CN108239675A - A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower - Google Patents
A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower Download PDFInfo
- Publication number
- CN108239675A CN108239675A CN201810191880.3A CN201810191880A CN108239675A CN 108239675 A CN108239675 A CN 108239675A CN 201810191880 A CN201810191880 A CN 201810191880A CN 108239675 A CN108239675 A CN 108239675A
- Authority
- CN
- China
- Prior art keywords
- muskmelon
- flower
- primer
- unisexuality
- tjcm02
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for identifying molecular marked compound TJcM02 and its application of muskmelon unisexual flower, for current unisexuality female flower muskmelon selection and breeding the problem of, such as year limit for length, the shortcomings of efficiency is low and of high cost, the present invention provides a kind of TJcM02 molecular labelings and its primer special for identifying muskmelon unisexual flower, pass through PCR, the differentiation to unisexuality female flower and non-unisexuality female flower muskmelon material can be completed in Muskmelon Plants early stage, it is good with specificity, accuracy rate is high, it is not affected by environment the advantages of.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of molecular marked compound for being used to identify muskmelon unisexual flower
TJcM02 and its application.
Background technology
Muskmelon Cucumis melo L. belong to Curcurbitaceae Cucurbitaceae, Cucumis Cucumis, are a kind of important
Garden crop, unique flavor is best in quality, very popular.China is shown according to FAO (Food and Agriculture Organization of the United Nation) (FAO) data
Melon yield and cultivated area rank first in the world, this is of great significance to the economic benefit for promoting peasant.Muskmelon flower property type
Two classes, i.e. unisexuality female flower and hermaphrodite flower can be divided by floral organ inserted part, unisexuality female flower is a kind of ideal compared with hermaphrodite flower
Crossbreeding material, receive significant attention.The muskmelon cultivated at present is all male flower hermaphrodite flower, in first-filial generation production of hybrid seeds process
In, pollination needs artificial emasculation, and operation is more cumbersome, if emasculation misoperation can reduce percentage of fertile fruit and seed purity.Therefore it selects
Unisexuality female flower muskmelon is educated, is one of the important goal of current muskmelon genetic breeding.
Adnane Boualem confirm that muskmelon unisexuality female flower is controlled by dominant single-gene A, find the male hermaphrodite flower of muskmelon
It is since the mutation of A gene mononucleotides causes A57V to replace, the Synthesis pathway enzyme mutation that CmACS-7 is encoded is caused to make
Into.In addition, the expression pattern of Curcurbitaceae flower property type can be modified by hormone (such as ethylene) and environmental factor.
Currently for the selection and breeding of unisexuality female flower muskmelon, the method for generally also using conventional hybridization is low with year limit for length, efficiency
And the shortcomings of of high cost.Molecular mark can directly select character from DNA level, have efficiently, accurately
And the advantages that economic, it can substantially shorten breeding cycle, be the strong supplement of traditional breeding technology.InDel labels have accuracy
It is high, the advantages that stability is good, and its detection is simple and convenient, relatively low to instrument and equipment and technology requirement, can be based on being inserted into/scarce
The sequence design special primer of unsceptered both sides carries out PCR amplification, is detected directly on electrophoretic techniques platform.
Suitable InDel molecular labelings are developed, for the selection and breeding of unisexuality female flower melon variety or strain, breeding can be accelerated
Process improves breeding efficiency, reduces breeding cost, has important actual application value.
Invention content
For current unisexuality female flower muskmelon selection and breeding the problem of, such as year limit for length, the shortcomings of efficiency is low and of high cost,
The present invention provides a kind of TJcM02 molecular labelings and its primer special for identifying muskmelon unisexual flower, pass through polymerase chain reaction
Should, the differentiation to unisexuality female flower and non-unisexuality female flower muskmelon material can be completed in Muskmelon Plants early stage, it is specific good to have, accurate
True rate is high, it is not affected by environment the advantages of.
A kind of primer special for the molecular labeling TJcM02 for identifying muskmelon unisexual flower, it is characterized in that the primer is from 5` ends
To the forward primer TTCAAATCTTCACAACTTTACCGTATTGATCC of the single-stranded DNA sequence of 1-32 at 3` ends；From 5`
Hold the reverse primer GGTGGTCATTTTCATAGAACTTTCCCATAC of the 1-30 single stranded DNA sequences at 3` ends.
Using the molecular labeling primer special of the present invention, using the genomic DNA of material to be detected as template, expanded by PCR
Increase and obtain molecular labeling, found by being sequenced, the PCR that molecular labeling size is 249bp in the muskmelon material of unisexuality female flower is produced
Object, the single-stranded DNA sequence from 5` ends to 3` ends are：
TTCAAATCTTCACAACTTTACCGTATTGATCCCTTAAAAATGAAGTAAAAACAATA
ATGAACGAACTAAGACAATCACCATTTGAAAGTTTAAGGACCAAATGAACCAAAG
TTAAAAGTATAGAAACAAAAATAAACATCGCTAAATAAACCAAATAAAACTAGAA
TTACTTAATTGAAACAAAATAATATGAAATGGATCAAATCTTTAGACTTTAGTGTA
TGGGAAAGTTCTATGAAAATGACCACC。
Using the molecule labelling method of the primer special identification muskmelon of the present invention, it is characterized in that extraction muskmelon detected sample
Genomic DNA as template, carry out PCR (PCR) using molecular labeling primer special and expand, then pass through electricity
Swimming is detected amplified production.
1) the muskmelon sample to be measured arbitrarily genomic DNA of tissue or organ is extracted using CTAB methods.
2) using the sample to be tested genomic DNA obtained by step 1 as template, using molecular labeling specific primer to carrying out
PCR amplification obtains amplified production.
3) using polyacrylate hydrogel electrophoretic techniques, the pcr amplification product obtained by step 2 is separated by electrophoresis.
4) pcr amplification product is dyed using silver staining.
5) by judging the size of amplified production, the larger DNA fragmentation for 249bp of amplified production is expanded containing 249bp
The sample to be tested of product is unisexuality female flower muskmelon material；The sample to be tested for not containing 249bp amplified productions is non-unisexuality female flower sweet tea
Melon material.
Template used in above-mentioned PCR amplification is muskmelon genomic DNA.
Primer used in above-mentioned PCR amplification is as follows：
1) delete, increase or be mutated one or several as the single strand dna shown in sequence in sequence table 2 or by sequence 2
A nucleotide, and with sequence 2 have identical function single strand dna.
2) delete, increase or be mutated one or several as the single strand dna shown in sequence in sequence table 3 or by sequence 3
A nucleotide, and with sequence 3 have identical function single strand dna.
A kind of primer special for being used to identify muskmelon unisexual flower and molecule labelling method disclosed by the invention and the prior art
It is compared to possessed good effect：
When the 1st, carrying out unisexuality female flower selection and breeding using conventional method, need to do Fields detection, it is time-consuming and laborious, easily by environment shadow
It rings；And this method is by the way of DNA detections, it is not affected by environment.
2nd, for from detection time, the detection of conventional method needs to carry out in florescence, and this method is in seedling stage or kind
The sub- phase can be detected, and the time of detection is earlier.
3rd, few with ACS-7 linked markers in the prior art, nothing isolates label, and the resistant gene in the present invention can be done
It is isolated to ACS-7.
4th, conventional method is not achieved 100% for the screening of unisexuality female flower, and the accuracy of this method can reach 100%.
In conclusion the method for the present invention specificity is good, accuracy rate is high, has advantage not affected by environment, and to unisexuality
Female flower muskmelon material is distinguished well, may also differentiate between homozygous and heterozygosis.Therefore, present invention obtains one can efficiently,
Accurately distinguish muskmelon whether be the female floral material of unisexuality molecular labeling.
Description of the drawings
Fig. 1 is muskmelon unisexuality female flower and hermaphrodite flower field phenotypic evaluation：Oa831 be unisexuality female flower muskmelon material, Oa808
For hermaphrodite flower muskmelon material.
Fig. 2 is the qualification result of the molecular labeling of the present invention：Wherein M represents DNA Marker, remaining swimming lane is not similary
The electrophoresis result of the pcr amplification product of product, respectively：The qualification result of No. 1 expression unisexuality female flower Oa831 material, No. 2 expressions
The qualification result of hermaphrodite flower Oa808, No. 3 F1 generation material qualification results for representing that Oa831 hybridizes with Oa808, remaining is F2 for material
The qualification result of material.
It for those of ordinary skill in the art, without creative efforts, can be according to above attached
Figure obtains other relevant drawings.
Specific embodiment
The present invention is described below by specific embodiment.Unless stated otherwise, technological means used in the present invention
It is method known in those skilled in the art.In addition, embodiment is interpreted as illustrative, it is not intended to limit the present invention
Range, the spirit and scope of the invention are limited only by the claims that follow.To those skilled in the art, without departing substantially from this
The various changes carried out to the material component in these embodiments and dosage under the premise of invention spirit and scope or change
It belongs to the scope of protection of the present invention.Experimental method used in following embodiment is conventional method unless otherwise specified；
Instrument used and reagent etc. unless otherwise specified, commercially obtain.
Muskmelon material Oa831, Oa808 and F1 generation material in following embodiment, the public can be from University Of Tianjin's plant resources
And breeding laboratory obtains, which only attaches most importance to used in the related experiment of duplicate invention, can not be used as other purposes.
The acquisition of embodiment 1, molecular labeling
Muskmelon gene C mACS-7 is the important regulating and controlling factor for adjusting muskmelon flower property type, resurveys sequence using muskmelon genome and believes
Breath in the gene position near zone, obtains 1 InDel molecular labeling TJcM02, sequence 1 in sequence such as sequence table
It is shown.To utilize the InDel sites, suitable specific primer is devised, including sense primer F and downstream primer R, primer sequence
Row are as follows：
Sense primer F：TTCAAATCTTCACAACTTTACCGTATTGATCC
Downstream primer R：GGTGGTCATTTTCATAGAACTTTCCCATAC
Embodiment 2, muskmelon material Oa831, Oa808 and F2 are for the acquisition of segregating population and the identification of material flower property type
Muskmelon material Oa831 is female parent, and Oa808 is male parent, carries out hybridization and obtains F1 generation, F1 generation selfing obtains F2 for muskmelon
Material.It is normally cultivated in field, treats the Hua Xingxing of florescence observation material, whether hero is contained according to the flower in open state
Stamen, gynoecium determine Oa831 as the female floral material of unisexuality, and Oa808 is both sexes floral material, and F1 generation is the female floral material of unisexuality, 44 plants of F2 sweet teas
In melon plant, 39 plants show as the female floral material of unisexuality, and 5 plants show as both sexes floral material.
The application of embodiment 3, molecular labeling in identifying whether muskmelon is unisexuality female flower muskmelon
To the muskmelon material in embodiment 2, using the genomic DNA of CTAB methods extraction blade, specific step is：Take sweet tea
Melon young leaflet tablet 0.2g enters in 1.5mL centrifuge tubes, adds 50 μ L 2%CTAB Extraction buffers, grinding, rear polishing to 400 μ L, and 65
DEG C water-bath 30min；Add in 400 μ L chloroforms：Isoamyl alcohol (24:1), jog 5min.12000 rpm centrifuge 5min；Take 200 μ of supernatant
L adds in the 200 μ L mixings of isopropanol of precooling, -20 DEG C of placement 20min；12000 rpm centrifuge 10min；Supernatant is abandoned, adds in 150 μ
L pre-cooled ethanols, gently mixing clean, 10,000rpm centrifugation 5min；Supernatant is abandoned, dry or is dried up；100 μ L of distilled water is added to dissolve
DNA is placed at room temperature for 1h；DNA is diluted to 50ng/ μ L with distilled water, is used as pcr template or -20 DEG C saves backup.
Using above-mentioned muskmelon genomic DNA as template, sense primer F in embodiment 1 and be primer with downstream R carries out PCR
Amplification, using the reaction system of 10 μ L, including：
The program that PCR amplification uses for：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of renaturation 30s, 72 DEG C extend
30s, 35 cycles；72 DEG C extend 5min eventually.
To pcr amplification product in 8% polyacrylamide gel, 140v constant pressure electrophoresis 90min dye gel,
Observe result.Kit can also be made in the other compositions of specific primer and PCR, for identifying whether muskmelon is that unisexuality is female
Flower muskmelon.
It can be found that only amplifying the band of a 249bp, hermaphrodite flower material in the female floral material Oa831 of unisexuality from result
The band of a 228bp is only amplified in material Oa808, F1 generation material amplifies the band of 228 and 249bp simultaneously.F2 is for group
In, phenotypic evaluation is in 5 plants of materials of hermaphrodite flower, only expands in addition to the band of a 228bp, with both sexes floral material Oa808
It is identical；Phenotypic evaluation is 6 plants of bands for only amplifying 249bp, with the female floral material of unisexuality in 39 plants of materials of unisexuality female flower
Oa831 is identical, for homozygous unisexuality female flower muskmelon material, 33 plants of bands for amplifying 249bp and 228bp simultaneously, with F1 generation sweet tea
Melon material identical is the unisexuality female flower muskmelon material of heterozygosis.The phenotypic evaluation of molecular markers for identification result and muskmelon flower property type
As a result it is consistent.
Based on the above results it is found that utilizing the InDel label TJcM02 shown in sequence in sequence table 1 and its sequence 2 and sequence
Special primer shown in row 3 carries out PCR amplification to the genomic DNA of muskmelon material to be identified, is separated by electrophoresis, after silver staining detection,
It was found that the qualification result of muskmelon flower property type is consistent with field phenotypic evaluation result, show InDel labels provided by the invention
TJcM02 and its special primer can be used for carrying out assisting sifting and identification to muskmelon flower property type, and screening or assisting sifting have
The muskmelon strain or kind of unisexuality female flower.
Illustrative description has been done to the present invention above, it should explanation, in the situation for the core for not departing from the present invention
Under, any simple deformation, modification or other skilled in the art can not spend the equivalent replacement of creative work equal
Fall into protection scope of the present invention.
Sequence table
<110>University Of Tianjin
<120>A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 249
<212> DNA
<213>Pcr amplification product
<400> 1
TTCAAATCTT CACAACTTTA CCGTATTGAT CCCTTAAAAA TGAAGTAAAA ACAATAATGA 60
ACGAACTAAG ACAATCACCA TTTGAAAGTT TAAGGACCAA ATGAACCAAA GTTAAAAGTA 120
TAGAAACAAA AATAAACATC GCTAAATAAA CCAAATAAAA CTAGAATTAC TTAATTGAAA 180
CAAAATAATA TGAAATGGAT CAAATCTTTA GACTTTAGTG TATGGGAAAG TTCTATGAAA 240
ATGACCACC 249
<210> 2
<211> 32
<212> DNA
<213>Artificial sequence
<400> 2
TTCAAATCTTCACAACTTTACCGTATTGATCC 32
<210> 3
<211> 30
<212> DNA
<213>Artificial sequence
<400> 3
GGTGGTCATTTTCATAGAACTTTCCCATAC 30
Claims (3)
1. it is a kind of identify muskmelon unisexual flower molecular labeling TJcM02 primer special it is characterized in that：The primer is from 5` ends
To the forward primer TTCAAATCTTCACAACTTTACCGTATTGATCC of the single-stranded DNA sequence of 1-32 at 3` ends；From 5`
Hold the reverse primer GGTGGTCATTTTCATAGAACTTTCCCATAC of the 1-30 single-stranded DNA sequences at 3` ends.
2. the molecule labelling method of the primer special identification muskmelon unisexual flower using claim 1, extracts muskmelon test sample to be checked
The genomic DNA of product carries out PCR (PCR) using molecular labeling primer special and expands, then pass through as template
Electrophoresis is detected amplified production.
3. method as claimed in claim 2, it is characterized in that step is as follows：
1) the muskmelon sample to be measured arbitrarily genomic DNA of tissue or organ is extracted using CTAB methods；
2) using the sample to be tested genomic DNA obtained by step 1 as template, using molecular labeling specific primer to carrying out PCR expansions
Increase, obtain amplified production；
3) using polyacrylate hydrogel electrophoretic techniques, the pcr amplification product obtained by step 2 is separated by electrophoresis；
4) pcr amplification product is dyed using silver staining；
5) by judging the size of amplified production, the larger DNA fragmentation for 249bp of amplified production contains 249bp amplified productions
Sample to be tested be unisexuality female flower muskmelon material；The sample to be tested for not containing 249bp amplified productions is non-unisexuality female flower muskmelon material
Material.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810191880.3A CN108239675B (en) | 2018-03-08 | 2018-03-08 | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810191880.3A CN108239675B (en) | 2018-03-08 | 2018-03-08 | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108239675A true CN108239675A (en) | 2018-07-03 |
| CN108239675B CN108239675B (en) | 2021-02-02 |
Family
ID=62699026
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810191880.3A Expired - Fee Related CN108239675B (en) | 2018-03-08 | 2018-03-08 | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108239675B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439790A (en) * | 2018-12-11 | 2019-03-08 | 中国农业科学院郑州果树研究所 | A kind of identification muskmelon type InDel molecular marker and primer thereof and application |
| CN109652412A (en) * | 2019-01-22 | 2019-04-19 | 西北农林科技大学 | The method and application of a kind of SNP marker, detection muskmelon flower property type |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630215A (en) * | 2015-01-23 | 2015-05-20 | 北京市农林科学院 | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers |
| CN107385055A (en) * | 2017-08-09 | 2017-11-24 | 青岛科技大学 | The SNP marker of the genes of muskmelon unisexuality floral formation correlation ACS 7 and application |
-
2018
- 2018-03-08 CN CN201810191880.3A patent/CN108239675B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630215A (en) * | 2015-01-23 | 2015-05-20 | 北京市农林科学院 | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers |
| CN107385055A (en) * | 2017-08-09 | 2017-11-24 | 青岛科技大学 | The SNP marker of the genes of muskmelon unisexuality floral formation correlation ACS 7 and application |
Non-Patent Citations (2)
| Title |
|---|
| BOUALEM,A.等: "Cucumis melo cultivar PI124112 1-aminocyclopropane-1-carboxylic acid synthase (ACS-7) gene, ACS-7-A allele, complete cds", 《GENBANK》 * |
| NAHUI KIM等: "The CmACS-7 Gene Provides Sequence Variation for Development of DNA Markers Associated with Monoecious Sex Expression in Melon", 《HORTIC. ENVIRON. BIOTECHNOL.》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109439790A (en) * | 2018-12-11 | 2019-03-08 | 中国农业科学院郑州果树研究所 | A kind of identification muskmelon type InDel molecular marker and primer thereof and application |
| CN109652412A (en) * | 2019-01-22 | 2019-04-19 | 西北农林科技大学 | The method and application of a kind of SNP marker, detection muskmelon flower property type |
| CN109652412B (en) * | 2019-01-22 | 2022-04-01 | 西北农林科技大学 | SNP molecular marker, method for detecting melon flower type and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108239675B (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107201404B (en) | Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof | |
| CN105368935B (en) | SSR primer sets and method for the Purity Identification of capsicum variety Huifeng 2 | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN109234428A (en) | A kind of molecular labeling and selection of cabbage type rape high erucic acid gene | |
| CN108384875A (en) | A kind of and the relevant insertion/deletion site of capsicum mellow fruit color gene, molecular labeling, molecular labeling primer and application | |
| CN108546774A (en) | A kind of SSR primers and identification method for purple chili Hybrid Purity | |
| CN113637794A (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN105219880A (en) | OncidiumLuridum belongs to EST-SSR labeled primer and application thereof | |
| CN107400721A (en) | With two InDel marks of cucumber yellow-white pericarp close linkage and application | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN108239675A (en) | A kind of molecular marked compound TJcM02 and its application for being used to identify muskmelon unisexual flower | |
| CN110079629A (en) | A kind of SNP marker, detection method and the application of the short climing close linkage of watermelon | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN107142308B (en) | Primer pair, kit and method for identifying cotton closed pollination material | |
| CN105861498B (en) | One kind SNP marker relevant to rubber tree dry incineration method and its application | |
| CN104560961B (en) | The dominant disease-resistant gene ZYMV 1 of cucurbita pepo ZYMV linkage molecule mark and its application | |
| CN106434906B (en) | A kind of and cauliflower bouquet hair floral formation chain SNP site and its detection method and primer sets | |
| CN108977573A (en) | A method of seven-star radish purity of hybrid is identified using SSR molecular marker | |
| CN108165652A (en) | For the specific molecular marker TGMI001 of Chinese torreya seedling stage sex identification | |
| CN109439783A (en) | A kind of SSR primer and method for sweet 25 Purities of muskmelon cenospecies gold | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210202 |