CN104059937A - New application of protein derived from clover and its coding genes - Google Patents
New application of protein derived from clover and its coding genes Download PDFInfo
- Publication number
- CN104059937A CN104059937A CN201310085151.7A CN201310085151A CN104059937A CN 104059937 A CN104059937 A CN 104059937A CN 201310085151 A CN201310085151 A CN 201310085151A CN 104059937 A CN104059937 A CN 104059937A
- Authority
- CN
- China
- Prior art keywords
- plant
- mtwrky76
- dross
- protein
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a new application of protein derived from clover and its coding genes. The new application provided in the invention is a method for cultivating transgenic nodulation plants with high nodulation capability and/or high stress tolerance by using MtWRKY76 coding nucleic acid molecules. The method for cultivating transgenic nodulation plants with high nodulation capability and/or high stress tolerance provided by the invention comprises the step of introducing the MtWRKY76 gene into a receptor nodulation plant to obtain a transgenic nodulation plant with nodulation capability and/or stress tolerance higher than those of the receptor nodulation plant; the MtWRKY76 is protein as shown in the following a) or b), wherein a) protein with an amino acid sequence as shown in SEQ ID No.2; b) protein which is obtained by substitution and/or deletion and/or addition of one or more than one amino acid residue in SEQ ID No.2, is related to the nodulation capability and/or stress tolerance of nodulation plants, and is derived from a). The new application of the invention has significant value in cultivation of transgenic leguminous crops with salt resistance, drought tolerance, and enhanced nodulation capability.
Description
Technical field
The present invention relates to a new purposes that derives from protein and the encoding gene thereof of clover.
Background technology
The result that leguminous plants and root nodule bacterium symbiosis are done is mutually to have produced a new plant organ-root nodule.The formation of root nodule not only relates to symbiosis both sides' minute subdialogue and regulation and control, simultaneously also relevant with environmental factors, as moisture, mineral nutrient element, temperature, heavy metal, sodium salt, CO
2, soil type and pH etc.But up to now, people also know little about it to the understanding of the molecule mechanism of the regulatory mechanism of fabaceous nodulation and nitrogen fixation process, therefore excavating the key gene in leguminous plants nodulation and nitrogen fixation approach and be familiar with its function, is the important means that solves leguminous plants nodulation and nitrogen fixation ability.
Cut that type clover has that genome is little, chromosome number is 2 * 8 (2n=16), vegetative period is short, self-pollination, nodule nitrogen fixation, genetic transformation efficiency high, and nearer with pulse family staple crop sibship, so be selected as model legume.Research shows, some abiotic stress, and for example salt stress, understands the nodulation and nitrogen fixation that directly affect plant, and some transcription factors of therefore cutting type clover may participate in abiotic stress and dross simultaneously, and there is very big-difference in this point and Arabidopis thaliana.Based on above feature, cutting type clover becomes the fabaceous focus of research.Therefore clover is very important high quality forage, and resistance and the nodulation and nitrogen fixation of studying clover improve alfalfa quality, excavates gene that resistance and nodulation and nitrogen fixation are relevant for cultivating good quality and high output New alfalfa cultivars, has important biological significance and economic worth.
Summary of the invention
Technical problem to be solved by this invention is to provide the new purposes that derives from the protein MtWRKY76 and the coding nucleic acid molecule that cut type clover (Medicago truncatula).
Wherein, SEQ ID No.2 is comprised of 285 amino-acid residues.
A kind of new purposes provided by the present invention is to utilize the coding nucleic acid molecule of MtWRKY76 to cultivate the method for the high and/or transgenosis dross plant that resistance of reverse is high of Noduling ability.
The method of the transgenosis dross plant that cultivation Noduling ability provided by the present invention is high and/or resistance of reverse is high, comprises to importing MtWRKY76 gene in acceptor dross plant and obtains Noduling ability and/or resistance of reverse higher than the step of the transgenosis dross plant of described acceptor dross plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to dross plant Noduling ability and/or resistance of reverse by a) derivative protein.
Described dross plant refers to the plant that can form root nodule after velamen nitrogen-fixing microorganism (root nodule bacterium and/or frankia) infects, comprise leguminous plants and non-leguminous plant, wherein non-leguminous plant refers to coffin, Horsetail Beefwood, red bayberry, Fruit of Thorny Elaeagnus, sea-buckthorn of xylophyta etc.
Described leguminous plants specifically can be clover, and described clover can be and cuts type clover, as medicago truncatula A17, and medicago truncatula R-108.In an embodiment of the present invention, described clover is for cutting type clover medicagotruncatula R-108 or medicago truncatula A17.
The new purposes of another kind provided by the present invention is the method for utilizing the coding nucleic acid molecule of MtWRKY76 cultivate to cultivate the transgenic plant that resistance of reverse is high.
The method of the transgenic plant that cultivation resistance of reverse provided by the present invention is high, comprises to importing MtWRKY76 gene in recipient plant and obtains resistance of reverse higher than the step of the transgenic plant of described recipient plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to plant stress tolerance by a) derivative protein.
Wherein, described recipient plant is for can be dicotyledons or monocotyledons, described dicotyledons can be Arabidopis thaliana or dross plant, described dross plant can be leguminous plants and non-leguminous plant, described leguminous plants can be clover, described clover can be and cuts type clover, as medicago truncatula A17, and medicago truncatula R-108.In embodiments of the present invention, described clover is for cutting type clover medicago truncatula R-108 or medicagotruncatula A17, and described Arabidopis thaliana is the environmental Arabidopis thaliana of columbia.
Wherein said MtWRKY76 gene can first be modified as follows, then imports in recipient plant, to reach better expression effect:
1) modify according to actual needs and optimize, so that gene efficient expression; For example, the codon that can have a preference for according to recipient plant changes its codon to meet plant-preference in the aminoacid sequence that keeps MtWRKY76 gene of the present invention; In optimizing process, preferably can make to keep certain GC content in the encoding sequence after optimizing, to realize best the high level expression of quiding gene in plant, wherein GC content can be 35%, more than 45%, more than 50% or more than approximately 60%;
2) modify the gene order of contiguous initial methionine, so that translation is effectively initial; For example, utilize known effective sequence in plant to modify;
3) be connected with the promotor of various expression of plants, be beneficial to its expression in plant; Described promotor can comprise that composing type, induction type, sequential regulate, grow adjusting, Chemical Regulation, tissue preferably and tissue-specific promoter; The selection of promotor will be along with expression time and space requirement and is changed, and depends on target species; For example tissue or the specific expressing promoter of organ, acceptor in what period of growing is determined as required; Although proved that the many promotors that derive from dicotyledons are operational in monocotyledons, vice versa, but ideally, select dicotyledons promotor for the expression of dicotyledons, monocotyledonous promotor is for the expression of monocotyledons;
4), with applicable Transcription Termination sub-connection, also can improve the expression efficiency of gene of the present invention; For example derive from the tml of CaMV, derive from the E9 of rbcS; Any known available terminator working in plant can be connected with gene of the present invention;
5) introduce enhancer sequence, for example, for example, as intron sequences (deriving from Adhl and bronzel) and virus leader sequence (deriving from TMV, MCMV and AMV).
Above, the encoding sequence of described MtWRKY76 gene specifically can be the 74-931 position Nucleotide of SEQ ID No.1.
Described MtWRKY76 gene can import object plant by MtWRKY76 expression casette or the MtWRKY76 that contains described MtWRKY76 expression casette expression vector.
The expression casette of MtWRKY76 described in the present invention all can contain described MtWRKY76 gene and start the promotor of described MtWRKY76 genetic transcription.The expression casette of MtWRKY76 described in the present invention all refers in host cell, to express the DNA of the MtWRKY76 shown in SEQ ID No.2, this DNA not only can comprise the promotor that starts described MtWRKY76 genetic transcription, also can comprise the terminator that stops described MtWRKY76 genetic transcription.Further, described MtWRKY76 expression casette also can comprise enhancer sequence.Can be used for promotor of the present invention includes but not limited to: constitutive promoter, the promotor that tissue, organ and growth are special, and inducible promoter.The example of promotor includes but not limited to: the constitutive promoter 35S of cauliflower mosaic virus; From the wound-induced type promotor of tomato, leucine aminopeptidase (" LAP ", the people such as Chao (1999) Plant Physiol120:979-992); From chemical inducible promoter of tobacco, pathogeny 1 (PR1) (being induced by Whitfield's ointment and BTH (diazosulfide-7-carbothioic acid carbothiolic acid S-methyl esters)) that be correlated with; Tomato proteinase inhibitor II promotor (PIN2) or LAP promotor (all available jasmonic acid Yue ester inductions); Heat-shocked promotor (United States Patent (USP) 5,187,267); Tsiklomitsin inducible promoter (United States Patent (USP) 5,057,422); Seed specific promoters, as Millet Seed specificity promoter pF128(CN101063139B (Chinese patent 200710099169.7)), the special promotor of seed storage protein matter (for example, phaseollin, napin, the promotor of oleosin and soybean beta conglycin (people (1985) EMBO such as Beachy is J.4:3047-3053)).All reference cited herein all quote in full.Suitable transcription terminator includes but not limited to: Agrobacterium rouge alkali synthetase terminator (NOS terminator), cauliflower mosaic virus CaMV35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (referring to, such as: the people (I such as Odell
985) Nature313:810; The people such as Rosenberg (1987) Gene, 56:125; The people such as Guerineau (1991) Mol.Gen.Genet, 262:141; Proudfoot (1991) Cell, 64:671; The people Genes Dev. such as Sanfacon, 5:141; The people such as Mogen (1990) Plant Cell, 2:1261; The people such as Munroe (1990) Gene, 91:151; The people such as Ballad (1989) Nucleic Acids Res.17:7891; The people such as Joshi (1987) Nucleic Acid Res., 15:9627).In an embodiment of the present invention, the constitutive promoter 35S that the promotor that starts described MtWRKY76 genetic transcription in described MtWRKY76 expression casette is cauliflower mosaic virus, the terminator that stops described MtWRKY76 genetic transcription is NOS.
The recombinant expression vector that available existing plant expression vector construction contains described MtWRKY76 expression casette.Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.As pROKII, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb(CAMBIA company) etc.Described plant expression vector also can comprise 3 ' end untranslated region of foreign gene, comprises the DNA fragmentation of polyadenylic acid signal and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylic acid signal joins 3 ' end of mRNA precursor, and the non-translational region of transcribing as Agrobacterium crown-gall nodule induction (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean stores protein gene) 3 ' end all has similar functions.While using gene constructed plant expression vector of the present invention, also can use enhanser, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can synthesize.Translation initiation region can be from transcription initiation region or structure gene.For the ease of transgenic plant cells or plant are identified and are screened, can process plant expression vector used, the coding that can express in plant as added can produce the enzyme of colour-change or the gene (gus gene of luminophor, luciferase genes etc.), antibiotic marker gene (as is given the nptII gene to kantlex and associated antibiotic resistance, give the bar gene to weedicide phosphinothricin resistance, give the hph gene to microbiotic hygromycin resistance, with the dhfr gene of giving methatrexate resistance, give the EPSPS gene to glyphosate resistance) or anti-chemical reagent marker gene etc. (as anti-weedkiller gene), the mannose-6-phosphate isomerase gene of metabolism seminose ability is provided.
In an embodiment of the present invention, described selectable marker gene is to give the hygromycin B phosphotransferase of microbiotic hygromycin resistance (hph) gene hyg.In an embodiment of the present invention, described MtWRKY76 gene imports object plant by the MtWRKY76 expression vector that contains described MtWRKY76 expression casette.Described MtWRKY76 expression vector is the recombinant expression vector obtaining at the MtWRKY76 encoding sequence shown in the 74-931 position Nucleotide of the multiple clone site insertion SEQ of pCAMBIA1302 ID No.1.
Described MtWRKY76 expression vector can be by being used Ti-plasmids; plant virus carrying agent; directly delivered DNA; microinjection, the conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998; Methodfor Plant Molecular Biology VIII; Academy Press, New York, pp.411-463; Geiserson andCorey, 1998, Plant Molecular Biology (2nd Edition).
When described recipient plant is dross plant, described transgenic plant have following 1)-3) in characteristic: 1) Noduling ability and resistance of reverse are all higher than acceptor dross plant; 2) Noduling ability is higher than acceptor dross plant; 3) resistance of reverse is higher than acceptor dross plant.
When described recipient plant is non-dross plant, the resistance of reverse of described transgenic plant is higher than recipient plant.
Above, described transgenic plant are interpreted as and not only comprise the first-generation transgenic plant that described gene transformation object plant is obtained, also comprise its filial generation.For transgenic plant, can in these species, breed this gene, also available traditional breeding method enters this transgenosis other kind of same species, in commercial variety.Described transgenic plant comprise seed, callus, whole plant and cell.
The new purposes of another kind provided by the present invention is MtWRKY76 or the application of relative biomaterial in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant.
This new purposes specifically can be B1)-B4):
B1) application of MtWRKY76 in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to dross plant Noduling ability and/or plant stress tolerance by a) derivative protein;
B2) nucleic acid molecule of the described MtWRKY76 application in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant of encoding;
The application of the expression cassette of the nucleic acid molecule that B3) contains the described MtWRKY76 that encodes in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant;
The application of the carrier of the nucleic acid molecule that B4) contains the described MtWRKY76 that encodes in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant.
In this new purposes, the definition of all terms is with above.
Above, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.The nucleic acid molecule of described coding MtWRKY76 specifically can be the gene of coding MtWRKY76, and the encoding sequence of the gene of described coding MtWRKY76 specifically can be the 74-931 position Nucleotide of SEQ ID No.1.
Wherein, SEQ ID No.1 is comprised of 938 Nucleotide; coding region be sequence 1 from the 74-931 position of 5 ' end Nucleotide; from the 1-7 position of 5 ' end Nucleotide, be Bgl II restriction enzyme site and protection base; 8-73 position Nucleotide is 3*flag sequence label, and 932-938 position Nucleotide is the restriction enzyme site of BstE II.
In above-mentioned application, B3) described expression cassette specifically can be above-mentioned MtWRKY76 expression casette, and B4) described carrier specifically can be above-mentioned MtWRKY76 expression vector.
Described MtWRKY76 expression casette or the described MtWRKY76 expression vector in aforesaid method and above-mentioned application, mentioned also belong to protection scope of the present invention.
The recombinant microorganism that imports the recombinant microorganism of MtWRKY76 expression casette mentioned above or import MtWRKY76 expression vector mentioned above also belongs to protection scope of the present invention.
Wherein, described recombinant microorganism specifically can be bacterium, yeast, algae and fungi.Wherein, bacterium can be from Escherichia (Escherichia), Erwinia (Erwinia), agrobacterium tumefaciens belongs to (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), Rhodopseudomonas (Pseudomonas), Bacillus (Bacillus) etc.
Above, described long to can be main root long.
Described biomass refers to the whole plant biomass of (being comprised of over-ground part and underground part); Described biomass represents with fresh weight or dry weight.
Experiment showed, that the Noduling ability of the transgenic alfalfa that imports MtWRKY76 gene of the present invention is higher than acceptor clover, the nodule number of transgenic alfalfa is 1.7-1.9 times of acceptor clover, and the weight of the root nodule of transgenic alfalfa is 1.65-1.82 times of acceptor clover.And import the salt tolerance of transgenic alfalfa of MtWRKY76 gene of the present invention and drought tolerance apparently higher than acceptor clover, under salt stress, the main root length that imports the transgenic alfalfa of MtWRKY76 gene of the present invention is 1.7 times of acceptor clover, and plant dry weight is 1.3 times of acceptor clover; Under drought stress, the survival rate that imports the transgenic alfalfa of MtWRKY76 gene of the present invention is 2.7-3.3 times of acceptor clover.Import in addition the transgenic arabidopsis salt tolerance of MtWRKY76 gene of the present invention higher than acceptor Arabidopis thaliana.The present invention has important value for cultivating salt tolerant transgenosis leguminous crop drought-enduring and enhancing Noduling ability.
Accompanying drawing explanation
Fig. 1 is the structural representation of carrier pCAMBIA1302-MtWRKY76.
Fig. 2 is T
2molecular level for transgenic arabidopsis detects.
1,17:1kb DNA ladder, is respectively 250bp from down to up, 500bp, 750bp, 1000bp, 1500bp, 2000bp; 2: negative control, H
2o; 3: positive control; 4: negative control; 5-9,11,12,14-16,18,19 and 21-28:PCR identify positive plant; 10,13 and 20:PCR identify negative plant.
Fig. 3 is T3 for MtWRKY3 transgenic arabidopsis (L2, L5, L8, L10 and L13) with wild-type Arabidopis thaliana at 150mM, 180mM, 190mM, 200mM, 210mM, the germination rate statistical graph under 220mM NaCl coerces.
Fig. 4 is the acquisition that Agrobacterium-mediated Transformation is cut type clover R-108 leaf regeneration plant.
A: the callus of induction; B: the formation of resistance seedling; C: the formation of regrowth; D: transgenic seedling is planted in flowerpot.
Fig. 5 is the PCR evaluation that transgenosis is cut type clover R-108.
1,19:1kb DNA ladder, is respectively 250bp from down to up, 500bp, 750bp, 1000bp, 1500bp, 2000bp; 2: negative control, H
2o; 3: positive control; 4: negative control; 5,7,10-18,21,23-27,29-34,35,37 and 39:PCR identify positive plant; 6,8,9,20,22,28,36 and 38:PCR identify negative plant.
Fig. 6 is that transgenosis is cut type medicago sativa l. 2 and L4 and contrasts (WT, not transgenic alfalfa) at the picture that is not containing and containing the long difference of root on 100mM NaCl.
Left figure is not for containing NaCl, and right figure is for containing 100mM.
Fig. 7 is that transgenosis is cut type medicago sativa l. 2 and L4 and contrasts (WT, not transgenic alfalfa) in the difference long with containing root on 100mMNaCl.
Left figure: transgenosis is cut type medicago sativa l. 2 and L4 and contrasted (WT, not transgenic alfalfa) long statistical graph of root on FN substratum, right figure: transgenosis is cut type clover and contrast (WT, not transgenic alfalfa) long statistical graph of root on the FN of 100mM NaCl substratum.
Fig. 8 is that transgenosis is cut type medicago sativa l. 2 and L4 and contrasts (WT, not transgenic alfalfa) difference of total dry weight on 100mM NaCl.
Left figure: transgenosis is beautiful cuts a type clover and educate phase L2 and L4 and contrast (WT, not transgenic alfalfa) total dry weight statistical graph on FN substratum; Right figure: transgenosis is cut type medicago sativa l. 2 and L4 and to impinging upon total dry weight statistical graph on the FN substratum that contains 100mM NaCl.
Fig. 9 is that transgenosis is cut type medicago sativa l. 2 and L4 and the picture that contrasts the processing of (WT, not transgenic alfalfa) arid.
Upper figure is the management control group that normally waters; Figure below is arid treatment group.
Figure 10 is that transgenosis is cut type medicago sativa l. 2 and L4 and the statistical graph that contrasts the rear survival rate of (WT, not transgenic alfalfa) arid processing.
Figure 11 is that transgenosis is cut type clover strain L2 and L4 and contrasted (WT, not transgenic alfalfa) and cultivate the picture after 30 days at Rhizobium Inoculation.
Figure 12 is that transgenosis is cut type clover strain L2 and L4 and contrasts (WT, not transgenic alfalfa) difference at Rhizobium Inoculation dross number after 30 days.
Figure 13 is that transgenosis is cut type clover strain L2 and L4 and contrasts (WT, not transgenic alfalfa) difference at Rhizobium Inoculation underground part fresh weight after 30 days.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Quantitative experiment in following examples, all arranges and repeats experiment, results averaged.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Biomaterial in following embodiment is as follows:
Cut type clover A17(Medicago truncatula A17) and R-108 (Medicago truncatula R-108): by from French INRA BRC-MTR(Biological Resource Centre for the model species Medicagotruncatula L.) grant.This biomaterial is documented in following document: de Lorenzo L; Merchan F, BlanchetS.Differential expression of the TFIIIA regulatory pathway in response to salt stressbetween Medicago truncatula genotypes.Plant Physiol.2007Dec; 145 (4): 1521-32.The environmental Arabidopis thaliana of columbia (the environmental Arabidopis thaliana (columbia stain of Arabidopsis thalianaas genetic background) of Colombia: purchased from salk company.
Agrobacterium tumefaciens EHA105 is documented in following document: microbiotic suppresses the effect of Agrobacterium and the impact that yezoensis laver is grown, Wang Ping etc., and aquatic science, 2009,28 (7), public Ke Cong China Agricultural University obtains, to repeat the application's experiment.。
Root nodule bacterium Sinorhizobium meliloti1021: granted by French CNRS-INRA-Universit é de Nice SophiaAntipolis.This biomaterial is documented in following document: Frendo P; Harrison J, NormanC.Glutathione and homoglutathione play a critical role in the nodulation process ofMedicago truncatula.Mol Plant Microbe Interact.2005Mar; 18 (3): 254-9.
The clone of embodiment 1, MtWRKY76 gene
1, design Auele Specific Primer, to (MtWRKY76_5 ' and MtWRKY76_3 '), is synthesized by Invitrogen company.
P1F：5’-
AGATCTAGATTACAAAGATCATGATGGTGACTATAAGGACCACGACATCGATTACAAAGATGATGATGATAAAATGGAATCAACATGCGTGGAT-3’；
P1R：5’-GGTGACCTCACCATTTGTCCTTATTAG-3’。
2, an extraction section type clover A17(Medicago truncatula) RNA of whole strain plant, reverse transcription is cDNA;
3, take the cDNA of step 2 is template, with the Auele Specific Primer of step 1, P1F and P1R is carried out to pcr amplification, reclaims pcr amplification product.
4, the pcr amplification product of step 3 is checked order.
Sequencing result is; the sequence of the gene of this PCR product is the sequence 1 in sequence table; sequence 1 is comprised of 938 Nucleotide; coding region be sequence 1 from the 74-931 position of 5 ' end Nucleotide; from the 1-7 position of 5 ' end Nucleotide, be Bgl II restriction enzyme site and protection base; 8-73 position Nucleotide is 3*flag sequence label, and 932-938 position Nucleotide is the restriction enzyme site of BstE II.By this unnamed gene, be MtWRKY76, the albumen called after MtWRKY76 of this genes encoding, the aminoacid sequence of this albumen is shown in the sequence 2 in sequence table, sequence 2 is comprised of 285 amino-acid residues.
5, above-mentioned PCR product is inserted to pMD18T-simple carrier (purchased from TaKaRa bio-engineering corporation), obtain carrier pMD18T-simple-MtWRKY76, sequencing result shows that pMD18T-simple-MtWRKY76 contains the sequence 1 in MtWRKY76(sequence table).
The acquisition of embodiment 2, transgenic arabidopsis and functional study
One, the acquisition of transgenic arabidopsis
1, the structure of recombinant vectors (pCAMBIA1302-MtWRKY76)
(1) with restriction enzyme Bgl II and BstE II double digestion carrier pMD18T-simple-MtWRKY76, reclaim small segment.
(2) use restriction enzyme Bgl II and BstE II double digestion pCAMBIA1302 (purchased from Center for theApplication of Molecular Biology to International Agriclture, www.cambia.org), reclaim carrier framework.
(3) small segment of step (1) is connected with the carrier framework of step (2), obtain connecting product, this is connected to product and transform bacillus coli DH 5 alpha, obtain transformant, extract the plasmid of this transformant, order-checking, shows by sequencing result recombinant vectors called after pCAMBIA1302-MtWRKY76(Fig. 1 that the sequence 1 in insertion sequence table obtains between the Bgl of pCAMBIA1302 II and BstE II restriction enzyme site).
2, the acquisition of transgenic arabidopsis
(1) preparation of agrobacterium tumefaciens competent cell
The mono-colony inoculation of picking agrobacterium tumefaciens EHA105 is in 100mlYEB liquid nutrient medium, and 220rpm, 28 ℃ of shaking culture are to OD
600=0.5; Proceed to aseptic centrifuge tube, the centrifugal 5min of 5000rpm, removes supernatant, adds the CaCl of the 0.15M of 10ml precooling
2the aqueous solution, suspension cell, places 20min on ice gently; 4 ℃, the centrifugal 5min of 5000rpm, remove supernatant, add 4ml precooling containing 10% glycerine (volumn concentration) and 0.15M CaCl
2the aqueous solution, suspend gently; Obtain agrobacterium tumefaciens suspension (EHA105 competent cell), be sub-packed in sterile eppendorf tubes, every pipe 200 μ l, quick-frozen 1min in liquid nitrogen, frozen in-70 ℃.
(2) pCAMBIA1302-MtWRKY76 transforms agrobacterium tumefaciens EHA105
Get 1 μ g pCAMBIA1302-MtWRKY76 plasmid obtained above and add in 200 μ l agrobacterium tumefaciens EHA105 competent cells, mix static 5min; Quick-frozen 1min in liquid nitrogen, 37 ℃ of water-bath 5min, add 1ml YEB liquid nutrient medium, 28 ℃, 150rpm shaking culture 4h; The centrifugal 3min of 5000rpm, abandons supernatant, adds 0.1ml YEB liquid nutrient medium, Eddy diffusion cell; Coat on the YEB solid plate containing 50 μ g/ml kantlex and 50 μ g/ml Rifampins, cultivate about 48h, obtain transformant for 28 ℃.This transformant is carried out to bacterium liquid PCR and identifies, identify that the primer is as follows:
P2F：5’-ATGGAATCAACATGCGTGGAT-3’；
P1R：5’-GGTGACCTCACCATTTGTCCTTATTAG-3’。
Result shows the fragment that obtains about 860bp, proves that pCAMBIA1302-MtWRKY76 successfully proceeds in agrobacterium tumefaciens EHA105.Again PCR is identified to positive transformant extracts plasmid, order-checking, result shows
The 74-938 position nucleotide sequence that contains SEQ ID No.1 in pCAMBIA1302-MtWRKY76.By the sub-called after restructuring of the Agrobacterium-mediated Transformation that contains pCAMBIA1302-MtWRKY76 Agrobacterium EHA105/pCAMBIA1302-MtWRKY76.
(3) arabidopsis thaliana transformation
1. restructuring Agrobacterium EHA105/pCAMBIA1302-MtWRKY76 is inoculated in the YEB liquid nutrient medium of 10ml containing 50 μ g/ml kantlex and 50 μ g/ml Rifampins, 28 ℃, 200rpm shaking culture spend the night;
2. transform and with 1:50 ratio (volume ratio), be inoculated in 200ml containing in identical antibiotic YEB substratum the day before yesterday, enlarged culturing to OD600 be 1.2-1.6, the centrifugal collection of 5,000rpm, 15min bacterium, is resuspended in infiltration damping fluid and (sucrose, tensio-active agent L-77 and water, consists of; The volumn concentration that the quality percentage composition of sucrose is 5%, L-77 is 0.05%), be diluted to OD600 and be about 0.8, be restructuring Agrobacterium EHA105/pCAMBIA1302-MtWRKY76 bacterium liquid;
3. adopt Foral dip method by the Arabidopis thaliana of Agrobacterium-mediated Transformation bud stage: when environmental Arabidopis thaliana (columbia stain of Arabidopsis thaliana as genetic background) the bolting 4-5cm of columbia, to cut off terminal inflorescence, make axillary inflorescence growth, while cutting, wound should be positioned at the highest stem leaf top, after about 4-5 days, transform, before conversion, to make soil fully drench and the bud of having bloomed is removed, only retain unopened small bud; During conversion, the whole strain of Arabidopis thaliana is tipped upside down on together with flowerpot in the container that fills 200ml restructuring Agrobacterium EHA105/pCAMBIA1302-MtWRKY76 bacterium liquid and soak 2-3min, after immersion, take out flowerpot, be sidelong in pallet, cover black plastic cloth, after 24hr, open plastic cloth, upright placing flowerpot, carry out normal illumination cultivation, results T
1in generation, turns MtWRKY76 Arabidopis thaliana seed (T
1in generation, turns pCAMBIA1302-MtWRKY76 Arabidopis thaliana seed).
(4) screening of transgenic arabidopsis and Molecular Identification
1. the screening of transgenic arabidopsis
T
1in generation, turns MtWRKY76 Arabidopis thaliana planting seed in containing on the MS solid plate of 80mg/L Totomycin, 4 ℃ of vernalization 3 days, put in 22 ℃ of illumination boxs and cultivate 7 days, transformant shows as true leaf and is deep green, root is profound to substratum, transformant is moved to not containing in antibiotic MS substratum, after 6 days, forward green seedling in soil breeding, the seed of results is T
2in generation, turns MtWRKY76 Arabidopis thaliana seed.
2. DNA level detects
By T
2in generation, turns MtWRKY76 Arabidopis thaliana cultivating seeds and becomes plant, the T of extraction
2the genomic dna that generation turns MtWRKY76 Arabidopis thaliana strain is template, with the positive contrast of plasmid pCAMBIA1302-MtWRKY76, and the negative contrast of genomic dna of the environmental Arabidopis thaliana of columbia (wild-type), with following primer, carry out pcr amplification:
P2F：5’-ATGGAATCAACATGCGTGGAT-3’；
P1R：5’-GGTGACCTCACCATTTGTCCTTATTAG-3’。
PCR system (25.O μ l): 10 * Ex Taq PCR Buffer2.5 μ l, dNTP(25mM) 2.0 μ l, 5 ' primer (5pmol/ μ l), 1.0 μ l, 3 ' primer (5pmol/ μ l), 1.0 μ l, ExTaq enzyme (5U/ μ l) 1.0 μ l, template (1 μ g/ μ l) 1.0 μ l, ddH
2o16.5 μ l.
PCR program is: the first round: 94 ℃ of sex change 5min; Second takes turns: 94 ℃ of sex change 30sec, and 50 ℃ of renaturation 30sec, 72 ℃ are extended 1min, 30 circulations; Third round: 72 ℃ are extended 10min.
After reaction finishes, 1.0% agarose gel electrophoresis detects pcr amplification product, the results are shown in Figure shown in 2, and Fig. 2 is pcr amplification product electrophorogram, 1,17 is 1kb DNA ladder, is respectively from down to up 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3 positive contrasts, 2,4 negative contrasts, 5-9,11,12,14-1618,19 and 21-28 be PCR positive plant, 10,13 and 20 is the negative plant of PCR; Can find out, the plant that can amplify MtWRKY76 gene specific band (about 860bp) is that PCR identifies positive T
2in generation, turns MtWRKY76 Arabidopis thaliana plant, obtains 20 PCR and identifies positive T
2in generation, turns MtWRKY76 Arabidopis thaliana plant, wherein five strain called after L2, L5, L8, L10 and L13 strain (T
2in generation, turns MtWRKY76 Arabidopis thaliana).
By L2, L5, L8, L10 and L13 strain are carried out selfing, obtain T
3for seed, cultivated as T
3in generation, turns MtWRKY76 Arabidopis thaliana plant L2, L5, L8, L10 and L13.
Two, the resistance of reverse of transgenic arabidopsis is identified
Respectively by L2, L5, L8, L10 and L13 strain Arabidopis thaliana (T
3in generation, turns MtWRKY76 Arabidopis thaliana seed) and environmental Arabidopis thaliana (wild-type) seed of columbia carry out salt stress experiment, test and establish three repetitions, repeat 60 seeds of each strain at every turn.Concrete grammar is as follows:
The Arabidopis thaliana seed of each strain is planted respectively in containing 150mM, 180mM, 190mM, 200mM, 210mM, on the MS substratum of 220mM NaCl, 4 ℃ of vernalization 72hr, illumination cultivation 7 days, every day, light application time was 16 hours, intensity of illumination is 100 μ mol m
-2s
-1, carry out germination rate calculating (the long 1mm of the root of take is sprouting standard).Statistics shows the increase along with salt concn, and the germination rate that turns the environmental Arabidopis thaliana of MtWRKY76 Arabidopis thaliana and columbia all reduces, but it is higher than the germination rate of empty carrier contrast and wild-type under identical salt concn, to turn MtWRKY76 Arabidopis thaliana.For example, on the MS of 210mM NaCl substratum, the germination rate of environmental Arabidopis thaliana (wt) seed of columbia is 33.3%, the germination rate of L2 seed is 63.3%, the germination rate of L5 seed is 61.1%, the germination rate of L8 seed is 71.1%, the germination rate of L10 seed is that the germination rate of 75.6%, L13 seed is 83.4%(Fig. 3).The germination rate that turns the seed of each strain of MtWRKY76 Arabidopis thaliana is significantly higher than the environmental Arabidopis thaliana of columbia, shows to express the saline-alkaline tolerance that MtWRKY76 has strengthened Arabidopis thaliana.
Embodiment 3, transgenosis are cut acquisition and the functional study of type clover
One, transgenosis is cut the acquisition of type clover
(1) vacuum leaf disc transformation method transforms and cuts type clover
Adopt the restructuring Agrobacterium EHA105/pCAMBIA1302-MtWRKY76 of embodiment 2 to infect the blade that cuts type clover R-108, the approach of regenerating by somatic embryo, adopts and vacuumizes a leaf disc transformation method conversion section type clover R-108.
1. cut the preparation of type clover material
The type clover R-108 that cuts that chooses full seed soaks about 25min(every 5min in the vitriol oil, jiggles), there is speckle to seed-coat, with a large amount of distilled water, clean 7 times, guarantee seed-coat covering water membrane, put to 4 ℃ of vernalization 2d.In large culture dish, put one deck filter paper, wetting with distilled water, the seed after vernalization is transferred on filter paper, incubated at room temperature 1-2d, to the long 2cm of root, is transferred to Nutrition Soil (Nutrition Soil: vermiculite=1:3) cultivate.
Cut type clover R-108 growth conditions: 16hr illumination every day/8hr is dark, 60% relative humidity, 22 ℃ of daytime/16 ℃ nights, 200 μ E/m2/s, growth 4-6weeks, cuts blade, tap water clean surface impurity with the scissors of sterilization, 5%NaClO surface sterilization 40min, with sterile purified water, clean 2-3 time, remove NaClO, cut away petiole, blade is cut into 5mm * 5mm fritter, for transformation experiment.
2. the preparation of blade with infect
The blade cutting is entered and is infected in liquid, fully mix, vacuumize-0.1pka(> 0.09pka), 30min; 28 ℃, 50rpm, cultivates 2h altogether.
3. cultivate altogether
The taking-up of cutting into slices, on the filter paper of sterilizing, remove as far as possible the Agrobacterium of slice surface, then transfer to SH3a solid medium (the Medicago truncatula handbook containing 100 μ M Syringylethanones, Transformation andregeneration of R108-1 (c3) via somatic embryogenesis (Cosson et a l., 2007) on, guarantee face of blade upward, secretly cultivate 3 days.
4. the formation of callus
Blade after common cultivation is transferred to the SH3a solid medium (guaranteeing that face of blade upward) that contains 10mg/L Totomycin and 400mg/L Pyocianil, secretly cultivated 5-6 week, switching in every 2 weeks once.Carboxylic Bian penicillin 300mg/L-200mg/L during flap, reduces gradually.
5. the formation of embryo
Treat that callus is ripe, transfer to SH9 substratum (the Medicago truncatula handbook that does not contain hormone, Transformation and regeneration of R108-1 (c3) via somatic embryogenesis (Cosson et a l., 2007) on, and transfer under illumination condition, cultivate, a plate of every 3 turnovers, to forming pre-embryo; About 20-30 days, pre-embryo develops into real embryo.
6. the growth of plant
2-3 is after week, and embryo germinates into plantlet; Plantlet is transferred on 1/2MS substratum, taken root.
7. transfer in greenhouse
Plant is transferred in greenhouse, cultivated, results T
0generation seed (the T that ties of (turn the pCAMBIA1302-MtWRKY76 present age, also turn MtWRKY76 the present age) plant (Fig. 4)
1for seed).
(2) transgenosis cut type clover Molecular Identification
By T
1generation turns pCAMBIA1302-MtWRKY76 cuts type alfalfa seed and cultivates into plant, extracts T
1it is template that generation turns the genomic dna that pCAMBIA1302-MtWRKY76 cuts type clover strain, with the positive contrast of plasmid pCAMBIA1302-MtWRKY76, cut type clover R-108(wild-type) the negative contrast of genomic dna, utilize upstream primer (in 150bp position, 35S promoter ATG upstream) and downstream primer (at the 3-of WRKY76 end), one section of goal gene fragment that is about 1000bp that pcr amplification is special.With following primer, carry out pcr amplification:
5 ' primer: 5 '-GACGCACAATCCCACTATCC-3 ';
3 ' primer: 5 '-GGTGACCTCACCATTTGTCCTTATTAG-3 '.
PCR system (25.O μ l): 10 * Ex Taq PCR Buffer2.5 μ l, dNTP(25mM) 2.0 μ l, 5 ' primer (5pmol/ μ l), 1.0 μ l, 3 ' primer (5pmol/ μ l), 1.0 μ l, ExTaq enzyme (5U/ μ l) 1.0 μ l, template (1 μ g/ μ l) 1.0 μ l, ddH
2o16.5 μ l.
PCR program is: the first round: 94 ℃ of sex change 5min; Second takes turns: 94 ℃ of sex change 30sec, and 50 ℃ of renaturation 30sec, 72 ℃ are extended 1min, 30 circulations; Third round: 72 ℃ are extended 10min.
After reaction finishes, 1.0% agarose gel electrophoresis detects pcr amplification product, the results are shown in Figure shown in 5,1,19 is 1kb DNA ladder, be respectively from down to up 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3 positive contrasts, 2,4 negative contrasts, 5,7,10-13,14-18,21,23-27,29-34,35,37 and 39 be PCR positive plant, 6,8,9,20,22,28,36 and 38 is the negative plant of PCR; Can find out, the plant that can amplify MtWRKY76 gene specific band (about 1000bp) is that PCR identifies positive T
1in generation, turns MtWRKY76 and cuts type alfalfa plants, obtains 25 PCR and identifies positive T
1in generation, turns MtWRKY76 and cuts type alfalfa plants, and 2 PCR of random choose identify positive strain called after L2 and L4 strain (T
2in generation, turns MtWRKY76 and cuts type clover) carry out the experiment of following step 2 and step 3.
Two, transgenosis is cut the resistance of reverse evaluation of type clover
1, will cut respectively type clover R-108(is that wild-type is cut type clover (WT)) and T
1in generation, turns MtWRKY76 and cuts type clover (L2 and L4) and carry out salt stress experiment:
1. the long experiment of root:
Wild-type is cut to seed and the T of type clover
1in generation, turns L2 and the L4 strain T that MtWRKY76 cuts type clover
1for first 0.1% the upper sprouting of water agar (10mg/L Totomycin) of seed, 4 ℃ of vernalization forward 25 ℃ of dark culturing 20h for 2 days to, forward to afterwards not containing (solute and concentration are MgSO with containing 100mMNaCl FN substratum
4.7H
2o0.5mM, KH
2pO
40.7mM, Na
2hPO
4.2H
2o0.8mM, FeEDTA0.5 μ M, NH
4nO
30.5mM, CaCl
21mM, MnSO
40.1mg/L, CuSO
40.1mg/L, ZnSO
40.1mg/L, H
3bO
30.1mg/L, Na
2moO
40.1mg/L, solvent is water) upper cultivation 7 days, record that initial main root is long and to cultivate after 7 days main root long, calculate its not containing with contain 100mMNaCl and screen the growth length (Fig. 6) of depressing main root.Through repeating experiment for 4 times, test 20 seeds of each strain at every turn, rough estimates go out its data as shown in Figure 7, and result shows under normal growth condition, and wild-type is cut type clover and is cut type with transgenosis and there is no difference, still under 100mM NaCl condition, T
1generation turns MtWRKY76, and to cut L2 and the L4 strain of type clover obviously long than the increment of wild-type root, main root length is 1.7 times that wild-type is cut type clover, its data are as follows: wild-type is cut the long 1.365cm of being of main root of type clover, and the main root length of L2 is 2.365cm, and the main root length of L4 is 2.275cm.This result showed to express the saline-alkaline tolerance that MtWRKY76 gene has increased section type clover R-108.
2. dry weight experiment:
Wild-type is cut to seed and the T of type clover
1in generation, turns L2 and the L4 strain T that MtWRKY76 cuts type clover
1for seed, first at 0.1% water agar (10mg/L Totomycin), above sprout, 4 ℃ of vernalization forward 25 ℃ of dark culturing 20h to after 2 days, at this moment the seed of sprouting can grow the root of approximately 1 centimetre, forward to not containing cultivating after 15 days with containing on 100mM NaCl FN substratum, 60 ℃ of individual plant samplings are dried 48h and are taken dry weight.Through 3 times, repeat to test, test 20 seeds of each strain at every turn, count its data as Fig. 8.Result shows that, under normal growth condition, the dry weight that wild-type and transgenosis are cut type clover does not have difference; But under 100mM NaCl condition, T
1generation turns MtWRKY76, and to cut L2 and the L4 strain of type clover obviously many than the biomass of wild-type, and plant dry weight is 1.3 times that wild-type is cut type clover, and data are as follows: wild-type is 4.15mg, and L2 is 5.52mg, and L4 is 5.30mg.This result shows that MtWRKY76 gene has strengthened the saline-alkaline tolerance of section type clover R-108.
2, to cutting type clover R-108(, be that wild-type is cut type clover (WT) respectively) and T
1in generation, turns MtWRKY76 and cuts type clover (L2 and L4) and carry out drought stress experiment:
Wild-type is cut to seed and the T of type clover
1in generation, turns L2 and the L4 strain T that MtWRKY76 cuts type clover
1for first 0.1% the upper sprouting of water agar (10mg/L Totomycin) of seed, 4 ℃ of vernalization forward 25 ℃ of dark culturing 20h for 2 days to, transfer to (Nutrition Soil: vermiculite (v/v)=1:3) in compost, after normal growth two weeks, arid was processed after 14 days, quantitative watering 300mL, more arid 14 days, three times repeatedly, last rehydration take pictures after 3 days (Fig. 9).The control group of the management of normally watering is set simultaneously.And calculate survival rate (the survival strain number of the survival strain number/control group of arid treatment group).The control group of the management of normally watering is set simultaneously.Three repetitions are established in experiment, repeat 24 seeds of each strain at every turn.Count its data as shown in figure 10, the survival rate that wild-type is cut type clover is 26.7%; And turn MtWRKY76, to cut type medicago sativa l. 2 be 88.9%, and L4 is 73.3%.The survival rate that imports the transgenic alfalfa of MtWRKY76 gene of the present invention is 2.7-3.3 times that wild-type is cut type clover.The ability that MtWRKY76 has improved section type clover drought resisting of expressing was described.
Three, transgenosis is cut the dross experimental identification of type clover
1, the activation of root nodule bacterium Sinorhizobium meliloti1021 and preparation
Root nodule bacterium Sinorhizobium meliloti1021 bacterial classification-80 ℃ of preservations is being contained to 100 μ g/ml Vetstrep TY solid medium (Tryptones 5g, yeast powder 3g, CaCl
20.6g, agar powder 15g, water is settled to 1000ml, adjusts pH to 7.0) upper line, in 28 ℃ of incubators, growth is two days later, picking list bacterium colony is to containing 100 μ g/ml Vetstrep TY liquid nutrient mediums, 28 ℃, 240rpm concussion is cultivated three days, according to 1:100 be transferred to new containing 100 μ g/ml Vetstrep TY substratum (50mL) until the OD of bacterium liquid
600be 0.8, with normal saline dilution to OD
600be 0.5, standby.
2, the preparation of vermiculite pipe
Vermiculite is stirred evenly straight with low nitrogen substratum, pack Boiling tube into, be about 2/3 of pipe range, sealed membrane is wrapped, and 121 ℃ of autoclavings 2 hours are down to the distilled water 30mL that each vermiculite pipe after room temperature adds sterilizing.
3, cut the dross experiment of type clover
To cut type clover R-108(is that wild-type is cut type clover (WT)) seed and T
1in generation, turns L2 and the L4 strain T that MtWRKY76 cuts type clover
1for seed, at 0.1% water agar (10mg/L Totomycin), above sprout, 4 ℃ of vernalization forward 25 ℃ of dark culturing 20h to after 2 days, when the seed of sprouting grows the root of approximately 1 centimetre, kind arrives in ready vermiculite pipe, the root nodule bacterium Sinorhizobium meliloti1021(OD that in each vermiculite pipe, inoculation step 1 has diluted
600be 0.5) 500 μ L, illumination cultivation 30 days, every day, light application time was 16 hours, intensity of illumination is 200 μ mol m
-2s
-1, carry out dross number calculating (Figure 11).Three repetitions are established in experiment, repeat 15 seeds of each strain at every turn.Statistics as shown in figure 12, can find out, the MtWRKY76 that turns of Rhizobium Inoculation Sinorhizobium meliloti1021 cuts type clover and increases than the dross number of wild-type.Counting its data and be wild-type, to cut type clover be 7.5; And two the strain L2 and the L4 that turn MtWRKY76 are respectively 13.9,12.4, the nodule number of transgenic alfalfa be acceptor clover 1.7-1.9 doubly.Underground part fresh weight is wild-type 51.8mg, and two the strain L2 and the L4 that turn MtWRKY76 are respectively 85.7mg, 94.5mg(Figure 13), the weight of the root nodule of transgenic alfalfa be acceptor clover 1.65-1.82 doubly.Show that MtWRKY76 has participated in a section type clover process of nodulation, and strengthen nodulation and nitrogen fixation ability.
Claims (10)
1. cultivate the method for the high and/or transgenosis dross plant that resistance of reverse is high of Noduling ability, comprise to importing MtWRKY76 gene in acceptor dross plant and obtain Noduling ability and/or resistance of reverse higher than the step of the transgenosis dross plant of described acceptor dross plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to dross plant Noduling ability and/or resistance of reverse by a) derivative protein.
2. method according to claim 1, is characterized in that: described transgenosis dross plant is transgenic leguminous plants, and described acceptor dross plant is leguminous plants.
3. cultivate the method for the transgenic plant that resistance of reverse is high, comprise to importing MtWRKY76 gene in recipient plant and obtain resistance of reverse higher than the step of the transgenic plant of described recipient plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to plant stress tolerance by a) derivative protein.
4. method according to claim 3, is characterized in that: described recipient plant is dicotyledons or monocotyledons.
5. according to arbitrary described method in claim 1-4, it is characterized in that: described resistance of reverse is salt tolerance and/or drought tolerance.
6. method according to claim 5, is characterized in that: described salt tolerance is presented as following A 1), A2) and A3) in all or part of:
A1), under salt stress, the germination rate of plant seed is higher than described acceptor dross plant or described recipient plant;
A2) described resistance of reverse is presented as under salt stress, and the length of root is higher than described acceptor dross plant or described recipient plant;
A3) described resistance of reverse is presented as under salt stress; Biomass is higher than described acceptor dross plant or described recipient plant.
7. according to arbitrary described method in claim 1-6, it is characterized in that: the encoding sequence of described MtWRKY76 gene is the 74-931 position Nucleotide of SEQ ID No.1.
8. the application following B1)-B4);
B1) application of MtWRKY76 in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant;
Described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and relevant to dross plant Noduling ability and/or plant stress tolerance by a) derivative protein;
B2) nucleic acid molecule of the described MtWRKY76 application in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant of encoding;
The application of the expression cassette of the nucleic acid molecule that B3) contains the described MtWRKY76 that encodes in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant;
The application of the carrier of the nucleic acid molecule that B4) contains the described MtWRKY76 that encodes in the Noduling ability of regulation and control dross plant and/or the resistance of reverse of regulating plant.
9. application according to claim 8, is characterized in that: described resistance of reverse is salt tolerance and/or drought tolerance.
At least one biomaterial in 10.C1-C4:
C1, the expression cassette of nucleic acid molecule that contains the MtWRKY76 that encodes, described MtWRKY76 be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2;
B) by the replacement of one or several amino-acid residue in SEQ ID No.2 and/or disappearance and/or interpolation and with dross plant Noduling ability and/or plant stress tolerance by a) derivative protein;
The carrier of the nucleic acid molecule that C2 contains the described MtWRKY76 that encodes;
C3, the MtWRKY76 expression vector that contains expression cassette described in C1 or import the recombinant microorganism of described MtWRKY76 expression vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310085151.7A CN104059937B (en) | 2013-03-18 | 2013-03-18 | One protein deriving from Herba Medicaginis and the new application of encoding gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310085151.7A CN104059937B (en) | 2013-03-18 | 2013-03-18 | One protein deriving from Herba Medicaginis and the new application of encoding gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104059937A true CN104059937A (en) | 2014-09-24 |
| CN104059937B CN104059937B (en) | 2016-12-28 |
Family
ID=51547868
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310085151.7A Active CN104059937B (en) | 2013-03-18 | 2013-03-18 | One protein deriving from Herba Medicaginis and the new application of encoding gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104059937B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450740A (en) * | 2014-12-16 | 2015-03-25 | 中国农业科学院北京畜牧兽医研究所 | Alfalfa MsWRKY33 transcription factor as well as encoding protein, preparation method and application of alfalfa MsWRKY33 transcription factor |
| CN106967729A (en) * | 2017-04-16 | 2017-07-21 | 陈帅 | Application of the WRKY transcription factors in resistant transgenic sweet orange is prepared |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108913715A (en) * | 2018-07-19 | 2018-11-30 | 中国农业科学院北京畜牧兽医研究所 | A kind of construction method of plant expression plasmid carrier containing FLAG protein fusion label and its carrier |
| CN111205355A (en) * | 2018-11-21 | 2020-05-29 | 中国农业科学院作物科学研究所 | Plant stress tolerance related protein SiWRKY76 and coding gene and application thereof |
| CN113583099A (en) * | 2021-08-03 | 2021-11-02 | 中国农业大学 | Method for cultivating alfalfa male sterile line and corresponding maintainer line and related biological material thereof |
| CN116970054A (en) * | 2023-09-22 | 2023-10-31 | 西北农林科技大学深圳研究院 | Ulcer disease-inducing transcription factor AcWRKY76 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101130785A (en) * | 2007-07-30 | 2008-02-27 | 北京未名凯拓农业生物技术有限公司 | Clone of rice WRKY gene relative to drought resistance and application thereof |
| WO2012061615A1 (en) * | 2010-11-03 | 2012-05-10 | The Samuel Roberts Noble Foundation, Inc. | Transcription factors for modification of lignin content in plants |
| CN102939384A (en) * | 2010-02-24 | 2013-02-20 | 中国科学院遗传与发育生物学研究所 | Genes conferring stress tolerance in plants and uses thereof |
-
2013
- 2013-03-18 CN CN201310085151.7A patent/CN104059937B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101130785A (en) * | 2007-07-30 | 2008-02-27 | 北京未名凯拓农业生物技术有限公司 | Clone of rice WRKY gene relative to drought resistance and application thereof |
| CN102939384A (en) * | 2010-02-24 | 2013-02-20 | 中国科学院遗传与发育生物学研究所 | Genes conferring stress tolerance in plants and uses thereof |
| WO2012061615A1 (en) * | 2010-11-03 | 2012-05-10 | The Samuel Roberts Noble Foundation, Inc. | Transcription factors for modification of lignin content in plants |
Non-Patent Citations (4)
| Title |
|---|
| DASHARATH PRASAD LOHAR ET AL.: "Transcript Analysis of Early Nodulation Events in Medicago truncatula", 《PLANT PHYSIOLOGY》 * |
| GENBANK: "GenBank：AES59079.1", 《GENBANK》 * |
| GENBANK: "NCBI Reference Sequence:XP_003588828.1", 《GENBANK》 * |
| NEVIN D. YOUNG ET AL.: "The Medicago genome provides insight into the evolution of rhizobial symbioses", 《NATURE》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450740B (en) * | 2014-12-16 | 2016-06-15 | 中国农业科学院北京畜牧兽医研究所 | A kind of alfalfa MsWRKY33 transcription factor and encoding proteins, preparation method and application |
| CN104450740A (en) * | 2014-12-16 | 2015-03-25 | 中国农业科学院北京畜牧兽医研究所 | Alfalfa MsWRKY33 transcription factor as well as encoding protein, preparation method and application of alfalfa MsWRKY33 transcription factor |
| CN106967729B (en) * | 2017-04-16 | 2020-11-06 | 章驰 | Application of WRKY transcription factor in preparation of stress-resistant transgenic sweet orange |
| CN106967729A (en) * | 2017-04-16 | 2017-07-21 | 陈帅 | Application of the WRKY transcription factors in resistant transgenic sweet orange is prepared |
| CN108411030A (en) * | 2018-05-25 | 2018-08-17 | 兰州大学 | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 |
| CN108411030B (en) * | 2018-05-25 | 2021-05-14 | 兰州大学 | Primer pair, kit containing primer pair, application of primer pair and method for detecting ecological A17 and R108 of medicago truncatula |
| CN108913715A (en) * | 2018-07-19 | 2018-11-30 | 中国农业科学院北京畜牧兽医研究所 | A kind of construction method of plant expression plasmid carrier containing FLAG protein fusion label and its carrier |
| CN111205355A (en) * | 2018-11-21 | 2020-05-29 | 中国农业科学院作物科学研究所 | Plant stress tolerance related protein SiWRKY76 and coding gene and application thereof |
| CN111205355B (en) * | 2018-11-21 | 2021-08-13 | 中国农业科学院作物科学研究所 | Plant stress tolerance related protein SiWRKY76 and coding gene and application thereof |
| CN113583099A (en) * | 2021-08-03 | 2021-11-02 | 中国农业大学 | Method for cultivating alfalfa male sterile line and corresponding maintainer line and related biological material thereof |
| CN113583099B (en) * | 2021-08-03 | 2022-07-26 | 中国农业大学 | Method for cultivating alfalfa male sterile line and corresponding maintainer line and related biological material thereof |
| CN116970054A (en) * | 2023-09-22 | 2023-10-31 | 西北农林科技大学深圳研究院 | Ulcer disease-inducing transcription factor AcWRKY76 and application thereof |
| CN116970054B (en) * | 2023-09-22 | 2023-11-28 | 西北农林科技大学深圳研究院 | Ulcer disease-inducing transcription factor AcWRKY76 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104059937B (en) | 2016-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104059937A (en) | New application of protein derived from clover and its coding genes | |
| CN101955521B (en) | Plant stress tolerance associated protein, and coded genes and application thereof | |
| CN107383179B (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN111218470B (en) | Method for regulating and controlling stress resistance of plants | |
| CN113388017B (en) | Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants | |
| CN104829699B (en) | A kind of and plant adversity resistance related protein Gshdz4 and its encoding gene and application | |
| CN103667339A (en) | Application of rice-derived protein OsMKK4 and related biological material thereof to regulation and control of plant panicle types | |
| CN111574606B (en) | Wheat disease-resistant and heading regulation gene TaCOK and related biological material and application thereof | |
| CN102653556B (en) | Plant adverse resistance related transcription factor GmWRKY78 as well as encoding gene and application thereof | |
| CN106367433B (en) | Plant is improved to the method and its application of gibberellin inhibitor sensitiveness | |
| CN110684089B (en) | Application of plant stress tolerance related protein GmMYB118 in regulation and control of plant stress tolerance | |
| CN114805508B (en) | Rice heading stage gene DHD3 function and application | |
| CN105400814A (en) | Method for cultivating insect-resistant transgenic maize | |
| Li et al. | Development of a Simple and Efficient Method for Agrobacterium-Mediated Transformation in Sorghum. | |
| CN105646683B (en) | The application of complete salt tolerant protein matter and relevant biological material in regulation plant salt endurance | |
| CN110627887B (en) | Application of SlTLFP8 protein and related biological material thereof in regulation and control of tomato drought resistance | |
| CN110684114B (en) | Application of plant stress tolerance associated protein TaBAKL in regulation and control of plant stress tolerance | |
| CN113773374B (en) | Transcription factor ZmbZIPa6 and coding gene and application thereof | |
| CN116769797B (en) | Application of methyl jasmonate and PpyMYC2 gene in germination | |
| CN115807010B (en) | Honeysuckle leaf glandular hair-growing gene and application thereof | |
| CN113061172B (en) | Plant salt tolerance related LIP1 protein and related biological material and application thereof | |
| CN108795975B (en) | Application of wild soybean related protein in improving insect resistance of plants | |
| CN116970047A (en) | Application of protein ZmRtn16 in regulation and control of drought resistance of plants | |
| CN105732783B (en) | The application of resistance relevant protein and its encoding gene in regulation stress resistance of plant | |
| CN118290557A (en) | Tn1a protein for regulating and controlling rice tillering quantity, and related biological material and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |