CN102424851A - Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor - Google Patents
Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor Download PDFInfo
- Publication number
- CN102424851A CN102424851A CN2011104431008A CN201110443100A CN102424851A CN 102424851 A CN102424851 A CN 102424851A CN 2011104431008 A CN2011104431008 A CN 2011104431008A CN 201110443100 A CN201110443100 A CN 201110443100A CN 102424851 A CN102424851 A CN 102424851A
- Authority
- CN
- China
- Prior art keywords
- primer
- cdear
- mould
- epidemic disease
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor, and establishes a set of quick, high-sensitivity, stable and reliable molecular detection technology for detecting the Edrus deodara (Roxb) Lobd blight. The method has the advantages of accuracy, quickness, simplicity in operation and the like, can identify pathogens in an early stage of contagious disease, can be referentially applied to inspection and quarantine and field investigation of imported and exported plants and plant products, and has an important significance for controlling the Edrus deodara (Roxb) Lobd blight to spread in China. Meanwhile, the establishment of the system provides technical guidance and theoretical basis for detecting other pathogenic bacteria.
Description
Technical field
The present invention relates to a kind ofly be used to detect the mould primer of cdear epidemic disease, and utilize said primer to detect the mould molecular detecting method of cdear epidemic disease.
Background technology
Cdear phytophthora root rot bacterium (
Phytophthora lateralisTucker et Mibrath) causes that the cdear butt rot is sick.This disease nineteen twenty discovery first in the Washington, DC Seattle.This germ is distributed widely in all over the world (Smith I M. at present
Phytophthora lateralis [J]. EPPO Bulletin, 2009.
39(1): 43-47.).This disease in 2010 China's Taiwan Province's reported first (Brasier C M, Vettraino A M, Chang T T,
Et al.
Phytophthora lateralisDiscovered in an old growth Chamaecyparis forest in Taiwan [J]. Plant Pathology, 2010,
59(4): 595-603), the area, continent is not found as yet, is one type of dangerous Plant Quarantine venereal disease evil.Cdear phytophthora root rot bacterium not only endangers cdear, can also infect Chamaecyparis lawsoniana, yewtree, U.S. point leaf Japan cypress, Kiwifruit, Japan cypress, needle juniper, arbor-vitae, rhododendron (James W, Claire S. Pest Risk Analysis For
Phytophthora lateralis[Z] .2006.).
This disease screening difficulty divides defection to produce a lot of assorted bacterium by ordinary method, influences the accurate separation of pathogenic bacteria.Simultaneously, the mould morphological specificity of epidemic disease is complicated, and variation is fast, and
P. lateralisWith other pathogenic bacteria as
P. cinnamomi,
P. gonapodyidesBe difficult to separate (Torgeson D C, Young R A, Milbrath J A.
PhytophthoraRoot rot diseases of Lawson cypress and other ornamentals [M]. Agricultural Experiment Station, Oregon State College, 1954).Therefore, conventional disease screening technology is difficult to quick and precisely identify this pathogenic bacteria.Along with the development of Protocols in Molecular Biology, the mould Molecular Detection of a lot of epidemic diseases many researchs have been carried out both at home and abroad.Prove that at present because the highly variation and in planting, stablizing between fungi (oomycetes) is planted of tRNA sequence, so this sequence is that the Molecular Detection of pathogenic bacteria provides the ideal target sequence.
Summary of the invention
Technical problem to be solved by this invention provides a kind of cdear epidemic disease mould molecular detecting method and primer thereof, and it is mould to utilize this primer and detection method to detect the cdear epidemic disease, and speed is fast, accurate, highly sensitive, reliable and stable.
Technical scheme provided by the invention is: a kind ofly be used to detect the mould primer of cdear epidemic disease, its upstream primer sequence such as SEQ ID No.1 are said, and downstream primer sequence such as SEQ ID No.2 are said.
A kind of mould test kit of cdear epidemic disease that detects, this test kit comprises above-mentioned primer.
A kind of mould method of above-mentioned primer detection cdear epidemic disease of utilizing; Its process is: the DNA that extracts testing sample is as template; Utilize described primer to carry out the PCR reaction; Get PCR reaction amplified production and detect,, prove that then to contain the cdear epidemic disease in institute's sample article mould if exist molecular weight to be about the DNA band of 192bp.
The above-mentioned mould method of detection cdear epidemic disease; Further; The amplification system of said PCR reaction is: 10.0 μ L SYBR Premix Ex TaqTM (2 *), 0.4 μ L ROX Reference Dye II (50 *), each 0.4 μ L of primer (10 μ mol/L); Template 2 μ L supply volume to 20 μ L with aqua sterilisa.
The mould method of described detection cdear epidemic disease, the response procedures of said PCR reaction is: 94 ° of preparatory sex change 30 s of C; 94 ° of C sex change 5 s, 46 ° of C 34 s that anneal, 40 circulations; 95 ° of C 15 s, 60 ° of C 1 min, 95 ° of C 15 s, 60 ° of C 15 s.
Further; Detect the mould sensitivity of cdear epidemic disease for improving, the present invention also provides another kind to be used to detect the mould primer of cdear epidemic disease, comprises two pairs of primers; That is: first pair of its upstream primer nucleotide sequence of primer such as SEQ ID No.1 are said; Downstream primer nucleotide sequence such as SEQ ID No.2 are said, and second pair of its upstream primer nucleotide sequence of primer such as SEQ ID No.3 are said, and downstream primer nucleotide sequence such as SEQ ID No.4 are said.
The present invention also provides the another kind of mould test kit of cdear epidemic disease that detects, its comprise above-mentioned first pair of primer and with second pair of primer.
The present invention also provides the another kind of mould method of cdear epidemic disease that detects; Its process is: the DNA that extracts testing sample utilizes described two pairs of primers to carry out the sleeve type PCR reaction as template, and the template of first round PCR reaction is for extracting the DNA of testing sample; Primer is described second pair of primer; Second take turns PCR reaction template be first round PCR reaction product, primer is described first pair of primer, gets second and takes turns PCR reaction amplified production and carry out gel electrophoresis; If exist molecular weight to be about the DNA band of 192bp, prove that then to contain the cdear epidemic disease in institute's sample article mould.
The present invention has following beneficial effect:
This paper can detect in the plant tissue in conjunction with the method for pcr amplification through design a pair of Auele Specific Primer T1/T2 (nucleotide sequence such as SEQ ID No.1/SEQ ID No.2) effectively
P. lateralisAdvantages such as it is accurate, quick, simple to operation that the inventive method has; Can identify pathogen at the disease initial stage of infecting; Can be with reference to the inspection and quarantine and the field investigation of be applied to enter and leave the border plant and plant prod; The mould China of importing into is significant to control cdear epidemic disease, and simultaneously, the foundation of system of the present invention also provides technical director and theoretical foundation for the detection of other pathogenic bacteria.
The present invention is to obtaining from GenBank
P. lateralisAnalyze with the tRNA sequence of the mould kind of other epidemic disease, designed a pair of Auele Specific Primer T1/T2 (nucleotide sequence such as SEQ ID No.1/SEQ ID No.2), utilize this primer to other 15 kinds of epidemic diseases mould with other fungi carry out specific amplification, discovery can only from
P. lateralisMiddle amplification obtains the band of one 192 bp, and other bacterial strain does not all have amplified band and occurs, and shows that this has the specificity of planting to primer.RDNA-ITS sequences Design Auele Specific Primer with fungi carries out the diagnosis of disease and the Molecular Detection of plant pathogenic fungi, is used widely, and once has the scholar to utilize the difference of rDNA-ITS sequence to design
P. lateralisAuele Specific Primer (Winton L M, Hansen E M. Molecular diagnosis of
Phytophthora lateralisIn trees, water, and foliage baits using multiplex polymerase chain reaction [J]. Forest Pathology, 2001,
31(5): 275-283), still
P. lateralisWith
P. ramorumITS sequence height similar, can't both be distinguished (Martin F N, Tooley P W. Phylogenetic relationships of
Phytophthora ramorum,
P. nemorosa,And
P. pseudosyringae, three species recovered from areas in California with sudden oak death [J]. and Mycological Research, 2003,
107(12): 1379-1391).The present invention uses this then can be easier to the two is made a distinction to primer.
Highly sensitive is the important indicator that pathogenic bacteria detects, and can it be related to and directly be applied in the PCR Fast Detection Technique in the inspection and quarantine of entry and exit plant and plant prod.In 25 μ L reaction systems, the common PCR method can detect 10 pg
P. lateralisGenomic dna.Once reported sleeve type PCR can detection sensitivity improve 10 ~ 1 000 times (Zhang Z G, Li Y Q, Fan H,
Et al.Molecular detection of
Phytophthora capsiciIn infected plant tissues, soil and water [J]. Plant Pathology, 2006,
55(6): 770-775; Ippolito A, Schena L, Nigro F. Detection of
Phytophthora nicotianaeAnd
P. citrophthoraIn citrus roots and soils by nested PCR [J]. European Journal of Plant Pathology, 2002.
108(9): 855-868), and in the system that the present invention sets up, adopt the sleeve type PCR technology to detect
P. lateralis1 fg has been brought up in the sensitivity of genomic dna, and efficient has improved 10,000 times, and this amount for the target pathogen is very low or extremely important when having the PCR inhibition.And in the mould Molecular Detection of other epidemic disease, sensitivity can only be arrived 1 pg's
P. capsiciGenomic dna, 10 pg's
P. nicotianaWith
P. citrophthoraGenomic dna and 2. 5 pg's
P. nicotianaeGenomic dna, this shows that primer of the present invention has very high sensitivity.
Zoospore can and infect the host through the irrigation water propagation, is another important object of Molecular Detection therefore.In the system that the present invention sets up, detect
P. lateralisSensitivity reached 0.5 zoospore.The highly sensitive of this system shows, this method can be used for the falling ill Molecular Detection of plant pathogen can reach the purpose and the requirement of inspection and quarantine.When disease plant is detected, use special primer T1/T2 to carry out pcr amplification in conjunction with simple DNA process for extracting, just can judge on 1 working days plant whether by
P. lateralisInfect.Use the NaOH cracking process can obtain within 30 min that the DNA of pathogenic bacteria is used for pcr amplification in the diseased tissues, needed for 2 weeks at least and use traditional method to detect.
The accurate quantification of pathogenic bacteria is very important opportunity to formulating control strategy and control in the pathophyte, and the present invention has set up for this reason
P. lateralisThe real-time quantitative PCR detection architecture, this is to the real-time monitoring of cdear phytophthora root rot and formulate control strategy important directive significance is arranged.PCR system after the optimization and program have avoided because the non-specific amplification that factors such as non-specific amplification and primer dimer cause has improved the accuracy that detects.
Description of drawings
Fig. 1 based on the cdear epidemic disease mould (
Phytophthora lateralis) a pair of Auele Specific Primer T1/T2 of tRNA sequences Design
The specificity checking of Fig. 2 primer T1/T2, M:2000 bp marker; Swimming lane 1-43: all bacterial strains in the table 1 (in proper order: from top to bottom); Swimming lane 44: negative control.
The conventional PCR of Fig. 3 A to the cdear epidemic disease mould (
P. lateralis) sensitivity detect M:2000 bp marker; Swimming lane 1-11: template concentrations is respectively 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, 100 ag, the pcr amplification product of 10 ag and 1 ag genomic dna; Swimming lane 12: positive control.
Fig. 3 B sleeve type PCR to the cdear epidemic disease mould (
P. lateralis) sensitivity detect M:2000 bp marker; Swimming lane 1-11: template concentrations is respectively 100 ng, 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, 1 fg, the pcr amplification product of 100 ag and 10 ag genomic dnas; Swimming lane 12: negative control.
Fig. 4 cdear epidemic disease mould (
P. lateralis) in the inoculation plant sensitivity of zoospore DNA detect.M:2000 bp marker; Swimming lane 1-11: template is respectively 0.5,1,10 zoospore genomic dnas of 2,3,4,5,6,7,8,9 and; Swimming lane 12: negative control.
In Fig. 5 disease plant the cdear epidemic disease mould (
P. lateralis) PCR detect M:2000 bp marker; Swimming lane 1-6: slightly carry the pcr amplification product that DNA is a template with disease plant; Swimming lane 7: healthy plant contrast; Swimming lane 8: positive control.
Fig. 6 quantitative fluorescence analysis typical curve.
Embodiment
Come further to illustrate the present invention through the detailed description of embodiment below, but be not limitation of the present invention, only make example description.
Embodiment 1: design, synthetic primer are also set up the PCR reaction system of the mould inspection testing cassete of cdear epidemic disease
One, design of primers and synthetic
Specificity draws the design of T1/T2: among the GeneBank
P. lateralisTRNA sequence with other epidemic disease in mould compares analysis (Fig. 1), has designed a pair of Auele Specific Primer T1/T2, and sequence is following:
T1：5’-?GCTTTATATATTTATTAGAT?-3’?（SEQ?ID?NO.1）
And T2:5 '-CTCCTTTTTTGATATTAT-3 ' (SEQ ID NO.2).Designed primer is its specificity of BLAST analysis verification in GeneBank again.
Also design a pair of sleeve type PCR outer primer T3/T4 simultaneously, according to
P. lateralisThe tRNA sequence, make this primer in the Auele Specific Primer outside, design a pair of outer primer T3/T4, sequence is following:
T3：5’-?GTTCGAATCCCTTTTTTTGC?-3’?（SEQ?ID?NO.3）
T4：5’-?CAACAAATTTACAGTCTGCCGC?-3’?（SEQ?ID?NO.4）。
All primers entrust Shanghai handsome (Invitrogen) biotech firm synthetic.
Two, set up conventional PCR reaction system
Conventional pcr amplification system is: 10 * PCR buffer, 2.5 μ L, MgCl
22 mmol/L, 2.5 mmol/L dNTP, 0.5 μ L, primer (20 μ mol/L) 0 .25 μ L, Taq DNA enzyme (5U/ μ L) 0.25 μ L, template 0.25 μ L, amplification system is 25 μ L, supplies volume with aqua sterilisa.On TaKaRa pcr amplification appearance, carry out amplified reaction, response procedures is: 94 ° of preparatory sex change 5 min of C; 94 ° of C sex change 30 s, 46 ° of C 30 s that anneal, 72 ° of C extend 30 s, totally 35 circulations; 72 ° of C extend 10 min.Get 5 μ L amplified productions electrophoresis (voltage 5 V/cm) in 1.0% sepharose, on gel imaging system, detect and take pictures,, prove that then to contain the cdear epidemic disease in institute's sample article mould if exist molecular weight to be about the DNA band of 192 bp.
Three, set up the sleeve type PCR reaction system
For improving detection sensitivity, further set up the sleeve type PCR reaction system.With T3/T4 is first round reaction primer, the above-mentioned conventional PCR system of reaction system.Annealing temperature is 60 ° of C in the response procedures, and other parameters are with above-mentioned conventional PCR response procedures.Being Auele Specific Primer then with T1/T2, is that template is carried out second and taken turns PCR amplification with first round PCR product (1 μ L).System is the same, and annealing temperature is 46 ° of C, other parameter constant.All reagent are all purchased the company in TaKaRa.Get 5 μ L amplified productions electrophoresis (voltage 5 V/cm) in 1.0% sepharose, on gel imaging system, detect and take pictures,, prove that then to contain the cdear epidemic disease in institute's sample article mould if exist molecular weight to be about the DNA band of 192 bp.
Four, quantitative fluorescent PCR reaction
The present invention has further set up the real-time quantitative PCR detection architecture.The fluorescent quantitative PCR system is: 10.0 μ L SYBR Premix Ex Taq
TM(2 *), 0.4 μ L ROX Reference Dye II (50 *), each 0.4 μ L of primer (10 μ mol/L), template 2 μ L, amplification system is 20 μ L, supplies volume with aqua sterilisa.Response procedures after the optimization is: 94 ° of preparatory sex change 30 s of C; 94 ° of C sex change 5 s, 46 ° of C 34 s that anneal, 40 circulations; 95 ° of C 15 s, 60 ° of C 1 min, 95 ° of C 15 s, 60 ° of C 15 s.The quantitative fluorescent PCR instrument is 7500 Real-Time PCR System.
Embodiment 2: the preparation dna profiling
Extract the template of the DNA of all kinds of samples as the PCR reaction, detailed process is following:
1. mycelial cultivation, collection and DNA extraction
(1) preparation of substratum
10% V8 substratum: 100 mL V8 juice, CaCO
30.2 g adds water and is settled to 1 L.
PDA substratum (Potato Dextrose Agar): agar powder 20 g, potato 200 g, glucose 20 g add water and are settled to 1 L.
(2) mycelium is cultivated and is collected
To supply to cut 10 2 mm * 2 mm bacterium colony pieces from colony edge behind 20 ° of C dark culturing 3 d on the mould V8 of the going to solid medium of the examination epidemic disease flat board, go to the V8 liquid nutrient medium; 25 ° of C shaking culture 5-7 days; Filter and collect mycelia, preserve subsequent use through the freezing 20 ° of C of ， – that pulverize that drain.
(2) extraction of mycelia DNA
The hypha powder that takes a morsel adds 900 μ L, 2% CTAB extracting solution and 90 μ L, 10% SDS, the whirlpool mixing, in 55 ° of C water-bath 1 h, during per 10 min turn upside down several times.Centrifugal 10 min of 12,000 g get and reset and add equal-volume phenol/chloroform/primary isoamyl alcohol (25:24:1), put upside down mixing, and centrifugal 10 min of 12,000 g move to new pipe with supernatant, add the equal-volume chloroform, put upside down mixing gently, centrifugal 5 min of 12,000 g.Supernatant is transferred in the new pipe, adds the absolute ethyl alcohol of 2 times of volumes and the 3 mol/L NaAc (pH 5.2) of 1/10 volume ,-20 ° of C deposition (> 1 h).Centrifugal 10 min of 12,000 g, the supernatant that inclines, deposition is with 70% washing with alcohol twice, and room temperature is dried.Add an amount of sterilization ultrapure water or TE (pH8.0) dissolution precipitation (containing 20 μ g/mL RNase), after 37 ° of C handled 1h ,-20 ° of C preserved subsequent use.
2. the extraction of zoospore liquid DNA
With reference to Zheng's wavelet method (Zheng X B.
PhytophthoraAnd methods in
Phytophthora(in chinese) [M] .Beijing:China Agriculture Press (Scientia Agricultura Sinica), 1997.) induce
P. lateralisDischarge zoospore.The thick extracting method of zoospore DNA: in 60 μ L sterilized waters, add 60 zoospores (microscopically direct census); Add 0.05 g silica sand; Thermal agitation 3 min on vortice; Centrifugal slightly, supernatant is zoospore DNA crude extract, gets 0.5-10 μ L supernatant respectively and directly carries out pcr amplification as template.
3. the extraction of morbidity plant tissue DNA
To supply to cut 32 mm * 2 mm bacterium colony pieces from colony edge behind 20 ° of C dark culturing 3 d on the mould V8 of the going to solid plate of examination epidemic disease, wound is inoculated on the Chamaecyparis lawsoniana.The cultivation of preserving moisture of 20 ° of C dark cuts incidence tissue and extracts genomic dna after for some time.Concrete operations: the plant tissue of getting one section morbidity; Every milligram of tissue adds 10 μ L, 0.5 mol/L NaOH; Be transferred in the eppendorf pipe of 1.5 mL centrifugal 5 min of 12,000 g after in mortar, fully grinding; Get 5 μ L supernatants and add 495 μ L, 0.1 mmol/L Tris (pH 8.0), get 1 μ L behind the mixing and directly be used for the PCR reaction.
Carry out the mould detection of cdear epidemic disease with the template of the foregoing description 1 detection primer and method and embodiment 2 preparations below.
Embodiment 3: detect the specificity and the sensitivity of primer
One, specific detection
Bacterial strain uses therefor of the present invention and relevant information are seen table 1.All strains tested genomic dnas carry out pcr amplification in the employing Auele Specific Primer T1/T2 his-and-hers watches 1 that the present invention designed, and only can try from 2 confessions
P. lateralisAmplify the band of one 192 bp in the bacterial strain specifically, and other strains tested and blank all do not have amplified band (table 1, Fig. 2).Show the specificity that this primer has kind, can with
P. lateralisDistinguish with other allied species and other relevant kind.
Be used to screen the bacterial strain of primer specificity in table 1 present embodiment
In the last table :+expression has the specific amplification band of primer T1/T2, and length is 192 bp; The no amplified production of-expression.
Two, sensitivity detects
In the reaction system of 25 μ L, measured the sensitivity of the above-mentioned detection architecture of setting up, primer T1/T2 can stably increase from the genomic templates of at least 10 pg and obtain the specific band (Fig. 3 A) of 192 bp.And it is right with primer T3/T4
P. lateralisThe product that the genomic dna of bacterial strain different concns carries out pcr amplification is a template, re-uses Auele Specific Primer T1/T2 and carries out second and take turns sleeve type PCR amplification, can stably detect the genomic dna of 1 fg, makes detection sensitivity improve 10,000 times (Fig. 3 B).
At the genomic dna crude extract that with the zoospore is material is in the PCR reaction system of template, and the detection sensitivity of T1/T2 can reach 0.5 zoospore (Fig. 4).
Embodiment 4: the pathogen in the phytopathy tissue detects
Clip incidence tissue from the plant of artificial inoculation extracts DNA and carries out the PCR amplification, and the morbidity sample has all amplified the specific band (Fig. 5) of 192 bp, and healthy plant this band that can not increase.Explain that this cover technology can be used for the mould rapid molecular of phytopathy tissue cdear epidemic disease and detect.
Embodiment 5: the genomic dna real-time quantitative PCRAnd typical curve is set up
The present invention has set up
P. lateralisThe real-time quantitative PCR detection architecture, T1/T2 is right with primer
P. lateralis10 times of gradient dilution liquid of genomic dna carry out SYBR Green I pcr amplification.The result shows, is limited to 100 fg/ μ L genomic dnas under the detection of this system.
P. lateralisThe SYBR Green I PCR typical curve of genomic dna shows: linear between the Ct value (y) of the logarithm (x) of DNA amount (pg) and correspondence: Y=– 4.05x+43.36, R
2=0.97 (Fig. 6).PCR system after the optimization and program have avoided because the non-specific amplification that factors such as non-specific amplification and primer dimer cause has improved the accuracy that detects.
< 110>P. R. of China Kunshan Entry-exit Inspection and Quarantine Bureau
< 120>mould molecular detecting method and the primer thereof of cdear epidemic disease
<160>?4
<210>?1
<211>?20
<212>?DNA
< 213>artificial sequence
<220>
< 223>description of artificial sequence: the sequence of synthetic
<400>?1
GCTTTATATA?TTTATTAGAT 20
<210>?2
<211>?18
<212>?DNA
< 213>artificial sequence
<220>
< 223>description of artificial sequence: the sequence of synthetic
<400>?2
CTCCTTTTTT?GATATTAT 18
<210>?3
<211>?20
<212>?DNA
< 213>artificial sequence
<220>
< 223>description of artificial sequence: the sequence of synthetic
<400>?3
GTTCGAATCC?CTTTTTTTGC 20
<210>?4
<211>?22
<212>?DNA
< 213>artificial sequence
<220>
< 223>description of artificial sequence: the sequence of synthetic
<400>?4
CAACAAATTT?ACAGTCTGCC?GC 22
Claims (8)
1. one kind is used to detect the mould primer of cdear epidemic disease, it is characterized in that: its upstream primer sequence such as SEQ ID No.1 are said, and downstream primer sequence such as SEQ ID No.2 are said.
2. one kind is detected the mould test kit of cdear epidemic disease, it is characterized in that: this test kit comprises the described primer of claim 1.
3. molecular detecting method that the cdear epidemic disease is mould; It is characterized in that: the DNA that extracts testing sample is as template; Utilize the described primer of claim 1 to carry out the PCR reaction; Get PCR reaction amplified production and detect,, prove that then to contain the cdear epidemic disease in institute's sample article mould if exist molecular weight to be about the DNA band of 192 bp.
4. molecular detecting method according to claim 3; It is characterized in that: the amplification system of said PCR reaction is: 10.0 μ L SYBR Premix Ex TaqTM (2 *); 0.4 μ L ROX Reference Dye II (50 *); Each 0.4 μ L of primer (10 μ mol/L), template 2 μ L supply volume to 20 μ L with aqua sterilisa.
5. molecular detecting method according to claim 4 is characterized in that: the response procedures of said PCR reaction is: 94 ° of preparatory sex change 30 s of C; 94 ° of C sex change 5 s, 46 ° of C 34 s that anneal, 40 circulations; 95 ° of C 15 s, 60 ° of C 1 min, 95 ° of C 15 s, 60 ° of C 15 s.
6. one kind is used to detect the mould primer of cdear epidemic disease; It is characterized in that: comprise two pairs of primers; First pair of its upstream primer nucleotide sequence of primer such as SEQ ID No.1 are said; Downstream primer nucleotide sequence such as SEQ ID No.2 are said, and second pair of its upstream primer nucleotide sequence of primer such as SEQ ID No.3 are said, and downstream primer nucleotide sequence such as SEQ ID No.4 are said.
7. one kind is detected the mould test kit of cdear epidemic disease, it is characterized in that: this test kit comprises the described primer of claim 6.
8. one kind is utilized the described primer of claim 6 to detect the mould method of cdear epidemic disease; It is characterized in that: the DNA that extracts testing sample utilizes the described primer of claim 6 to carry out the sleeve type PCR reaction as template, and the template of first round PCR reaction is for extracting the DNA of testing sample; Primer is described second pair of primer; Second take turns PCR reaction template be first round PCR reaction product, primer is described first pair of primer, gets second and takes turns PCR reaction amplified production and carry out gel electrophoresis; If exist molecular weight to be about the DNA band of 192 bp, prove that then to contain the cdear epidemic disease in institute's sample article mould.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110443100 CN102424851B (en) | 2011-12-27 | 2011-12-27 | Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110443100 CN102424851B (en) | 2011-12-27 | 2011-12-27 | Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102424851A true CN102424851A (en) | 2012-04-25 |
| CN102424851B CN102424851B (en) | 2013-05-08 |
Family
ID=45958879
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110443100 Expired - Fee Related CN102424851B (en) | 2011-12-27 | 2011-12-27 | Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102424851B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636371A (en) * | 2016-11-30 | 2017-05-10 | 中华人民共和国昆山出入境检验检疫局 | Color determination-based loop-mediated isothermal amplification (LAMP) technology for detecting phytophthora sojae of cedar |
| CN109988864A (en) * | 2019-05-15 | 2019-07-09 | 南京林业大学 | RPA-LFD technology detects the primer and probe combination and its application of deodar phytophthora |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880476A (en) * | 2006-04-29 | 2006-12-20 | 中华人民共和国昆山出入境检验检疫局 | Molecular detection method for Fusarium circinatum |
| CN101519697A (en) * | 2009-04-07 | 2009-09-02 | 福建省农业科学院植物保护研究所 | Phytophthora sojae molecule detecting primer and detection reagent kit thereof |
-
2011
- 2011-12-27 CN CN 201110443100 patent/CN102424851B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880476A (en) * | 2006-04-29 | 2006-12-20 | 中华人民共和国昆山出入境检验检疫局 | Molecular detection method for Fusarium circinatum |
| CN101519697A (en) * | 2009-04-07 | 2009-09-02 | 福建省农业科学院植物保护研究所 | Phytophthora sojae molecule detecting primer and detection reagent kit thereof |
Non-Patent Citations (2)
| Title |
|---|
| 《Journal of Microbiological Methods》 20060417 Leonardo Schena 等 Assessing the potential of regions of the nuclear and mitochondrial genome to develop a "molecular tool box" for the detection and characterization of Phytophthora species 第70-85页 1-8 第67卷, * |
| LEONARDO SCHENA 等: "Assessing the potential of regions of the nuclear and mitochondrial genome to develop a "molecular tool box" for the detection and characterization of Phytophthora species", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636371A (en) * | 2016-11-30 | 2017-05-10 | 中华人民共和国昆山出入境检验检疫局 | Color determination-based loop-mediated isothermal amplification (LAMP) technology for detecting phytophthora sojae of cedar |
| CN106636371B (en) * | 2016-11-30 | 2020-06-19 | 中华人民共和国昆山出入境检验检疫局 | Color determination-based loop-mediated isothermal amplification (LAMP) technology for detecting phytophthora root rot of cedar |
| CN109988864A (en) * | 2019-05-15 | 2019-07-09 | 南京林业大学 | RPA-LFD technology detects the primer and probe combination and its application of deodar phytophthora |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102424851B (en) | 2013-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| CN108707687B (en) | PCR detection and identification method capable of distinguishing blast bacteria and rice blast bacteria | |
| CN103333969B (en) | Method and kit for quickly detecting verticillium dahliae through PCR (polymerase chain reaction) | |
| CN102154476B (en) | Loop-mediated isothermal amplification (LAMP) detection method for specificity of radopholus similis and application thereof | |
| CN103243166B (en) | A kind of rapid molecular detection method of Plasmopara viticola and application | |
| CN102534010A (en) | Primers for molecular detection of nontoxic genes of Magnaporthe grisea and application thereof | |
| CN101974651B (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian | |
| Yousef et al. | Lipid profiling of the soybean pathogen Phytophthora sojae using Fatty Acid Methyl Esters (FAMEs) | |
| CN104962639A (en) | LAMP primer group and detection method for rapidly detecting corynespora cassiicola | |
| CN102433387B (en) | Molecular detection method and primers for detecting fusarium oxysporum | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN102424851B (en) | Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor | |
| CN101086015B (en) | Mushroom 45 bacteria molecular specific mark and its obtaining method and uses | |
| Wang et al. | Development of a real-time TaqMan PCR method for absolute quantification of the biocontrol agent Esteya vermicola | |
| CN104293957B (en) | A kind of early stage rapid molecular detection method of Botrytis cinerea | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| Munawar et al. | Development and evaluation of a recombinase polymerase amplification assay for rapid detection of strawberry red stele pathogen | |
| CN104328205A (en) | Establishment of rapid detection method for grain sclerospora graminicola by LAMP | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| CN113789405A (en) | Method for detecting content of gibberella zeae in soil based on real-time fluorescent quantitative PCR | |
| CN104745677A (en) | AFLP finger-print chromatogram construction of metalaxyl resistance by phytophthora sojae | |
| Grundy et al. | A molecular approach to explore the extent of the threatened fungus Hypocreopsis rhododendri within wood | |
| CN102888470B (en) | RT-PCR primer of mushroom dsRNA virus and detection method | |
| CN105420372A (en) | PCR primer for detecting alternaria kikuchiana and detection method using same | |
| CN102634585B (en) | Primer for detecting pytophthora capsici developed on basis of plygalacturonase Pcipg8 gene and method therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130508 Termination date: 20131227 |