CN111270006A

CN111270006A - Detection primer and detection method for Ustilago esculenta, pathogenic bacteria of Ustilago esculenta and application of detection primer and detection method

Info

Publication number: CN111270006A
Application number: CN202010269467.1A
Authority: CN
Inventors: 游景茂; 唐涛; 王帆帆; 郭杰; 段媛媛; 郭晓亮
Original assignee: INSTITUTE OF CHINESE HERBAL MEDICINES HUBEI ACADEMY OF AGRICULTURAL SCIENCES
Current assignee: INSTITUTE OF CHINESE HERBAL MEDICINES HUBEI ACADEMY OF AGRICULTURAL SCIENCES
Priority date: 2020-04-08
Filing date: 2020-04-08
Publication date: 2020-06-12

Abstract

The invention belongs to the technical field of biology, and particularly relates to a detection primer, a detection method and application of a smut pathogen, namely, ustilaginoidea alutahensis. The invention designs a specific primer according to the difference of basic group compositions in ITS regions of pathogenic bacteria Thecaphora schwarzmaniana of rhubarb and fungi of the same genus and Hepacillum, and provides a detection primer, a detection method and application of pathogenic bacteria Thecaphora schwarzmaniana of Hepacillum. The method has the characteristics of rapidness, accuracy and sensitivity, and effectively improves the convenience, timeliness and accuracy of detecting the rhubarb smut caused by Thecaphora schwarzmaniana.

Description

Detection primer and detection method for Ustilago esculenta, pathogenic bacteria of Ustilago esculenta and application of detection primer and detection method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a detection primer, a detection method and application of a smut pathogen, namely, ustilaginoidea alutahensis.

Background

The traditional Chinese medicine rhubarb comprises Rheum palmatum L, Rheum palmatum Maxim. ex Balf. and Rheum officinale of Rheum tanguticum Maxim. of Polygonaceae, the medicinal parts of the Rheum palmatum L. are mainly rhizomes, have the effects of eliminating stagnation, clearing away damp heat, purging pathogenic fire, cooling blood, removing blood stasis, detoxifying and the like, are raw material medicines of various Chinese patent medicines, are widely distributed in south China of Shanxi, Gansu, northeast, Hubei, Qinghai, West Sichuan, Yunnan and east of Tibet, and are also distributed in Europe and Japan.

With the development of the traditional Chinese medicine industry, the dosage of the traditional Chinese medicine rhubarb is increased year by year, the planting area is enlarged year by year, but smut caused by (Thecaphora schwarzmaniana) (the DNA sequence of an internal transcription spacer region is shown in a table SEQ ID NO.11) is widely prevalent in main rhubarb producing regions around the world, and the smut mainly comprises harmful leaves, tender buds and leaf stalks. After the leaves are damaged, the veins of the leaf back become locally thick and bulged, the leaves turn reddish at the initial stage and turn reddish brown at the later stage, nodules are formed at the later stage, and after the leaves are broken, the winter spores are scattered out and then holes are formed. The tender shoots are damaged and swollen, green at the initial stage, finally turn into purplish red, cannot grow up to form leaves, and finally break to release the winter spores. After the petiole is damaged, nodules with different sizes are formed, the nodules are green at the initial stage, then turn to mauve, turn to yellow brown after that, and then the lesions are cracked and black powder is scattered. When the affected part is wet, white hypha appears at the cracked part of the lesion. In severe cases, the plants are stagnant in growth, short in whole and mostly withered in advance. The pathogen can be transmitted by the produced spores through seedlings, water, soil and air. Once infected, the rhubarb is completely rotten and died in one month, and the disease can occur from 3 months to 11 months per year, which greatly affects the yield and quality of the rhubarb and also seriously hinders the planting enthusiasm of farmers. The incidence rate of rhubarb in China currently reaches 80 percent, the incidence rate of the rhubarb main producing area in Hubei province reaches 100 percent, and great influence is caused to the rhubarb industry.

At present, systematic research aiming at the bacteria is lacked, and random seedling transportation becomes a main path for spreading the disease. Due to the lack of guidance of Chinese medicinal plant protection professionals, various chemical agents are abused in various large production areas of the rhubarb, so that the disease cannot be effectively prevented and controlled, the drug resistance of pathogenic bacteria is increased, the environmental pollution is aggravated, the development concept of green medicinal materials is not met, and the further development and the growth of the rhubarb industry are seriously threatened. The traditional identification of pathogenic bacteria can be carried out only after the plants are infected by pathogenic bacteria to show symptoms, the identification needs to be carried out by separation, purification culture, Koch's rule verification, morphological observation, physiological and biochemical detection and the like of the pathogenic bacteria, the whole process needs about 20-30 days if the identification is successfully completed, however, once other infectious microbes pollute a culture medium, the identification speed is influenced, longer time is needed, and meanwhile, the long-time identification delays the control time and is not beneficial to the timeliness of control. The traditional identification has the defects of inaccurate identification, time consumption and labor waste, and the requirements of accurate and rapid prevention and control of plant protection work cannot be completely met.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a detection primer and a detection method for the powdery mildew pathogenic bacterium, namely, Alternaria aetans, and application thereof, and aims to solve part of the problems in the prior art or at least alleviate part of the problems in the prior art.

The detection primer of the ustilaginoidea alvarezii, a pathogen of ustilaginoidea alzizani is realized in the invention, and the upstream and downstream sequences of the detection primer are shown as SEQ ID NO.1 and SEQ ID NO. 2; or as shown in SEQ ID NO.3 and SEQ ID NO. 4; or as shown in SEQ ID NO.5 and SEQ ID NO. 6; or as shown in SEQ ID NO.7 and SEQ ID NO. 8.

The detection method of the powdery mildew pathogen, namely the nigrosine rosenbergii, comprises the following steps:

step 1: extracting the genome DNA of a sample to be detected;

step 2: using the extracted genome DNA as a template, and carrying out first round PCR amplification by using a universal primer 27F/1492R;

and step 3: taking the first round PCR amplification product as a template, carrying out second round PCR amplification by using the detection primer in claim 1, and judging whether the sample has smut pathogen, namely, ustilaginoidea alvarezii according to the amplification result.

Further, when the second round of PCR reaction is carried out using the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 of claim 1, if a band of 380bp size appears in the amplification product, the powdery mildew pathogen, Ustilago alzetimescens, is present in the sample; otherwise, it is absent;

when the sequences shown in SEQ ID No.3 and SEQ ID No.4 of claim 1 are used for carrying out the second round of PCR reaction, if a band with the size of 426bp appears in the amplification product, the powdery mildew pathogen, Ustilago alzetidis alzewazevii, is present in the sample; otherwise, it is absent;

when the sequences shown in SEQ ID No.5 and SEQ ID No.6 of claim 1 are used for the second round of PCR reaction, if a band of 425bp size appears in the amplification product, the powdery mildew pathogen, Ustilago alzetimescens, is present in the sample; otherwise, it is absent;

when the second round of PCR reaction is carried out by using the sequences shown in SEQ ID NO.5 and SEQ ID NO.6 in claim 1, if a band with the size of 443bp appears in the amplification product, the powdery mildew pathogen, Ustilago alzetidis alzeylanica, is present in the sample; otherwise, it is not present.

Further, the first round of PCR in step 2 and the second round of PCR amplification system in step 3 are: mu.L of template, 12.5. mu.L of 2 XTAQALMaster Mix, 1. mu.L of each of 10. mu.M upstream and downstream primers, and 9.5. mu.L of double distilled water.

Further, the first round of PCR amplification reaction in step 2 was pre-denatured at 94 ℃ for 3 minutes, 94 ℃ for 30 seconds, 54 ℃ for 30 seconds, 72 ℃ for 1 minute and 30 seconds, 35 cycles, and finally extended at 72 ℃ for 10 minutes and stored at 16 ℃.

Further, the amplification reaction procedure of the second round of PCR in step 3 was pre-denaturation at 94 ℃ for 3 minutes, followed by 94 ℃ for 30 seconds, 54 ℃ for 30 seconds, 72 ℃ for 1 min for 30 seconds, 25 cycles, and finally extension at 72 ℃ for 3 minutes, and storage at 16 ℃.

