus it is understood that the invention is not limited to the detection method of the PCR product. In a preferred embodiment, the method for detecting the amplification product by polyacrylamide gel electrophoresis is low in cost and high in speed, and does not need to modify a primer additionally; PAGE gels with 6% -10% gel content are preferably used, for example, but not limited to PAGE gels with 6%, 7%, 8%, 9% or 10% concentration, and PAGE gels with 8% concentration are preferred, and the electrophoretic bands can be made clearer by adjusting the conditions for optimizing the electrophoresis.
The following examples are provided to further illustrate the advantageous effects of the present invention.
Example 1 primer pair for detecting Medicago truncatula ecotypes A17 and R108
The embodiment provides a primer pair for detecting the ecotypes A17 and R108 of medicago truncatula, which comprises a primer NST480-F and a primer NST480-R, wherein the primer NST480-F has a sequence shown in SEQ ID NO.1, and the primer NST480-R has a sequence shown in SEQ ID NO. 2.
NST480-F(5′-3′)：GGAGAACAATGAGAACAACAATG
NST480-R(5′-3′)：GACCACCATCACCACATGC
Example 2 kit for detecting Medicago truncatula ecotypes A17 and R108
The embodiment provides a kit for detecting the ecotypes A17 and R108 of medicago truncatula, which comprises the following components: primer NST480-F and primer NST480-R, 2 XPCR Master and ddH2O；
Wherein the 2 XPCR Master contains 3mM MgCl20.2mM dNTP, 0.1U/. mu.l Taq and 2 XPCR Buffer.
Example 3A method for identifying the seeds of Medicago truncatula ecotypes A17 and R108
The embodiment provides a method for identifying seeds of alfalfa ecotypes A17 and R108, which comprises the following steps:
A) collecting seeds with different mutants of the ecological type A17 and R108 of the medicago truncatula, germinating for 72 hours at 25 ℃ by adopting a double-layer filter paper germination method, and extracting genome DNA of the germinated seeds for later use by an SDS method;
B) performing PCR amplification on the genomic DNA extracted in the step A) by using a primer NST480-F and a primer NST 480-R;
the PCR amplification system is a 20-mu-l system which comprises TaKaRa 2 XPCR TaqMix 10 mu l, DNA template 1 mu l with the concentration of 50 ng/mu l, primer NST 480-F1 mu l with the concentration of 10nM, primer NST480-R1 mu l with the concentration of 10nM and ddH2O 7μl；
PCR amplification procedure: a) pre-denaturation at 94 ℃ for 4 min; b) denaturation at 94 ℃ for 30 seconds; c) annealing at 52 ℃ for 30 seconds; d) extension at 72 ℃ for 30 seconds; the steps b) to d) are cycled for 35 times; e) extension at 72 ℃ for 7 min;
C) and (3) detecting a PCR product: detection was performed using 8% PAGE gel, 100ml system, 53.0ml H20, 26.3ml of polypropylene, 20ml of 5 XTBE, 700. mu.l of 35% ammonium persulfate, 70. mu.l of TEMED, solidifying for 50min, performing electrophoresis at 200V for 1h40min in a vertical plate electrophoresis apparatus, then dyeing with nucleic acid dye, and performing photography on a gel imager; judging whether the seeds are ecotype A17 or ecotype R108 according to the amplified product fragments.
EXAMPLE 4 amplification of Medicago truncatula seed DNA with primer NST480-F and primer NST480-R
Taking 30 different mutant strain seeds in alfalfa ecotype A17, wherein the seed information is shown in Table 1; taking 30 different mutant strain seeds in the alfalfa ecotype R108, wherein the seed information is shown in Table 2; germinating all the seeds at 25 ℃ for 72 hours by adopting a double-layer filter paper germination method, extracting genome DNA of the germinated seeds by adopting an SDS (sodium dodecyl sulfate) method, diluting the concentration of the genome DNA to 50 ng/mu l as a template, and carrying out PCR (polymerase chain reaction) amplification on a system, reaction conditions and an electrophoresis method of an amplification product in the same way as in the example 3; the results are shown in FIGS. 1 and 2, wherein each lane represents a sample as shown in tables 1 and 2, and lane M represents Marker; as can be seen from FIGS. 1 and 2, the electrophoretic bands using the genomic DNA of the seeds of Medicago truncatula ecotypes A17 and R108 as templates are clear and bright, the electrophoretic band using the genomic DNA of the seeds of Medicago truncatula ecotype A17 as templates is 176bp, the electrophoretic band using the genomic DNA of the seeds of Medicago truncatula ecotype R108 as templates is 167bp, and the primers NST480-F and NST480-R can amplify the DNA of various mutants.
TABLE 1 Medicago truncatula ecotype A17 mutant information
TABLE 2 alfalfa ecotypic R108 mutant information
Example 5 primer NST480-F and primer NST480-R
To further verify the validity of primers NST480-F and NST480-R, DNA fragments of the amplification products of Medicago truncatula ecotypes A17 and R108 were sequenced. The results show that the amplification product fragments of the alfalfa ecotypes A17 and R108 both contain primer NST480-F and primer NST 480-R.
PCR amplification is carried out by taking 50 ng/mu l of alfalfa ecotype A17 genome DNA as a template and adopting primers NST480-F and NST 480-R. The PCR system and method were the same as in example 3. Detecting the PCR product in 2% agarose, recovering DNA fragment with length about 170bp, connecting pGEM-T vector to obtain pGEM-T-NST480-A17 recombinant plasmid, and transforming the plasmid into Escherichia coli DH5 alpha competent cell. E.coli containing pGEM-T-NST480-A17 plasmid is smeared on LB culture medium containing Amp, IPTG and X-Gal, cultured overnight at 37 ℃, 3 positive clone bacterial plaques are picked, and cultured with shaking overnight at 37 ℃ in LB liquid culture medium containing Amp. After the detection, the bacterial liquid conforms to the size of the expected band, the bacterial liquid is sent to Shanghai biological engineering Co., Ltd for sequencing, and 3 positive clone bacterial strains are selected and sent for sequencing. The result shows that the primer NST480-F and the primer NST480-R can well amplify the DNA fragment of the alfalfa ecotype A17, and a 176bp special gene fragment is amplified. Wherein the amplified fragment of the alfalfa ecotype A17 has a sequence shown as SEQ ID NO.3, the length of the sequence fragment is 176bp, and the complementary sequence is shown as SEQ ID NO. 4.
PCR amplification is carried out by taking 50 ng/mu l of alfalfa ecotype R108 genome DNA as a template and adopting primers NST480-F and NST 480-R. The PCR system and method were the same as in example 3. Detecting the PCR product with 2% agarose, recovering DNA fragment of 167bp length, connecting with pGEM-T vector to obtain pGEM-T-NST480-R108 recombinant plasmid, and transforming the plasmid into Escherichia coli DH5 alpha competent cell. Coating the Escherichia coli containing pGEM-T-NST480-R108 plasmid on LB culture medium containing Amp, IPTG and X-Gal, culturing overnight at 37 ℃, picking 3 positive clone bacterial plaques, and culturing overnight in LB liquid culture medium containing Amp at 37 ℃ with shaking. After the detection, the bacterial liquid conforms to the size of the expected band, the bacterial liquid is sent to Shanghai biological engineering Co., Ltd for sequencing, and 3 positive clone bacterial strains are selected and sent for sequencing. The result shows that the primer NST480-F and the primer NST480-R can well amplify the DNA fragment of the alfalfa ecotype R108, and a 167bp special gene fragment is amplified. Wherein the amplified fragment of the alfalfa ecotype R108 has a sequence shown as SEQ ID NO.5, the length of the sequence fragment is 167bp, and the complementary sequence is shown as SEQ ID NO. 6.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
SEQUENCE LISTING
<110> Lanzhou university
<120> primer pair, kit containing primer pair, application of primer pair and method for detecting alfalfa ecotypes A17 and R108
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence
<400> 1
ggagaacaat gagaacaaca atg 23
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence
<400> 2
gaccaccatc accacatgc 19
<210> 3
<211> 176
<212> DNA
<213> Medicago truncatula (Medicago truncatula)
<400> 3
ggagaacaat gagaacaaca atgatgggta tcatgcaatt attcaagtag atatggctaa 60
tgaaaatgaa gggtcattct ctgatcatca tcatcatcat catcataaca acatggttaa 120
taatccatta gaggcatcat catcatcaat ggtgatagca tgtggtgatg gtggtc 176
<210> 4
<211> 176
<212> DNA
<213> Medicago truncatula (Medicago truncatula)
<400> 4
cctcttgtta ctcttgttgt tactacccat agtacgttaa taagttcatc tataccgatt 60
acttttactt cccagtaaga gactagtagt agtagtagta gtagtattgt tgtaccaatt 120
attaggtaat ctccgtagta gtagtagtta ccactatcgt acaccactac caccag 176
<210> 5
<211> 167
<212> DNA
<213> Medicago truncatula (Medicago truncatula)
<400> 5
ggagaacaat gagaacaaca atgatgggta tcatgcaatt attcaagtag atatggctaa 60
tgaaaatgaa ggatcattct ctgatcatca tcatcataac aacatggtta ataatccatt 120
agaggcatca tcatcatcaa tggtgatagc atgtggtgat ggtggtc 167
<210> 6
<211> 167
<212> DNA
<213> Medicago truncatula (Medicago truncatula)
<400> 6
cctcttgtta ctcttgttgt tactacccat agtacgttaa taagttcatc tataccgatt 60
acttttactt cctagtaaga gactagtagt agtagtattg ttgtaccaat tattaggtaa 120
tctccgtagt agtagtagtt accactatcg tacaccacta ccaccag 167
Claims (9)
1. A primer pair for detecting the ecotypes A17 and R108 of medicago truncatula is characterized by comprising a primer NST480-F and a primer NST 480-R;
the nucleotide sequence of the primer NST480-F is SEQ ID NO.1, and the nucleotide sequence of the primer NST480-R is SEQ ID NO. 2.
2. The primer pair according to claim 1, wherein primer NST480-F and primer NST480-R are modified;
the modification comprises adding a label at the 5 'end and the 3' end of the primer;
the label comprises a fluorescent label, a biotin label or a digoxigenin label.
3. A kit comprising the primer pair of claim 1 or 2.
4. The kit of claim 3, further comprising Mg2+dNTP, DNA polymerase and PCR Buffer.
5. Use of the primer pair of claim 1 or 2 or the kit of claim 3 or 4 for detecting Medicago truncatula ecotypes A17 and R108.
6. A method for detecting the ecotypes A17 and R108 of medicago truncatula, which is characterized by comprising the following steps: performing PCR amplification on DNA of a sample to be detected, and judging whether the sample to be detected contains components of the ecological A17 and/or R108 of the medicago truncatula through detecting whether the amplification product contains DNA fragments of the ecological A17 and/or R108 of the medicago truncatula;
wherein, the primers used in the PCR amplification are the primer pair of claim 1 or 2;
the sample to be detected is medicago truncatula seeds;
the length of the amplified DNA fragment of the alfalfa ecological type A17 seed is 176bp, and the length of the amplified DNA fragment of the alfalfa ecological type R108 seed is 167 bp.
7. The method of claim 6, wherein the genomic DNA of the seed is extracted after the seed is germinated.
8. The method of claim 7, wherein the seed genomic DNA is extracted after germinating the seeds on filter paper for 72h at 25 ℃.
9. The method of claim 7, wherein the PCR amplification conditions are a) pre-denaturation at 94 ℃ for 4 minutes; b) denaturation at 94 ℃ for 30 seconds; c) annealing at 52 ℃ for 30 seconds; d) extension at 72 ℃ for 30 seconds; the steps b) to d) are cycled for 35 times; e) extension at 72 ℃ for 7 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810532326.7A CN108411030B (en) | 2018-05-25 | 2018-05-25 | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810532326.7A CN108411030B (en) | 2018-05-25 | 2018-05-25 | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108411030A CN108411030A (en) | 2018-08-17 |
| CN108411030B true CN108411030B (en) | 2021-05-14 |
Family
ID=63140747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810532326.7A Active CN108411030B (en) | 2018-05-25 | 2018-05-25 | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108411030B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112195260B (en) * | 2020-10-14 | 2023-09-29 | 广州海关技术中心 | Primer, probe, kit and detection method for alfalfa component identification and detection |
| CN114231659B (en) * | 2022-01-05 | 2023-06-23 | 兰州大学 | Primer pair for detecting thistle plants in alfalfa, application of primer pair and detection method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011008698A1 (en) * | 2009-07-13 | 2011-01-20 | The Samuel Roberts Noble Foundation, Inc. | Plants with modified lignin content and methods for production thereof |
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN104059937A (en) * | 2013-03-18 | 2014-09-24 | 中国农业大学 | New application of protein derived from clover and its coding genes |
| FR3012471A1 (en) * | 2013-10-31 | 2015-05-01 | Centre Nat Rech Scient | MICROPEPTIDES AND THEIR USE FOR MODULATING GENE EXPRESSION |
| CN104815324A (en) * | 2007-04-04 | 2015-08-05 | 传染性疾病研究院 | Immunogenic compositions comprising mycobacterium tuberculosis polypeptides and fusions thereof |
| CN106191109A (en) * | 2016-07-19 | 2016-12-07 | 中国农业科学院北京畜牧兽医研究所 | Identify the VIGS silencing system of alfalfa MsPDS gene and structure thereof and authentication method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9074216B2 (en) * | 2008-12-10 | 2015-07-07 | The Samuel Roberts Noble Foundation, Inc. | Methods and compositions for altering plant biomass |
-
2018
- 2018-05-25 CN CN201810532326.7A patent/CN108411030B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104815324A (en) * | 2007-04-04 | 2015-08-05 | 传染性疾病研究院 | Immunogenic compositions comprising mycobacterium tuberculosis polypeptides and fusions thereof |
| WO2011008698A1 (en) * | 2009-07-13 | 2011-01-20 | The Samuel Roberts Noble Foundation, Inc. | Plants with modified lignin content and methods for production thereof |
| CN102643896A (en) * | 2012-01-14 | 2012-08-22 | 兰州大学 | Kit for identifying authenticity of medicago sativa seed and detection method thereof |
| CN104059937A (en) * | 2013-03-18 | 2014-09-24 | 中国农业大学 | New application of protein derived from clover and its coding genes |
| FR3012471A1 (en) * | 2013-10-31 | 2015-05-01 | Centre Nat Rech Scient | MICROPEPTIDES AND THEIR USE FOR MODULATING GENE EXPRESSION |
| CN106191109A (en) * | 2016-07-19 | 2016-12-07 | 中国农业科学院北京畜牧兽医研究所 | Identify the VIGS silencing system of alfalfa MsPDS gene and structure thereof and authentication method |
Non-Patent Citations (5)
| Title |
|---|
| Genome variations account for different response to three mineral elements between Medicago truncatula ecotypes Jemalong A17 and R108;Tian-Zuo Wang等;《BMC Plant Biology》;20140506;第14卷;122 * |
| Medicago truncatula ecotypes A17 and R108 differed in their response to iron deficiency;Gen Li等;《J Plant Physiol》;20140501;第171卷(第8期);第639-647页 * |
| Medicago truncatula NAC secondary wall thickening promoting factor 1 (NST1) mRNA, complete cds.;Zhao,Q.等;《DDBJ》;20100718;GU144511 * |
| PREDICTED: Medicago truncatula NAC domain-containing protein 43 (LOC25500625), mRNA;NCBI;《GenBank》;20180423;"ORIGIN" * |
| 蒺藜苜蓿遗传转化体系研究进展;王宇等;《草业科学》;20140331;第31卷(第03期);第504-511页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108411030A (en) | 2018-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Target region amplification polymorphism: a novel marker technique for plant genotyping | |
| CN108374054B (en) | Rice SSR molecular markers suitable for capillary electrophoresis detection technology and application thereof | |
| CN108411030B (en) | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula | |
| CN107630103B (en) | CAPS molecular marker method for identifying rice varieties and application | |
| CN113621734B (en) | Molecular marker primer combination for rapidly identifying super-large fruit type characters of waxberries and application thereof | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
| CN107058494B (en) | Method for simplifying purity identification of common vetch variety by adopting SCoT molecular marker | |
| CN109694923B (en) | Characteristic sequence, marker primer and identification method of apocarya variety Jingzhou No. 1 | |
| CN110512023B (en) | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence | |
| CN107988418B (en) | Primer group, kit and method for pure heterozygous identification of transgenic papaya YK16-0-1 transformant | |
| KR102332688B1 (en) | Molecular marker based on nuclear genome sequence for discriminating Panax ginseng 'SeonHyang' cultivar and uses thereof | |
| KR102286871B1 (en) | Molecular marker for discriminating branchless watermelon cultivar and uses thereof | |
| KR102335806B1 (en) | Molecular marker based on chloroplast genome sequence for discriminating Zizyphus jujuba 'SanJo' cultivar and uses thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN108676904B (en) | Primer pair, reagent and kit, application thereof and method for identifying whether alfalfa product contains peanuts | |
| CN109694922B (en) | Characteristic sequence, labeled primer and identification method of pecan variety dependendable | |
| KR102174274B1 (en) | Molecular marker for discriminating Zizyphus jujuba 'Boeun' and 'Chuseok' cultivar and uses thereof | |
| CN108441577B (en) | Primer pair, kit and application thereof, and method for detecting whether alfalfa product contains soybeans | |
| CN111549174B (en) | Special primer for identifying variety of water chestnut and water chestnut variety identification method | |
| JP6853523B2 (en) | PCR using helicase | |
| CN111321139A (en) | Composition for cat genotyping and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |