CN108251553A - A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria - Google Patents
A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria Download PDFInfo
- Publication number
- CN108251553A CN108251553A CN201810271863.0A CN201810271863A CN108251553A CN 108251553 A CN108251553 A CN 108251553A CN 201810271863 A CN201810271863 A CN 201810271863A CN 108251553 A CN108251553 A CN 108251553A
- Authority
- CN
- China
- Prior art keywords
- rhizoma atractylodis
- atractylodis macrocephalae
- primer
- leaf spot
- pathogenic bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biotechnologies.It is proposed a kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, the primer such as SEQ ID NO：1 and SEQ ID NO：Shown in 2, by extracting genome DNA, universal primer carries out first round amplification, and specific primer carries out the second wheel amplification, so as to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria.The present invention has detection sensitivity high, even if being in latent infection in Phoma herbarum, the presence of pathogen can be also detected when not showing symptom, minimal detectable concentration is 1fg/ μ L；There is high specificity simultaneously, will not be interfered by other pathogens, the characteristics of accuracy rate is high.
Description
Technical field
The invention belongs to biotechnologies, and in particular to it is a kind of for detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria primer and its
Methods and applications.
Background technology
Rhizoma Atractylodis Macrocephalae (Atractylodes macrocephala) be composite family rhizoma atractylodis platymiscium Rhizoma Atractylodis Macrocephalae dry rhizome, Hubei,
The ground such as Anhui, Zhejiang, Hunan are planted extensively, have the effect of strengthening the spleen and replenishing qi, eliminate dampness and have diuretic effect, hidroschesis tocolysis, are eaten suitable for spleen deficiency
Less, the diseases such as abdominal distention diarrhea, phlegm and retained fluid, oedema, spontaneous perspiration, fetal irritability are the bulk pharmaceutical chemicals of a variety of Chinese patent drugs.
The incidence of Rhizoma Atractylodis Macrocephalae leaf spot is 45%-80%, and some fields up to 100%, every year make Rhizoma Atractylodis Macrocephalae yield by disease
Into loss be more than 40%.The generation of Rhizoma Atractylodis Macrocephalae leaf spot at present is in exacerbation trend, all causes largely to lose every year, serious contusion is poor
Tired mountain area medicinal herb grower plants enthusiasm, and Rhizoma Atractylodis Macrocephalae cultivated area in Hubei Province's reduces about 10% every year at present, is extremely unfavorable for for a long time
The development of our province Chinese medicine Rhizoma Atractylodis Macrocephalae specialty industries.Due to lack the Plant Protection Specialty talent guidance, exist disorderly apply abuse it is all kinds of
The situation of chemical agent not only fails effective controlling disease, and increases drug resistance and the environmental pollution of pathogenic bacteria, these are right
Rhizoma Atractylodis Macrocephalae yield and quality is affected, the further development and growth of serious threat Rhizoma Atractylodis Macrocephalae industry.The identification of traditional pathogen must
It must can just implement after plant shows symptom, need pathogenicbacteria separation, purifying culture, the verification of Ke Heshi rules, morphology
Observation, Physiological-biochemical Characters etc. go to identify, smoothly completing whole process needs about 20 days, but it is miscellaneous once to generate other
Bacterium pollutes culture medium, will influence to differentiate speed, while prolonged identification delays prevention opportunity.There is identification not in conventional identification
The shortcomings that accurate, time-consuming, laborious, does not fully meet the requirement of accurate, the quick prevention and control of plant protection work.
In order to solve the present situation that Rhizoma Atractylodis Macrocephalae leaf spot is quickly spread, realize that fast and accurate identification Phoma herbarum draw
The purpose of the Rhizoma Atractylodis Macrocephalae leaf spot risen, urgent need, which establishes one kind, can realize " convenient ", " quick " and the Phoma of " accurate " target call
Herbarum causes the rapid detection method of Rhizoma Atractylodis Macrocephalae leaf spot.The present invention is according to Phoma herbarum and belongs to other microorganisms
ITS regions (internal gene transcribed spacers) base composition difference and design specific primer, using nest-type PRC (Nested PCR)
Molecular Detection is carried out to Phoma herbarum, detection is easy to operate, accuracy is good, sensitivity is higher, does not there is report both at home and abroad
Road.
Invention content
The object of the present invention is to provide a kind of for detecting the primer of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, and Rhizoma Atractylodis Macrocephalae leaf spot is put forward
Pathogenic bacteria nido (Nested) PCR rapid detection methods have the characteristics of quick, accurate, sensitive, effectively increase detection
Phoma herbarum cause the convenience, promptness and accuracy of Rhizoma Atractylodis Macrocephalae leaf spot.
The present invention is realized especially by following technical scheme：
A kind of primer for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, the specific primer is according to Phoma
HerbarumITS gene orders (NCBI Accession No.KY780194) belong to fungi otherness nucleic acid alkali with other Phoma
Base designs the sequence to Phoma herbarum one couple of PCR primers, i.e. special molecular detection primer with specific amplified effect
For：
Sense primer BZYBF：5`GTCTTTTGAGTACCTTACGTTTCCT 3`；
Downstream primer BZYBR：5`AAGGCGAGTCTACAGGAGACAAACA 3`；
In addition, the present invention provides a kind of quick detection sides of quick, accurate, easy to operate Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria
Method specifically includes following steps：
1) sample to be tested genomic DNA is extracted；
2) first round PCR amplification is carried out using universal primer ITS1/ITS4；The universal primer is：ITS1：5`
TCCGTAGGTGAACCTGCGG 3`；ITS4：5`TCCTCCGCTTATT GATATGC 3`；
3) first round amplified production is diluted 10 times, as template, second is carried out using special primer BZY BF/BZYBR
Take turns PCR amplification；The special primer is：BZYBF：5`GTCT TTTGAGTACCTTACGTTTCCT 3`；BZYBR：5`
AAGGCGAGTCTACAGGAGACA AACA 3`；
4) detected through gel electrophoresis, detection of taking pictures under gel imaging system, there are the DNA specific bands of 313bp, then really
It is fixed to detect in sample that there are Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria.
Further, the sample gene group is extracted using CTAB methods.
Further, the reaction system of the first round PCR amplification is 25 μ L：2 × Taq Master Mix, 12.5 μ L,
10 μM of upstream and downstream primer ITS1/ITS4 each 1 μ L, DNA1 μ L, 9.5 μ L of distilled water；Response procedures are：94 DEG C of pre-degeneration 5 minutes,
94 DEG C 30 seconds, 54 DEG C 1 minute, 72 DEG C 1 minute, 30 cycle, finally 72 DEG C extend 3 minutes, 16 DEG C preservation.
Further, the reaction system of the second wheel PCR amplification is 25 μ L：2 × Taq Master Mix, 12.5 μ L,
10 μM of upstream and downstream primer BZYBF/BZYBR each 1 μ L, D NA templates, 1 μ L, 9.5 μ L of distilled water；Response procedures are：Pre-degeneration 94
DEG C 3 minutes, then 94 DEG C 30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 minutes, 30 cycles finally extend 3 minutes, 16 DEG C of guarantors at 72 DEG C
It deposits.
The present invention also provides the specific primer BZYBF/BZYBR answering in Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria are detected
With the Primer composition being generally made up of universal primer and the specific primer BZYBF/BZYBR carries out nest-type PRC
Amplification is realized carrying out detected through gel electrophoresis.
In addition, the present invention also provides a kind of for detecting the kit of detection Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, the examination
Agent box includes specific primer BZYBF/BZYBR and universal primer ITS1/I TS4.
Beneficial effects of the present invention are：
1) primer of the present invention and method detection sensitivity are high, can detect the Phoma herbarum genes of 1fg/ μ L
Group DNA, more conventional PCR detection method sensitivity improve 1000 times, even if in the case where incubation period or infection are extremely slight
Also Pho ma herbarum can accurately be detected；
2) the method for the present invention can amplify the single band of 313b p for Rhizoma Atractylodis Macrocephalae leaf spot fungi genomic DNA, specifically
Property it is strong, interfered by foreign gene group DNA small, precision is high；
3) present invention, which also has, takes the characteristics of short, easy to operate, does not need to complicated detection place and laboratory, completes whole
A detection about 3 hours of program, conventional pathogen identification method at least need 20 days；
4) present invention introduces a fine variety quarantine, the quality testing of detoxification seed seedling and the anti-Phoma of Rhizoma Atractylodis Macrocephalae suitable for Rhizoma Atractylodis Macrocephalae
The asymptomatic plant detection of leaf spot Resistance Identification early stage caused by herbarum.
Description of the drawings
Fig. 1 is the specific detection that special primer BZYBF/BZYBR is directed to Phoma herbarum genomic DNAs；Wherein
Swimming lane 1 is DL2000Marker；Swimming lane 2 is clear water blank control, is negative control；Swimming lane 3 is Phoma herbarum genes
Group DNA, positive control；Swimming lane 4,5,6,7,8,9,10,11,12,13 for Phoma adonidicola, Ph oma carteri,
Phoma digitalis, Phoma gardeniae, Phoma infossa, P homa tropica, Phoma exigua, rice
Aspergillus, Sclerotiumrolfsii and Rhizoma Atractylodis Macrocephalae plant genome D NA；
Fig. 2 is the Standard PCR detection Phoma herbarum genomic DNAs of special primer BZYBF/BZYBR；Wherein swimming lane
1 is DL2000Marker；Swimming lane 2 is clear water blank control；Swimming lane 3-11 be respectively Phoma herbarum genomic DNAs successively
For 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L and 1fg/ μ L；
Fig. 3 is the Nested PCR detection Phoma herbar um genomic DNAs of special primer BZYBF/BZYBR；Wherein
Swimming lane 1 is DL2000Marker；Swimming lane 2 is clear water blank control；Swimming lane 3-11 is respectively Phoma herbarum genomic DNAs
It is followed successively by 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L and 1fg/ μ
L；
Fig. 4 is that special primer BZYBF/BZYBR detects field Rhizoma Atractylodis Macrocephalae leaf spot under the conditions of Nested PCR；Wherein swimming lane
1 is DL2000Marker；Swimming lane 2 is clear water blank control；Swimming lane 3-6 is respectively leaf spot plant, and 7-11 is the disease-free plant of health
Strain.
Specific embodiment
Below in conjunction in specific embodiment of the present invention, real technical solution of the invention is clearly and completely described,
Obviously, described embodiment is only part of the embodiment of the present invention, instead of all the embodiments.Based in the present invention
Embodiment, those of ordinary skill in the art's all other embodiments obtained without making creative work, all
Belong to the scope of protection of the invention.
Test method used in following embodiments is conventional method unless otherwise specified.
Experiment material, reagent used in following embodiments etc. unless otherwise specified, commercially obtain.
The foundation of 1 Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria PCR method for detecting specificity of embodiment
1st, the extraction of Rhizoma Atractylodis Macrocephalae leaf spot Disease-causing gene group DNA
Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria Phoma herbarum are ground for Research Institute of Traditional Chinese Medicine microorganism
Study carefully room preservation.It is cultivated on the PDA plate containing glassine paper after a week, pathogenic bacteria total genomic dna is extracted with CTAB methods.
2nd, the design of special molecular detection primer
PCR amplification sequencing is carried out to obtained germ total genomic dna, designing has Phoma herbarum special expand
One couple of PCR primers of increasing effect, the i.e. sequence of special molecular detection primer are：
Sense primer BZYBF:5`GTCTTTTGAGTACCTTACGTTTCCT 3`
Downstream primer BZYBR：5`AAGGCGAGTCTACAGGAGACAAACA 3`
3rd, the foundation of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria rapid molecular detection method
1) DNA is extracted from Rhizoma Atractylodis Macrocephalae plant, sample gene group DNA is extracted using CTAB methods, then in -20 DEG C of preservations；
2) to extract Rhizoma Atractylodis Macrocephalae plant DNA as template first round PCR amplification is carried out using universal primer
The sequence of universal primer ITS1/ITS4 is：
ITS1：5`TCCGTAGGTGAACCTGCGG 3`；
ITS4：5`TCCTCCGCTTATTGATATGC 3`.
Reaction system total volume is 25 μ L, and reactive component is：2 × Taq Master Mix, 12.5 μ L, 10 μM of upstream and downstream
Each 1 μ L of primer I TS1/ITS4,1 μ L of DNA, 9.5 μ L of distilled water.
Amplified reaction program is：94 DEG C of pre-degeneration 5 minutes, 94 DEG C 30 seconds, 54 DEG C 1 minute, 72 DEG C 1 minute, 30 cycles,
Finally extend at 72 DEG C 3 minutes, 16 DEG C of preservations.
3) first round amplified production is diluted 10 times, 1 μ L is taken to carry out the second wheel amplification as template
Sense primer BZYBF:5`GTCTTTTGAGTACCTTACGTTTCCT 3`
Downstream primer BZYBR：5`AAGGCGAGTCTACAGGAGACAAACA 3`
Reaction system total volume is 25 μ L, and first round amplified production is diluted 10 times, takes 1 μ L as template, reactive component
For：2 × Taq Master Mix 12.5 μ L, 10 μM of each 1 μ L of upstream and downstream primer BZYBF/BZYBR, 9.5 μ L of distilled water.
Amplified reaction program is：94 DEG C of pre-degeneration 3 minutes, then 94 DEG C 30 seconds, 52 DEG C 30 seconds, 72 DEG C 30 minutes, 30
Cycle finally extends 3 minutes, 16 DEG C of preservations at 72 DEG C.
4) amplified production electrophoresis detection
7 μ L amplified productions are taken, using 1% (mass/volume) Ago-Gel, 100ml agarose gels add in 100 μ L (bodies
Product ratio) Goldview I type nucleic acid staining agent, electrophoresis 20 minutes under voltage 120V, inspection of taking pictures under gel imaging system
It surveys, if there is the DNA specific bands of 313bp, it is determined that detect in sample that there are Phoma herbarum.
Embodiment 2 is directed to the specific detection of Phoma herbarum genomic DNAs
Utilize CTAB methods extraction Phoma adonidicola, Phoma carteri, Phoma digitalis, Phoma
Gardeniae, Phoma infossa, Phoma tropica, Phoma exigua, rice aspergillus, Sclerotiumrolfsii and Rhizoma Atractylodis Macrocephalae plant base
Because of a group DNA, using the genomic DNA of Phoma herbar um as positive control, while clear water is set for negative control, take with
Upper each 1 μ L of pathogen DNA carry out PCR as template.
Reaction system is：2 × Taq Master Mix 12.5 μ L, 10 μM of each 1 μ L of upstream and downstream primer BZYBF/BZYBR,
9.5 μ L of distilled water.Amplified reaction program is：94 DEG C of pre-degeneration 5 minutes, then 94 DEG C 30 seconds, 52 DEG C 30 seconds, 72 DEG C 30 seconds, 30
A cycle finally extends 3 minutes at 72 DEG C.
7 μ L amplified productions are taken, using 1% (mass/volume) Ago-Gel, 100mL agarose gels add in 100 μ L (matter
Measure volume ratio) Goldview I type nucleic acid staining agent, electrophoresis 20 minutes under voltage 120V are taken pictures under gel imaging system
Detection.
The results are shown in Figure 1, can be with for Rhizoma Atractylodis Macrocephalae leaf spot fungi genomic DNA using primer BZYBF/BZYBR of the present invention
The single band of 313bp is amplified, not will detect that Phoma adonidicola, Phoma carteri, Phoma
It is digitalis, Phoma gardeniae, Phoma infossa, Phoma tropica, Phoma exigua, rice aspergillus, white
Thin,tough silk bacterium and Rhizoma Atractylodis Macrocephalae plant genomic DNA, high specificity are interfered small, precision height by foreign gene group DNA.
3 Standard PCR of embodiment detects Phoma herbarum genomic DNAs
By Phoma herbarum genomic DNAs be diluted to successively 100ng/ μ L, 10ng/ μ L, 1ng/ μ L, 100pg/ μ L,
10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L, 1fg/ μ L add up to 9 concentration gradients, then carry out PCR.
PCR reaction systems total volume is 25 μ L, and reaction system is：2 × Taq Master M ix 12.5 μ L, 10 μM upper
Each 1 μ L of downstream primer BZYBF/BZYBR, 9.5 μ L of distilled water.Amplified reaction program is：94 DEG C of pre-degeneration 5 minutes, then 94 DEG C
30 seconds, 50 DEG C 30 seconds, 72 DEG C 30 seconds, 30 cycle, finally 72 DEG C extend 3 minutes.
7 μ L amplified productions are taken, using 1% (mass/volume) Ago-Gel, 100mL agarose gels add in 100 μ L (matter
Measure volume ratio) Goldview I type nucleic acid staining agent, electrophoresis 20 minutes under voltage 120V are taken pictures under gel imaging system
Detection.
The results are shown in Figure 2, and 100pg/ μ L can be detected using Standard PCR present invention primer BZYBF/BZYBR
Phoma herbarum genomic DNAs, detection limit be less than 100g/ μ L when cannot be detected well.
Embodiment 4Nested PCR detect Phoma herbarum genomic DNAs
By phoma aquilegiicola genomic DNAs be diluted to successively 100ng/ μ L, 10ng/ μ L, 1ng/ μ L,
100pg/ μ L, 10pg/ μ L, 1pg/ μ L, 100fg/ μ L, 10fg/ μ L, 1fg/ μ L, 100ag/ μ L, 10ag/ μ L, 1ag/ μ L add up to 12
A concentration gradient, then carries out first round PCR using primer I TS1/ITS4, and amplified reaction program is：94 DEG C of pre-degeneration 5 minutes,
Then 94 DEG C 30 seconds, 54 DEG C 1 minute, 72 DEG C 1 minute, 30 cycle, finally 72 DEG C extend 3 minutes, take above-mentioned PCR product dilute
It releases 10 times and takes 1 μ L as template, primer BZYBF/BZYBR carries out the second wheel PCR, and reaction system is：2×Taq Master
Mix 12.5 μ L, 10 μM of each 1 μ L of upstream and downstream primer BZYBF/BZYBR, 9.5 μ L of distilled water.Amplified reaction program is：Pre-degeneration
94 DEG C 5 minutes, then 94 DEG C 30 seconds, 52 DEG C 30 seconds, 72 DEG C 30 seconds, 30 cycles finally extend 3 minutes at 72 DEG C.
7 μ L amplified productions are taken, using 1% (mass/volume) Ago-Gel, 100ml agarose gels add in 100 μ L (matter
Measure volume ratio) Goldview I type nucleic acid staining agent, electrophoresis 20 minutes under voltage 120V are taken pictures under gel imaging system
Detection.
The results are shown in Figure 3, and detection sensitivity of the present invention is high, can detect the Phoma herbarum bases of 1fg/ μ L
Because of a group DNA, more conventional PCR detection method sensitivity improves 100,000 times, even if in incubation period or infecting extremely slight situation
Under also can accurately detect Phoma herbarum.
5 special primer of embodiment surveys field Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria
In July, 2015 is in Enshi City San Cha townshiies of Hubei Province Research Institute of Traditional Chinese Medicine's Rhizoma Atractylodis Macrocephalae planting base
Random acquisition has 5 plants of a Rhizoma Atractylodis Macrocephalae plant of apparent tikka disease symptoms, and healthy field is without apparent 5 plants of tikka disease symptoms Rhizoma Atractylodis Macrocephalae plant, then
It is numbered according to the sequence of 2-11 for sample, then extracts sample DNA according to CTAB methods.N is carried out with reference to step embodiment 4
Ested PCR are detected.
The results are shown in Figure 4, and 4 plant Rhizoma Atractylodis Macrocephalae plant of the acquisition with apparent tikka disease symptoms detect band, and healthy
No 4 plants of Rhizoma Atractylodis Macrocephalae plant of apparent tikka disease symptoms do not detect then, illustrate that the method for the present invention is practical in practical application.
It although an embodiment of the present invention has been shown and described, for the ordinary skill in the art, can be with
Understanding without departing from the principles and spirit of the present invention can carry out these embodiments a variety of variations, modification, replace
And modification, the scope of the present invention is defined by the appended.
Sequence table
<110>Research Institute of Traditional Chinese Medicine
<120>A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria
<141> 2018-03-29
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gtcttttgag taccttacgt ttcct 25
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
aaggcgagtc tacaggagac aaaca 25
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tccgtaggtg aacctgcgg 19
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
tcctccgctt attgatatgc 20
Claims (9)
- A kind of 1. primer for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, which is characterized in that the primer such as SEQ ID NO：1 He SEQ ID NO：Shown in 2.
- 2. a kind of rapid detection method of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, which is characterized in that include the following steps：1) sample to be tested genomic DNA is extracted；2) first round PCR amplification is carried out using universal primer ITS1/ITS4；3) first round amplified production is diluted 10 times, as template, the second wheel PCR amplification is carried out using special primer；4) detected through gel electrophoresis, detection of taking pictures under gel imaging system, there are the DNA specific bands of 313bp, it is determined that institute There are Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria in detection sample.
- 3. the rapid detection method of a kind of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria according to claim 2, which is characterized in that described Sample gene group is extracted using CTAB methods.
- 4. the rapid detection method of a kind of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria according to claim 2, which is characterized in that described Universal primer such as SEQ ID NO：3 and SEQ ID NO：Shown in 4.
- 5. the rapid detection method of a kind of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria according to claim 2, which is characterized in that described Specific primer such as SEQ ID NO：1 and SEQ ID NO：Shown in 2.
- 6. the rapid detection method of a kind of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria according to claim 2, which is characterized in that described The reaction system of first round PCR amplification is 25 μ L：2 × Taq Master Mix 12.5 μ L, 10 μM of upstream and downstream primer ITS1/ ITS4 each 1 μ L of 1 μ L, DNA, 9.5 μ L of distilled water；Response procedures are：94 DEG C of pre-degeneration 5 minutes, 94 DEG C 30 seconds, 54 DEG C 1 minute, 72 DEG C 1 minute, 30 cycle, finally 72 DEG C extend 3 minutes, 16 DEG C preservation.
- 7. the rapid detection method of a kind of Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria according to claim 2, which is characterized in that described The reaction system of second wheel PCR amplification is 25 μ L：2 × Taq Master Mix 12.5 μ L, 10 μM of upstream and downstream primer BZYBF/ Each 1 μ L of BZYBR, 1 μ L of DNA profiling, 9.5 μ L of distilled water；Response procedures are：94 DEG C of pre-degeneration 3 minutes, then 94 DEG C 30 seconds, 52 DEG C 30 seconds, 72 DEG C 30 minutes, 30 cycles finally extend 3 minutes, 16 DEG C of preservations at 72 DEG C.
- 8. the primer described in claim 1 for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria is in Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria are detected Using.
- 9. a kind of kit for detection detection Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria, which is characterized in that the kit includes power Profit requires the primer described in 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271863.0A CN108251553B (en) | 2018-03-29 | 2018-03-29 | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271863.0A CN108251553B (en) | 2018-03-29 | 2018-03-29 | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108251553A true CN108251553A (en) | 2018-07-06 |
| CN108251553B CN108251553B (en) | 2021-06-18 |
Family
ID=62747273
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810271863.0A Active CN108251553B (en) | 2018-03-29 | 2018-03-29 | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108251553B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110643726A (en) * | 2019-10-16 | 2020-01-03 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for soft rot pathogen Dickeya chrysanthemi and application of detection primer and detection method |
| CN111073995A (en) * | 2020-01-17 | 2020-04-28 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for pathogenic bacteria Phoma exigua of leaf spot disease and application of detection primer and detection method |
| CN111270006A (en) * | 2020-04-08 | 2020-06-12 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for Ustilago esculenta, pathogenic bacteria of Ustilago esculenta and application of detection primer and detection method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101544986A (en) * | 2008-03-28 | 2009-09-30 | 南京大学 | Method for genetically transforming phoma herbarum |
| US20130071356A1 (en) * | 2010-03-11 | 2013-03-21 | Institut National De La Recherche Agronomique | Treatment of Plants Against Oomycete Infection |
| CN105296641A (en) * | 2015-11-16 | 2016-02-03 | 湖北省农科院中药材研究所 | Primer for detecting atractylodes macrocephala root rot pathogen and rapid detection method |
| CN106434997A (en) * | 2016-12-06 | 2017-02-22 | 西南大学 | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) |
-
2018
- 2018-03-29 CN CN201810271863.0A patent/CN108251553B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101544986A (en) * | 2008-03-28 | 2009-09-30 | 南京大学 | Method for genetically transforming phoma herbarum |
| US20130071356A1 (en) * | 2010-03-11 | 2013-03-21 | Institut National De La Recherche Agronomique | Treatment of Plants Against Oomycete Infection |
| CN105296641A (en) * | 2015-11-16 | 2016-02-03 | 湖北省农科院中药材研究所 | Primer for detecting atractylodes macrocephala root rot pathogen and rapid detection method |
| CN106434997A (en) * | 2016-12-06 | 2017-02-22 | 西南大学 | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) |
Non-Patent Citations (2)
| Title |
|---|
| ACCESSION：KY780194.1: "Phoma herbarum strain BZYB-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence", 《GENBANK》 * |
| MADIHA NAYAB，NAUREEN AKHTAR: "New report of Cycas revoluta leaf necrosis by Phoma herbarum from Pakistan", 《JOURNAL OF PLANT DISEASES AND PROTECTION》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110643726A (en) * | 2019-10-16 | 2020-01-03 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for soft rot pathogen Dickeya chrysanthemi and application of detection primer and detection method |
| CN111073995A (en) * | 2020-01-17 | 2020-04-28 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for pathogenic bacteria Phoma exigua of leaf spot disease and application of detection primer and detection method |
| CN111073995B (en) * | 2020-01-17 | 2021-05-14 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for pathogenic bacteria Phoma exigua of leaf spot disease and application of detection primer and detection method |
| CN111270006A (en) * | 2020-04-08 | 2020-06-12 | 湖北省农业科学院中药材研究所 | Detection primer and detection method for Ustilago esculenta, pathogenic bacteria of Ustilago esculenta and application of detection primer and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108251553B (en) | 2021-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108728573B (en) | Fluorescent PCR detection kit for identifying dendrobium officinale and application thereof | |
| CN104131086B (en) | A kind of SSR marker finger printing of needle mushroom F3 bacterial classification and application | |
| CN108251553A (en) | A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria | |
| CN105483282A (en) | PCR specificity identifying primers and paris polyphylla identifying method adopting same | |
| CN106318938B (en) | Produce substance PCR detection primer pair combination, detection method and the purposes of aflatoxin fungi | |
| CN106191294A (en) | A kind of method utilizing DGGE to identify mixing Chinese medicinal powder composition species | |
| CN108823325A (en) | The application of Riemerellosis Anatipestifer Imp gene and its PCR detection kit and method | |
| CN107988328A (en) | A kind of primer and its methods and applications for being used to detect coptis leaf spot pathogenic bacteria | |
| CN101086015B (en) | Mushroom 45 bacteria molecular specific mark and its obtaining method and uses | |
| CN101475991B (en) | Method for identifying black fungus bacterial strain 185 and gene sequence for identifying black fungus bacterial strain 185 | |
| CN101928779A (en) | Real-time fluorescent RCR molecular detection kit for leptosphaeria maculans and detection method thereof | |
| CN105256052A (en) | Reagent kit and detection method used for legionella quick detecting and parting | |
| CN101086017B (en) | Mushroom 507 bacteria molecular specific mark and its obtaining method and uses | |
| CN103571946A (en) | Molecular detection primer specific for phytophthora sojae and application thereof | |
| CN110643726A (en) | Detection primer and detection method for soft rot pathogen Dickeya chrysanthemi and application of detection primer and detection method | |
| CN102321620B (en) | Molecular standard sample for bull's eye rot bacteria on apples and preparation method thereof | |
| CN105506072A (en) | Primers for detecting pseudomonas syringae pv.mori and application thereof | |
| CN105002166A (en) | Molecular standard sample of brown cockroach and preparation method thereof | |
| CN105255876A (en) | Primers and method for legionella quick detecting and parting | |
| Yijia et al. | Species-specific primers for rapid identification of Erysiphe paeoniae, the powdery mildew pathogen in Paeonia lactiflora in Beijing: morphological characteristics, phylogenetic analysis, and host range expansion | |
| CN103966198A (en) | Plant DNA (Deoxyribose Nucleic Acid) rapid extraction method | |
| CN105296641B (en) | A kind of Root Rot of Largehead Atractylodes bacterium detection primer and rapid detection method | |
| CN103060440A (en) | Universal PCR (Polymerase Chain Reaction) detection method for bacteria | |
| CN101514364A (en) | Mark of Ganoderma tsugae strain or fruiting body molecule thereof, and acquisition method and application thereof | |
| CN101086018A (en) | Mushroom 7402 bacteria molecular specific mark method and uses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20180706 Assignee: ENSHI SOURCE TECHNOLOGY DEVELOPMENT Co.,Ltd. Assignor: INSTITUTE OF CHINESE HERBAL MEDICINES, HUBEI ACADEMY OF AGRICULTURAL SCIENCES Contract record no.: X2023420000022 Denomination of invention: A primer for detecting the pathogenic bacteria of Atractylodes macrocephala leaf spot and its method and application Granted publication date: 20210618 License type: Common License Record date: 20230220 |