CN108251553B - Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof - Google Patents

Abstract

The invention belongs to the field of biotechnology. A primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, a method and application thereof are provided, wherein the primer is shown as SEQ ID NO: 1 and SEQ ID NO: 2, extracting genome DNA, carrying out first round amplification by using a universal primer, and carrying out second round amplification by using a specific primer, thereby detecting the pathogenic bacteria of the leaf spot of the bighead atractylodes rhizome. The invention has extremely high detection sensitivity, even if the Phoma herbarum is in latent infection and does not express symptoms, the pathogenic bacteria can be detected, and the lowest detection concentration is 1 fg/. mu.L; meanwhile, the method has the characteristics of strong specificity, high accuracy and no interference by other pathogenic bacteria.

Description

Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, and a method and application thereof.

Background

Atractylodes macrocephala (Atractylodes macrocephala) is the dried rhizome of Atractylodes macrocephala of Compositae, is widely planted in Hubei, Anhui, Zhejiang, Hunan and the like, has the effects of strengthening spleen, tonifying qi, eliminating dampness, promoting diuresis, stopping sweating and preventing abortion, is suitable for symptoms such as spleen deficiency, anorexia, abdominal distention, diarrhea, phlegm retention, edema, spontaneous perspiration, threatened abortion and the like, and is a raw material medicine of various Chinese patent medicines.

The morbidity of the largehead atractylodes rhizome leaf spot is 45-80%, some fields can reach 100%, and the disease causes more than 40% of loss of the largehead atractylodes rhizome yield per year. At present, the occurrence of the leaf spot of the bighead atractylodes rhizome is in an aggravating trend, a large amount of loss is caused every year, the planting enthusiasm of the medical farmers in poverty poor mountainous areas is seriously contused, the planting area of the bighead atractylodes rhizome in Hubei province is reduced by about 10% every year at present, and the development of the characteristic industry of the traditional Chinese medicinal material bighead atractylodes rhizome in China is very unfavorable for a. Due to the lack of guidance of plant protection professional talents, various chemical agents are abused in a random way, so that the disease cannot be effectively prevented and controlled, the drug resistance of pathogenic bacteria and environmental pollution are increased, the influence on the yield and quality of white atractylodes rhizome is large, and the further development and the growth of the white atractylodes rhizome industry are seriously threatened. The traditional identification of pathogenic bacteria can be implemented only after the plants show symptoms, the identification needs separation of the pathogenic bacteria, purification culture, verification of Koch's rule, morphological observation, physiological and biochemical properties and the like, the whole process needs about 20 days if the identification is successfully completed, but once other mixed bacteria pollute a culture medium, the identification speed is influenced, and meanwhile, the long-time identification delays the prevention and treatment time. The traditional identification has the defects of inaccurate identification, time consumption and labor waste, and the requirements of accurate and rapid prevention and control of plant protection work cannot be completely met.

In order to solve the current situation of rapid spreading of the leaf spot disease of the bighead atractylodes rhizome and achieve the purpose of rapidly and accurately identifying the leaf spot disease of the bighead atractylodes rhizome caused by Phoma herbarum, a rapid detection method for the leaf spot disease of the bighead atractylodes rhizome caused by Phoma herbarum, which can achieve the target requirements of convenience, rapidness and accuracy, needs to be established urgently. The invention designs specific primers according to the difference of basic group compositions of ITS regions (gene transcription spacers) of Phoma herbarum and other microorganisms belonging to the same genus, adopts nested PCR (nested PCR) to carry out molecular detection on the Phoma herbarum, has simple detection operation, good accuracy and higher sensitivity, and has no report at home and abroad.

Disclosure of Invention

The invention aims to provide a primer for detecting pathogenic bacteria of largehead atractylodes rhizome leaf spot, and provides a Nested (Nested) PCR (polymerase chain reaction) rapid detection method for the pathogenic bacteria of the largehead atractylodes rhizome leaf spot, which has the characteristics of rapidness, accuracy and sensitivity, and effectively improves the convenience, timeliness and accuracy of detecting the largehead atractylodes rhizome leaf spot caused by Phoma herbarum.

The invention is realized by the following technical scheme:

a primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, wherein a pair of PCR primers with specific amplification effect on Phoma herbarum are designed according to the difference nucleic acid base of the gene sequence of Phoma herbarumITS (NCBI Accession No. KY780194) and other Phoma fungi, namely the sequence of a specific molecule detection primer is as follows:

an upstream primer BZYBF:5 'GTCTTTTGAGTACCTTACGTTTCCT 3';

a downstream primer BZYBR: 5 'AAGGCGAGTCTACAGGAGACAAACA 3';

in addition, the invention provides a rapid detection method of pathogenic bacteria of leaf spot of bighead atractylodes rhizome, which is rapid, accurate and simple to operate, and specifically comprises the following steps:

1) extracting genome DNA of a sample to be detected;

2) carrying out first round PCR amplification by using universal primers ITS1/ITS 4; the universal primer is as follows: ITS 1: 5 'TCCGTAGGTGAACCTGCGG 3'; ITS 4: 5 'TCCTCCGCTTATT GATATGC 3';

3) diluting the first round amplification product by 10 times, using the diluted product as a template, and performing second round PCR amplification by using a specific primer BZY BF/BZYBR; the specific primers are as follows: BZYBF:5 'GTCT TTTGAGTACCTTACGTTTCCT 3'; BZYBR: 5 'AAGGCGAGTCTACAGGAGACA AACA 3';

4) and (3) performing gel electrophoresis detection, performing photographing detection in a gel imaging system, and determining that the pathogenic bacteria of the leaf spot of the bighead atractylodes rhizome exist in the detected sample if 313bp DNA specific bands exist.

Further, the sample genome is extracted by a CTAB method.

Further, the reaction system of the first round of PCR amplification is 25 μ L: 2 xTaq Master Mix 12.5 uL, 10 uM upstream and downstream primers ITS1/ITS4 each 1 uL, DNA1 uL, double distilled water 9.5 uL; the reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min, 94 ℃ for 30 sec, 54 ℃ for 1 min, 72 ℃ for 1 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

Further, the reaction system of the second round of PCR amplification is 25 μ L: 2 XTaq Master Mix 12.5 μ L, 10 μ M upstream and downstream primers BZYBF/BZYBR each 1 μ L, D NA template 1 μ L, double distilled water 9.5 μ L; the reaction procedure is as follows: pre-denaturation at 94 ℃ for 3 min, followed by 94 ℃ for 30 sec, 50 ℃ for 30 sec, 72 ℃ for 30 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

The invention also provides application of the specific primer BZYBF/BZYBR in detecting the pathogenic bacteria of the leaf spot of the bighead atractylodes rhizome, which is realized by performing nested PCR amplification and performing gel electrophoresis detection through a primer composition consisting of a general primer and the specific primer BZYBF/BZYBR.

In addition, the invention also provides a kit for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, which comprises specific primers BZYBF/BZYBR and a universal primer ITS1/I TS 4.

The invention has the beneficial effects that:

1) the primer and the method have extremely high detection sensitivity, can detect the genome DNA of the Phoma herbarum at 1 fg/. mu.L, improve the sensitivity by 1000 times compared with the conventional PCR detection method, and can accurately detect the Pho ma herbarum even in the latent period or under the condition of extremely slight infection;

2) the method can amplify a single 313b p band aiming at the genomic DNA of the largehead atractylodes rhizome leaf spot bacterium, has strong specificity, is slightly interfered by exogenous genomic DNA and has high precision;

3) the method has the characteristics of short time consumption and simple operation, does not need complex detection places and laboratories, completes the whole detection procedure for about 3 hours, and requires at least 20 days for the conventional pathogenic bacteria identification method;

4) the invention is suitable for the introduction and quarantine of the white atractylodes rhizome, the quality detection of the detoxified seed seedlings and the early asymptomatic plant detection of the leaf spot resistance identification caused by the resistance of the white atractylodes rhizome to Phoma herbarum.

Drawings

FIG. 1 is the specific detection of specific primers BZYBF/BZYBR against Phoma herbarum genomic DNA; wherein lane 1 is DL2000 Marker; lane 2 is a clear water blank control, a negative control; lane 3 is Phoma herbarum genomic DNA, positive control; lanes 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 are Phoma adonidicola, Phoma carteri, Phoma digitalis, Phoma gardeniae, Phoma infossa, P homa tropica, Phoma exigua, Aspergillus oryzae, Rhizomucor solani and Atractylodes macrocephala plant genome D NA;

FIG. 2 is a conventional PCR detection of Phoma herbarum genomic DNA with specific primers BZYBF/BZYBR; wherein lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-11 are Phoma herbarum genomic DNA at 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L and 1 fg/. mu.L, respectively;

FIG. 3 shows the detection of Phoma herbar genomic DNA by Nested PCR of specific primers BZYBF/BZYBR; wherein lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-11 are Phoma herbarum genomic DNA at 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L and 1 fg/. mu.L, respectively;

FIG. 4 shows that the specific primer BZYBF/BZYBR detects field largehead atractylodes leaf spot under the condition of Nested PCR; wherein lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-6 are leaf spot plants, 7-11 are healthy disease-free plants, respectively.

Detailed Description

The technical solutions of the present invention will be described clearly and completely below with reference to specific embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The test methods used in the following examples are all conventional methods unless otherwise specified.

The experimental materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 establishment of specific PCR detection method for pathogenic bacteria of leaf spot of Atractylodes macrocephala Koidz

1. Extraction of pathogenic genome DNA of largehead atractylodes rhizome leaf spot

The pathogenic bacteria of the leaf spot disease of the bighead atractylodes rhizome, Phoma herbarum, are preserved in a microbiological research laboratory of the institute of Chinese medicinal materials of the academy of agricultural sciences of Hubei province. After one week of culture on PDA plates containing cellophane, total genomic DNA of pathogenic bacteria was extracted by CTAB method.

2. Design of specific molecule detection primer

And carrying out PCR amplification sequencing on the obtained total genome DNA of the pathogenic bacteria, and designing a pair of PCR primers having a specific amplification effect on Phoma herbarum, namely the sequences of the specific molecule detection primers are as follows:

upstream primer BZYBF: 5' GTCTTTTGAGTACCTTACGTTTCCT 3 ″

A downstream primer BZYBR: 5 'AAGGCGAGTCTACAGGAGACAAACA 3'

3. Establishment of rapid molecular detection method for pathogenic bacteria of largehead atractylodes rhizome leaf spot

1) Extracting DNA from the largehead atractylodes rhizome plant, extracting sample genome DNA by using a CTAB method, and then storing at-20 ℃;

2) carrying out first round PCR amplification by using the extracted DNA of the largehead atractylodes rhizome plant as a template and using a universal primer

The sequence of the universal primer ITS1/ITS4 is as follows:

ITS1：5`TCCGTAGGTGAACCTGCGG 3`；

ITS4：5`TCCTCCGCTTATTGATATGC 3`。

the total volume of the reaction system is 25 mu L, and the reaction components are as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers ITS1/ITS4 each 1. mu.L, DNA 1. mu.L, double distilled water 9.5. mu.L.

The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, 94 ℃ for 30 sec, 54 ℃ for 1 min, 72 ℃ for 1 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

3) The first round amplification product was diluted 10-fold, and 1. mu.L of the diluted product was used as a template for the second round amplification

Upstream primer BZYBF: 5' GTCTTTTGAGTACCTTACGTTTCCT 3 ″

A downstream primer BZYBR: 5 'AAGGCGAGTCTACAGGAGACAAACA 3'

The total volume of the reaction system is 25 muL, the first round amplification product is diluted by 10 times, 1 muL is taken as a template, and the reaction components are as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers BZYBF/BZYBR each 1. mu.L, double distilled water 9.5. mu.L.

The amplification reaction procedure was: pre-denaturation at 94 ℃ for 3 min, followed by 94 ℃ for 30 sec, 52 ℃ for 30 sec, 72 ℃ for 30 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

4) Electrophoretic detection of amplification products

And taking 7 mu L of amplification product, adding 100 mu L (volume ratio) of Goldview I type nucleic acid staining agent into 1% (mass/volume) agarose gel and 100ml agarose gel, carrying out electrophoresis at a voltage of 120V for 20 minutes, photographing and detecting under a gel imaging system, and determining that Phoma herbarum exists in the detected sample if a DNA specific strip with 313bp exists.

Example 2 specific detection of genomic DNA against Phoma herbarum

Phoma adonidicola, Phoma carteri, Phoma digitalis, Phoma gardeniae, Phoma infossa, Phoma tropica, Phoma exigua, Aspergillus oryzae, southern sclerotium and Atractylodes macrocephala plant genome DNA is extracted by a CTAB method, the genome DNA of Phoma herbar um is used as a positive control, clean water is used as a negative control, and 1 mu L of each pathogen DNA is used as a template for carrying out PCR.

The reaction system is as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers BZYBF/BZYBR each 1. mu.L, double distilled water 9.5. mu.L. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 52 ℃ for 30 sec, 72 ℃ for 30 sec, 30 cycles, and final extension at 72 ℃ for 3 min.

mu.L of the amplification product was collected, and 1% (mass/volume) agarose gel was used, 100mL agarose gel was added with 100. mu.L (mass/volume ratio) of Goldview I nucleic acid staining reagent, and the mixture was electrophoresed at 120V for 20 minutes and photographed under a gel imaging system for detection.

As shown in FIG. 1, 313bp single band can be amplified by using the primer BZYBF/BZYBR of the invention to the genomic DNA of the largehead atractylodes leaf spot fungus, and genomic DNAs of Phoma adonidicola, Phoma carteri, Phoma digitalis, Phoma gardeniae, Phoma infossa, Phoma tropica, Phoma exigua, Aspergillus oryzae, southern sclerotium and largehead atractylodes rhizome plants can not be detected, so that the specificity is strong, the interference by exogenous genomic DNA is small, and the precision is high.

Example 3 detection of Phoma herbarum genomic DNA by conventional PCR

Phoma herbarum genomic DNA was diluted in the order of 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, 1 fg/. mu.L for a total of 9 concentration gradients, and then subjected to PCR.

The total volume of the PCR reaction system is 25 mu L, and the reaction system is as follows: 2 XTaq Master M ix 12.5. mu.L, 10. mu.M upstream and downstream primers BZYBF/BZYBR each 1. mu.L, double distilled water 9.5. mu.L. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 50 ℃ for 30 sec, 72 ℃ for 30 sec, 30 cycles, and final extension at 72 ℃ for 3 min.

mu.L of the amplification product was collected, and 1% (mass/volume) agarose gel was used, 100mL agarose gel was added with 100. mu.L (mass/volume ratio) of Goldview I nucleic acid staining reagent, and the mixture was electrophoresed at 120V for 20 minutes and photographed under a gel imaging system for detection.

The result is shown in figure 2, the primer BZYBF/BZYBR of the invention can detect the genome DNA of the Phoma herbarum with the concentration of 100 pg/mu L by utilizing the conventional PCR technology, and the detection limit can not be well detected when the detection limit is lower than 100 g/mu L.

Example 4Nested PCR detection of Phoma herbarum genomic DNA

After the phoma aquilegicola genomic DNA was sequentially diluted to 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, 1 fg/. mu.L, 100 ag/. mu.L, 10 ag/. mu.L, 1 ag/. mu.L for 12 concentration gradients, first PCR was performed using primers ITS1/ITS4, and the amplification reaction procedure was: pre-denaturing at 94 ℃ for 5 minutes, then at 94 ℃ for 30 seconds, at 54 ℃ for 1 minute, at 72 ℃ for 1 minute, for 30 cycles, and finally, extending at 72 ℃ for 3 minutes, taking 1 microlitre of the PCR product diluted by 10 times as a template and primers BZYBF/BZYBR, and carrying out second round PCR by using a reaction system as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers BZYBF/BZYBR each 1. mu.L, double distilled water 9.5. mu.L. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 52 ℃ for 30 sec, 72 ℃ for 30 sec, 30 cycles, and final extension at 72 ℃ for 3 min.

mu.L of the amplification product was collected, and 1% (mass/volume) agarose gel was used, 100ml agarose gel was added with 100. mu.L (mass/volume ratio) of Goldview I type nucleic acid staining reagent, and the mixture was electrophoresed at 120V for 20 minutes and photographed under a gel imaging system for detection.

As shown in FIG. 3, the detection sensitivity of the invention is extremely high, and the invention can detect the Phoma herbarum genome DNA of 1 fg/. mu.L, the sensitivity is improved by one hundred thousand times compared with the conventional PCR detection method, and the Phoma herbarum can be accurately detected even in the latent period or under the condition of extremely slight infection.

Example 5 specific primers for detecting pathogenic bacteria of leaf spot of Atractylodes macrocephala in field

Randomly collecting 5 bighead atractylodes rhizome plants with obvious leaf spot disease symptoms in a bighead atractylodes rhizome planting base of a institute of traditional Chinese medicine of agriculture academy of sciences in Enshi city of Hubei province, 5 bighead atractylodes rhizome plants without obvious leaf spot disease symptoms in a healthy field in 2015 7 months, numbering the samples according to the sequence of 2-11, and extracting sample DNA according to a CTAB method. The N ested PCR assay was performed according to the procedure example 4.

The results are shown in fig. 4, and the 4 collected atractylodes macrocephala koidz plants with obvious leaf spot disease symptoms are detected to be banding, while the 4 healthy atractylodes macrocephala koidz plants without obvious leaf spot disease symptoms are not detected, which indicates that the method is feasible in practical application.

Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Sequence listing

<110> institute of Chinese medicinal materials of academy of agricultural sciences of Hubei province

<120> primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, and method and application thereof

<141> 2018-03-29

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtcttttgag taccttacgt ttcct 25

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaggcgagtc tacaggagac aaaca 25

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tccgtaggtg aacctgcgg 19

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcctccgctt attgatatgc 20

Claims (4)

1. Pathogenic bacteria of leaf spot of bighead atractylodes rhizomePhoma herbarumA rapid detection method for non-disease diagnostic purposes, comprising the steps of:

1) extracting genome DNA of a sample to be detected;

2) using the nucleotide sequence as shown in SEQ ID NO: 3 and SEQ ID NO: 4, carrying out first round PCR amplification by using universal primers ITS1/ITS 4;

3) the first round amplification product was diluted 10-fold and used as template with the nucleic acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, performing second PCR amplification by using a specific primer BZYBF/BZYBR;

4) and (3) performing gel electrophoresis detection, performing photographing detection in a gel imaging system, and determining that the pathogenic bacteria of the leaf spot of the bighead atractylodes rhizome exist in the detected sample if 313bp DNA specific bands exist.

2. The pathogenic bacteria of largehead atractylodes rhizome leaf spot according to claim 1Phoma herbarumThe rapid detection method for non-disease diagnosis is characterized in that the sample genome is extracted by a CTAB method.

3. The pathogenic bacteria of largehead atractylodes rhizome leaf spot according to claim 1Phoma herbarumThe rapid detection method for non-disease diagnosis is characterized in that the reaction system of the first round of PCR amplification is 25 mu L: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers ITS1/ITS4 each 1. mu.L, DNA 1. mu.L, double distilled water 9.5. mu.L; the reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min, 94 ℃ for 30 sec, 54 ℃ for 1 min, 72 ℃ for 1 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

4. The pathogenic bacteria of largehead atractylodes rhizome leaf spot according to claim 1Phoma herbarumThe rapid detection method for non-disease diagnosis is characterized in that the reaction system of the second round of PCR amplification is 25 mu L: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers BZYBF/BZYBR each 1. mu.L, DNA template 1. mu.L, double distilled water 9.5. mu.L; the reaction procedure is as follows: pre-denaturation at 94 ℃ for 3 min, followed by 94 ℃ for 30 sec, 52 ℃ for 30 sec, 72 ℃ for 30 min, 30 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

Images