The application of the primer for detecting the powdery mildew pathogen, namely, the ustilago ovatus in preparing a reagent or a kit for detecting the ustilago pathogenic bacterium, namely, Thecaphora schwarzmaniana.

Application of detection method of powdery mildew pathogenic bacterium, namely, Alternaria schwarzmaniana in preparation of reagent or kit for detecting powdery mildew pathogenic bacterium, namely, Theaphora schwarzmaniana

In summary, the advantages and positive effects of the invention are:

1) the primer and the method have extremely high detection sensitivity, can detect 10 fg/. mu.L of genome DNA of the pathogenic bacterium of the rhubarb smut, namely the Thecaphora schwarzmaniana, improve the sensitivity by 100 times compared with the conventional PCR detection method, and can accurately detect the Thecaphora schwarzmaniana even in the latent period or under the condition of extremely slight infection;

2) the method can respectively amplify single bands of 380bp, 426bp, 425bp and 443bp aiming at the genomic DNA of the ustilago rhabdus, has strong specificity, is slightly interfered by exogenous genomic DNA and has high precision;

3) the method has the characteristics of short time consumption and simple operation, does not need complex detection places and laboratories, completes the whole detection procedure for about 3 hours, and requires at least 20 days for the conventional pathogenic bacteria identification method;

4) the technical scheme of the invention is suitable for rheum officinale introduction quarantine inspection, detoxified seed seedling quality detection, resistance identification of the rheum officinale to smut disease caused by Thecaphora schwarzmaniana and early asymptomatic plant detection.

Drawings

FIG. 1 is a diagram showing the specific detection of specific primers DH1f/1r, DH2f/2r, DH3f/3r and DH4f/4r against Theraparaschwarzmania genomic DNA;

FIG. 2 shows the detection of Theraparaschwarzmania genomic DNA by conventional PCR with specific primers DH1f/1r, DH2f/2r, DH3f/3r, DH4f/4 r;

FIG. 3 shows the detection of genomic DNA of Theraphora schwarzmania by Nested PCR with specific primers DH1f/1r, DH2f/2r, DH3f/3r and DH4f/4 r;

FIG. 4 shows specific primers DH1f/1r, DH2f/2r, DH3f/3r and DH4f/4r for detecting Fairhium officinale smut in field under Nested PCR condition.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.

The invention discloses a detection primer, a detection method and application of a smut pathogen, namely, ustilaginoidea alzetima, and concretely relates to the following embodiments.

Example 1 establishment of specific PCR detection method for pathogenic bacteria of Rheum officinale Kishinouye disease

1. Extraction of pathogenic genome DNA of rhubarb smut

The pathogenic bacterium of the rhubarb smut disease Thecaphora schwarzmaniana is preserved in the plant protection research institute of Chinese medicinal materials institute of agricultural academy of sciences of Hubei province. After one week of culture on the PSA-containing plate, total genomic DNA of pathogenic bacteria was extracted using a bacterial DNA extraction kit.

2. Design of specific molecule detection primer

PCR amplification sequencing is carried out on the obtained total genome DNA of the pathogenic bacterium, and the specific transcription primer sequences of the pathogenic bacterium such as Theraparaschwarzmania, Therapara thystra, Therapara amaranthhi, Pseudomonas floccculus, Therapara solani, Theraparasofilaffini, Therapara frezii, Therapara lepteum, Therapara flavanthus, Therapara oxidis, Therapara medlandii, Therapara pulata, Theraparasalsianum, Usplasia macroides, Usplancholia, Usplasia specific primer sequences, Usplancholia primer, etc. 4, are designed according to the following sequence:

the upstream primer DH1f:5 'ATCATAGAATGTAAACAAAAAATCC 3' is shown in SEQ ID NO. 1;

downstream primer DH1 r: 5 'GCAGAAGTCAGTGAATCATCGAATC 3' as shown in SEQ ID NO. 2.

The upstream primer DH2f:5 'TTTAAAGAAAAGTGAGACGACCATA 3' is shown in SEQ ID NO. 3;

downstream primer DH2 r: 5 'TACGTTCACTCGTTCATAGAGGCCG 3' as shown in SEQ ID NO. 4.

The upstream primer DH3f:5 'ACGCTGACAGTCCGCCAAACTACTT 3' is shown in SEQ ID NO. 5;

downstream primer DH3 r: 5 'GCGATCCACAAACCAAACACACCTG 3' as shown in SEQ ID NO. 6.

The upstream primer DH4f:5 'TCAAACGCAAAGTATATCATAGAAT 3' is shown in SEQ ID NO. 7;

downstream primer DH4 r: 5 'CCGACCGTCCACTTTATAATTTCCA 3' as shown in SEQ ID NO. 8.

3. Establishment of rapid molecular detection method for pathogenic bacteria of rhubarb smut

1) Extracting the genome DNA of pathogenic bacteria of the rhubarb smut disease Thecaphora schwarzmaniana by using a bacterial DNA extraction kit, and then storing at-20 ℃;

2) and performing first round PCR amplification by using the extracted pathogenic bacteria DNA as a template and using a universal primer.

The sequence of the universal primer 27F/1492R is as follows:

ITS1：5’-TCCGTAGGTGAACCTGCGG-3’；SEQ ID NO.9；

ITS4：5’-TCCTCCGCTTATTGATATGC-3’。SEQ ID NO.10。

the total volume of the reaction system is 25 mu L, and the reaction components are as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers 27F/1492R each 1. mu.L, DNA 1. mu.L, double distilled water 9.5. mu.L.

The amplification reaction procedure was: pre-denaturation at 94 ℃ for 3 min, 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min and 30 sec, 35 cycles, final extension at 72 ℃ for 10 min, storage at 16 ℃.

3) The first round amplification product was diluted 10-fold, and 1. mu.L was used as a template for the second round amplification.

The total volume of the reaction system is 25 muL, the first round amplification product is diluted by 10 times, 1 muL is taken as a template, and the reaction components are as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M of upstream and downstream primers 1. mu.L each (4 pairs of specific primers designed in step 2 were used for amplification, respectively, and the amplification effect of different primer pairs was examined), and 9.5. mu.L of double distilled water.

The amplification reaction procedure was: pre-denaturation at 94 ℃ for 3 min, followed by 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min 30 sec, 25 cycles, final extension at 72 ℃ for 3 min, storage at 16 ℃.

4) Electrophoretic detection of amplification products

Taking 7 μ L of amplification product, adding 100 μ L (volume ratio) of Goldview I type nucleic acid staining agent into 1% (mass/volume) agarose gel and 100ml agarose gel, performing electrophoresis at 120V for 20 minutes, photographing and detecting under a gel imaging system, and determining that Theraphora schwarzmaniana exists in the detected sample if DNA specific bands of 380bp, 426bp, 425bp or 443bp fragments exist.

Example 2 specific detection of genomic DNA against Thecaphora schwarzmaniana

Extracting genomic DNA from Theraphora schwarzmaniana, Theraphooxothiopicis, Theaphora thspeos, Theaphora amaranthi, Pseudozyma florculosa, Theaphora solani, Theaphora semimini-convoluli, Theaphora henneii, Theaphora thyspes, Theaphora affinis, Theaphora frezii, Theaphora leptideum, Theaphora filinthis, Theraphora oxyalidis, Theraphora melandii, Theaphora pustulata, Theaphora alsianneuum, Theaphogo yga, Ussus candidus, Fusarium, Rhizoctonia, Botrytis cinerea, Usula and the like by using a bacterial DNA extraction kit, setting the negative template as clear water, and performing PCR using 1. mu. of the above as a control DNA.

The reaction system is as follows: 2 XTaq Master Mix 12.5. mu.L, 10. mu.M upstream and downstream primers of one of the 4 pairs of specific primers designed in step 2 of example 1, 1. mu.L each, and 9.5. mu.L of double distilled water. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min 30 sec, 30 cycles, and final extension at 72 ℃ for 3 min.

mu.L of the amplification product was collected, and 1% (mass/volume) agarose gel was used, 100mL agarose gel was added with 100. mu.L (mass/volume ratio) of Goldview I nucleic acid staining reagent, and the mixture was electrophoresed at 120V for 20 minutes and photographed under a gel imaging system for detection.

The results are shown in FIG. 1, lane 1 is DL2000 Marker; lane 2 is a clear water blank control, a negative control; lane 3 is Thecaphora schwarzmaniana genomic DNA, positive control; lanes 4-25 are genomic DNAs from Theraphooxotips, Theaphora thrausthios, Theaphora amaranthi, Pseudozyma floceucosa, Theaphora solani, Theaphora semimini-convoluli, Theaphora hennenni, Theaphora thras, Theaphora affins, Theaphora frezii, Theaphoraltide, Theaphora filinthis, Theaphora oxyalidiii, Theaphora pustulata, Theaphora alsinearum, Utiligo maydis, P.albus, Fusarium, Rhizoctonia, Phoma culorum, etc., respectively.

The results show that the primers DH1f/1r, DH2f/2r, DH3f/3r and DH4f/4r of the present invention can amplify single bands of 380bp, 426bp, 425bp and 443bp respectively against genomic DNA of Ustilago virens, and can not detect precision DNA of Theraphora oxytropis, Theraphora thysipeos, Theraphora amaranthi, pseudozymezacaulosa, Theraphora solani, Theraphora sesaminis-covoluuli, Theraphoraneni, Theraphora thysipeos, Theraphora affinis, Theraphora fizii, Therapholide, Theraphora diaphoridium, Theraphora silanthis, Theraphora oxyaalidis, CAaphora medinaliii, Theraphora diaphora, Theraphoria, Fusarium oxysporum, or the like, and high-specific DNA of Bacillus subtilis.

Example 3 detection of Thecaphora schwarzmaniana genomic DNA by conventional PCR

Thecaphora schwarzmaniana genomic DNA was sequentially diluted to 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, 1 fg/. mu.L for 9 concentration gradients, and then subjected to PCR.

The total volume of the PCR reaction system is 25 mu L, and the reaction system is as follows: 2 × Taq Master Mix 12.5 μ L, 10 μ M upstream and downstream primers BXTF/BXTR (4 pairs of specific primers designed in example 1) 1 μ L each, double distilled water 9.5 μ L. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min 30 sec, 25 cycles, and final extension at 72 ℃ for 3 min.

The results are shown in FIG. 2, where lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-11 are the genomic DNA of Thecaphora schwarzmaniana at 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, 1 fg/. mu.L, 100 ag/. mu.L, 10 ag/. mu.L, respectively.

The results show that when the conventional PCR technology is used for detection, the primers DH1f/1r, DH2f/2r, DH3f/3r and DH4f/4r of the invention can detect the genomic DNA of the Thecaphora schwarzmaniana at 100 pg/mu L, and the detection limit is lower than 10 pg/mu L, so that the detection cannot be well carried out.

Example 4 Nested PCR detection of Thecaphora schwarzmaniana genomic DNA

The genomic DNA of Thecaphora schwarzmaniana is sequentially diluted into 12 concentration gradients of 100 ng/mu L, 10 ng/mu L, 1 ng/mu L, 100 pg/mu L, 10 pg/mu L, 1 pg/mu L, 100 fg/mu L, 10 fg/mu L, 1 fg/mu L, 100 ag/mu L, 10 ag/mu L and 1 ag/mu L, and then a first round of PCR is carried out by using primers ITS1/ITS4, wherein the amplification reaction program is as follows: pre-denaturation at 94 ℃ for 3 minutes, at 94 ℃ for 30 seconds, at 54 ℃ for 30 seconds, at 72 ℃ for 1 min and 30 seconds, for 35 cycles, finally, extension at 72 ℃ for 10 minutes, preservation at 16 ℃, taking 1 μ L of the PCR product diluted by 10 times as a template and primers BXTF/BXTR, and carrying out second round PCR by using a reaction system as follows: 2 × TaqMaster Mix 12.5 μ L, 10 μ M upstream and downstream primers BXTF/BXTR each 1 μ L, double distilled water 9.5 μ L. The amplification reaction procedure was: pre-denaturation at 94 ℃ for 5 min, followed by 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min 30 sec, 25 cycles, and final extension at 72 ℃ for 3 min.

The results are shown in FIG. 3, where lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-12 are the genomic DNA of Thecaphora schwarzmaniana at 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 100 pg/. mu.L, 10 pg/. mu.L, 1 pg/. mu.L, 100 fg/. mu.L, 10 fg/. mu.L, 1 fg/. mu.L, and 100 ag/. mu.L, respectively.

The result shows that the detection sensitivity of the invention is extremely high, 10 fg/. mu.L of the genomic DNA of the Thecaphora schwarzmaniana can be detected, the sensitivity is improved by 100 times compared with the conventional PCR detection method, and the Thecaphora schwarzmaniana can be accurately detected even in the latent period or under the condition of extremely slight infection.

Example 5 detection of pathogenic bacteria of Rheum officinale Kishinouye disease in field by specific primers

3 rheum officinale plants with obvious smut symptom, 3 aseptic tissue culture seedlings and 3 rheum officinale plant samples with smut disease by artificial inoculation are randomly collected on a rheum officinale planting base in the third fork of rural area of Enshi city, Hubei province in 2019. Sterile water was also set as a control. Then, the samples were numbered in the order of 2 to 11, and the DNA of the samples was extracted. Nested PCR assay was performed according to the procedure in example 4.

The results are shown in FIG. 4, where lane 1 is DL2000 Marker; lane 2 is clear water blank control; lanes 3-12 are respectively, DNA positive control of smut, aseptic tissue culture seedling of rhubarb 1, rhubarb plant 1 with smut disease by artificial inoculation, rhubarb plant 1 with obvious smut disease symptom in field, aseptic tissue culture seedling of rhubarb 2, rhubarb plant 2 with obvious smut disease by artificial inoculation, rhubarb plant 2 with obvious smut disease symptom in field, aseptic tissue culture seedling of rhubarb 3, rhubarb plant 3 with obvious smut disease symptom in artificial inoculation, and rhubarb plant 3 with obvious smut disease symptom in field

The results show that the specific strips are detected by artificially inoculating 6 parts of rheum officinale plants with the black powdery mildew disease and 6 parts of rheum officinale plants with obvious black powdery mildew symptoms in the field, and no 3 samples of the aseptic tissue culture seedlings of the rheum officinale are detected, which proves that the method is feasible in practical application.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> institute of Chinese medicinal materials of academy of agricultural sciences of Hubei province

<120> detection primer and detection method for powdery mildew pathogen, namely, Alternaria aetans and application of detection primer and detection method

<160>11

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213> Artificial sequence (DH1f)

<400>1

atcatagaat gtaaacaaaa aatcc 25

<210>2

<211>25

<212>DNA

<213> Artificial sequence (DH1r)

<400>2

gcagaagtca gtgaatcatc gaatc 25

<210>3

<211>25

<212>DNA

<213> Artificial sequence (DH2f)

<400>3

tttaaagaaa agtgagacga ccata 25

<210>4

<211>25

<212>DNA

<213> Artificial sequence (DH2r)

<400>4

tacgttcact cgttcataga ggccg 25

<210>5

<211>25

<212>DNA

<213> Artificial sequence (DH3f)

<400>5

acgctgacag tccgccaaac tactt 25

<210>6

<211>25

<212>DNA

<213> Artificial sequence (DH3r)

<400>6

gcgatccaca aaccaaacac acctg 25

<210>7

<211>25

<212>DNA

<213> Artificial sequence (DH4f)

<400>7

tcaaacgcaa agtatatcat agaat 25

<210>8

<211>25

<212>DNA

<213> Artificial sequence (DH4r)

<400>8

ccgaccgtcc actttataat ttcca 25

<210>9

<211>19

<212>DNA

<213> Artificial sequence (ITS1)

<400>9

tccgtaggtg aacctgcgg 19

<210>10

<211>20

<212>DNA

<213> Artificial sequence (ITS4)

<400>10

tcctccgctt attgatatgc 20

<210>11

<211>668

<212>DNA

<213> Artificial sequence (Thecaphora schwarzmaniana)

<400>11

gggaaaggtt gtaacttagc ggtctctaag atacgttcac tcgttcatag aggccgcgat 60

ccacaaacca aacacacctg tgcacacata aatatctttc aaacgcaaag tatatcatag 120

aatgtaaaca aaaaatcctt cgaaggaagg tgaaagttaa atacaacttt cggcaacgga 180

tctctaggtt ctcctatcga tgaagaacgc agcgaattgc gataagtaat tgtgaattgc 240

agaagtcagt gaatcatcga atctttgaac gcatcttgcg ccctttggta ctccttaggg 300

catgcctgtt tgagtgtcac gagcaacctt taaacctcgg gttttttcat taaagcctgc 360

ttgggtttag tcttgagtgt ctgcccttta aaacgggctc gctctaaata cattagctgg 420

aattcccttc catatggtcg tctcactttt ctttaaagta gtttggcgga ctgtcagcgt 480

gataagtatc ttgctggtgg cctgccttac aaaatttgga aattataaag tggacggtcg 540

gattgcgatt tcgcttctaa ccaaggaagc cggtcctttc gaggatcgcg tctttgcact 600

atttgacatc tggcctcaga caggtaggac tacccgctga acttaagcat atcaataagc 660

cggaggaa 668

Claims

1. The detection primer of the powdery mildew pathogenic bacterium, namely, Alaska smut bacterium is characterized by comprising the following steps: the upstream and downstream sequences of the detection primer are shown as SEQ ID NO.1 and SEQ ID NO. 2; or as shown in SEQ ID NO.3 and SEQ ID NO. 4; or as shown in SEQ ID NO.5 and SEQ ID NO. 6; or as shown in SEQ ID NO.7 and SEQ ID NO. 8.

2. The detection method of the powdery mildew pathogenic bacterium, namely, Alternaria avayi, is characterized by comprising the following steps:

step 1: extracting the genome DNA of a sample to be detected;

3. The method for detecting the powdery mildew pathogen nigrospora ovata as claimed in claim 2, characterized in that: when the sequences shown in SEQ ID No.1 and SEQ ID No.2 of claim 1 are used for carrying out a second round of PCR reaction, if a 380bp band appears in an amplification product, the powdery mildew pathogen, Ustilago alzetimescens, is present in the sample; otherwise, it is absent;

4. The method for detecting the powdery mildew pathogen nigrostrea aemoreus, as claimed in claim 3, wherein: the first round of PCR in the step 2 and the second round of PCR amplification system in the step 3 are as follows: mu.L of template, 12.5. mu.L of 2 XTaq Master Mix, 1. mu.L of each of 10. mu.M upstream and downstream primers, and 9.5. mu.L of double distilled water.

5. The method for detecting the powdery mildew pathogen nigrostrea aemoreus, as claimed in claim 4, wherein: the first round of PCR amplification reaction in step 2 is performed by pre-denaturation at 94 ℃ for 3 minutes, at 94 ℃ for 30 seconds, at 54 ℃ for 30 seconds, at 72 ℃ for 1 minute and 30 seconds, for 35 cycles, and finally extension at 72 ℃ for 10 minutes and preservation at 16 ℃.

6. The method for detecting the powdery mildew pathogen nigrostrea aemoreus, as claimed in claim 5, wherein: the second round of PCR amplification in step 3 was performed by pre-denaturation at 94 ℃ for 3 min, followed by 94 ℃ for 30 sec, 54 ℃ for 30 sec, 72 ℃ for 1 min and 30 sec, 25 cycles, final extension at 72 ℃ for 3 min, and storage at 16 ℃.

7. Use of a detection primer of the smut pathogen smut schwarzmaniana as claimed in claim 1 for the preparation of a reagent or a kit for the detection of the smut pathogen chickpora schwarzmaniana.

8. Use of the method for the detection of the smut pathogen, ustilaginoidea schwarzmaniana, as defined in any of claims 2 to 6, for the preparation of a reagent or kit for the detection of the smut pathogen, Thecaphora schwarzmaniana.