CN106434997A - Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) - Google Patents
Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) Download PDFInfo
- Publication number
- CN106434997A CN106434997A CN201611109179.XA CN201611109179A CN106434997A CN 106434997 A CN106434997 A CN 106434997A CN 201611109179 A CN201611109179 A CN 201611109179A CN 106434997 A CN106434997 A CN 106434997A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- mulberry
- sequence
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Abstract
The invention relates to an early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction), comprising the steps of (1) using tissue sample DNA extracted via CTAB (cetyl trimethyl ammonium bromide) process as a template, and carrying first PCR amplification by using the primer ITS1/ITS4; (2) using a first product as a template to carry out second PCR amplification, and using a Ciboria shiraiana specific primer as a nested primer, having a sequence shown as in SEQ ID No. 1 and SEQ ID No. 2; (3) diagnosing Ciboria shiraiana pathogenic bacteria according to amplified bands of step (2). The method of the invention has excellent accuracy and specificity and has greatly improved detection sensitivity.
Description
Technical field
The invention belongs to field of plant disease control, be related to a kind of detection method and in particular to a kind of based on nest-type PRC
Fructus Mori hypertrophy sclerotiniose pathogen early stage method for quick.
Background technology
Bao Kuo China, the East Asia including India, the Central Asia and South Asia region, mulberry as a kind of important for breeding silkworms
Economic plants are extensively planted, and people mainly utilize its Folium Mori to feed silkworm, and most including Turkey and Greece
Number European countries, people plantation mulberry is primarily used to produce Fructus Mori.Fructus Mori as the potential source of functional food, because having
Numerous biological activitys and pharmacological action and receive much concern.Research show its have good antioxidation, antiinflammatory, protection nerve,
Numerous activity such as anticancer, blood sugar lowering and blood fat reducing.Transition with sericulture there and people numerous health cares, pharmacologically active to Fructus Mori
Understanding, domestic gradually emerging a large amount of fruit Mulberry and seedless mulberry field.Development fruit Mulberry is not only the emerging product that soil increases income
Industry, is also silkworm and mulberry transition and a big approach of upgrading.Fruit Mulberry cultivated area increases considerably year by year, only the fruit leaf of Chongqing City
Dual-purpose Mulberry cultivated area adds up to reach hundreds thousand of mus.But it easily infects fatal sclerotiniose and (is commonly called as Cortex Mori fruit disease, is loose type bacterium
Core disease, constrictive sclerotinios, the general designation of little graininess sclerotiniose), sickness rate up to more than 90% when serious, ruin product total crop failure, such as anti-
Control not in time, year after year repeated infection, make mulberry planter suffer serious financial consequences.This disease becomes the bottle hindering fruit Mulberry industrialized development
Neck.
Diseases of mulberry fruits is the most fatal disease that fruit Mulberry industry is faced at present, and it is in China In Middle And Lower Reaches of Changjiang River and Korea Spro
State's report is more, and its sclerotium can be survived the several years in soil, and Fructus Mori is infected in circulation, and when morbidity is serious, even No kernels or seeds are gathered, as in a year of scarcity.
The detection of diseases of mulberry fruits and diagnosis use traditional method at present, carry out experience according to Fructus Mori disease symptom
Property judges roughly, or collecting sample carries out isolating and purifying of pathogen, is then made a definite diagnosis according to Koch's Postulates.The method
Have the disadvantages that：
1st, could find to catch an illness after need to waiting until to show related symptoms.But it is now " cancer of late stage ", almost without can rescue
Medicine, even if spray preventing and treating, also sheerly " mends the fold after the sheep is lost ", takes effect little.Because this disease is fallen ill from Pathogen Infection to sorosis in a large number,
Course is very short, and patient's condition is violent, once display symptom, in mulberry field, most of disease fruit, to the infection later stage, is that bacterium bag is inedible entirely,
Suffer heavy losses.
2nd, time-consuming, empirical strong.Make a definite diagnosis, need to isolate and purify out pathogen, then carry out morphological observation, routine
The means such as Molecular Identification, reversal connection infection are made a definite diagnosis, and take and are up to tens of skies, or even all longer than the sorosis phase.
Therefore, develop new fast and accurate diseases of mulberry fruits detection of pathogens side on the basis of forefathers' research
Method has important practical significance, and it can not only carry out early prediction forecast, has the more fully time to take prophylactico-therapeutic measuress, simultaneously
Can also be quarantined in new mulberry field and introduction seedling etc..
Content of the invention
In view of this, it is an object of the invention to provide a kind of hypertrophy sclerotiniose pathogen of Fructus Mori based on nest-type PRC
Early stage method for quick.
For reaching above-mentioned purpose, the present invention provides following technical scheme：
Fructus Mori based on nest-type PRC hypertrophy sclerotiniose pathogen early stage method for quick, comprises the following steps：
(1) using the tissue sample DNA of CTAB method extraction as template, the first round is carried out using universal primer ITS1/ITS4
PCR expands；
(2) the second wheel PCR amplification is carried out for template with first round product, nested primer adopts the specificity of Mulberry reality cup cup fungi
Primer, sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2；
(3) diagnose the hypertrophy sclerotiniose of Fructus Mori respectively according to three amplified bands of step (2).
Preferably, the sample in step (1) is Fructus Mori.
Preferably, in step (1), the condition of first round PCR amplification is as follows：95 DEG C of denaturations 3min；94 DEG C of degeneration 30s,
55 DEG C of annealing 50s, 72 DEG C of extension 50s, 32 circulations, 72 DEG C of extension 10min, 4 DEG C, ∞.
Preferably, in step (1), the sequence such as SEQ ID NO.3 of universal primer ITS1/ITS4 and SEQ ID NO.4 institute
Show.
Preferably, in step (2), the second wheel amplification condition is similar to the first round, and annealing temperature is arranged to 56,58,60,62
Or the different gradients such as 64 DEG C, primer optimal condition is found with this.
It is further preferred that the annealing temperature of the second wheel amplification is 56,58,60 or 62 DEG C.
A pair of Mulberry reality cup cup fungi primer, sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
The screening technique of above-mentioned a pair of Mulberry reality cup cup fungi primer, be with caruncula shape cup cup fungi, core ground cane bacterium, sclerotinite and
Mulberry Phoma sp is comparison, and the corresponding pathogenic bacteria ITS sequence in NCBI carries out Multiple Sequence Alignment, ESPript with ClustalX 2
3.0 carry out variation analyses, and Primer 5.0 carries out the design of primer and assessment and obtains.
The beneficial effects of the present invention is：
In the gene of fungal gene group encoding ribosomal, transcriptional units are formed by 18S, 5.8S and 28S rDNA, its
In spacer be internal transcribed spacer region (Internal Transcribed Spacer, ITS).ITS region include ITS1 and
Two regions of ITS2, wherein ITS1 is located between 18S and 5.8S, and ITS2 is located between 5.8S and 28S.Because ITS1 and ITS2 enters
Change relatively rapid, there is conservative in certain inter-species specificity and kind, have become as funguses (especially filamentous fungis) classification
The research emphasis of identification.Present invention employs nest-type PRC, its have quickly, high specific the features such as, using ITS as the first round
Amplimer, specificity nested primer carries out diseases of mulberry fruits cause of disease quick detection as the second wheel amplimer, and method is feasible,
And there is wider annealing temperature, and early prediction forecast can be carried out, have the more fully time to take prophylactico-therapeutic measuress, simultaneously can also be right
Quarantine in new mulberry field and introduction seedling etc..Empirical tests, the detection method of the present invention has splendid accuracy and specificity, and
Substantially increase detection sensitivity.
Brief description
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below to carry out
Explanation：
Fig. 1 is various pathogenic bacteria ITS sequence comparison result (the designed primer location of band)；
Fig. 2 a and Fig. 2 b is the nest-type PRC result of different annealing temperature, and 6 swimming lanes therein are respectively M-marker, 1-
56 DEG C, 2-58 DEG C, 3-60 DEG C, 4-62 DEG C, 5-64 DEG C；Fig. 2 a is the result of sample1, and Fig. 2 b is the result of sample2；
Fig. 3 a and Fig. 3 b is the application result of method for quick.
Specific embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.
Material and reagent
Material：Adopt in the disease in It In Beibei, Chongqing West seed station mulberry field and Can Ye scientific and technical research institute of Chongqing City mulberry field
Sorosis, is shown in Table 1.
Table 1. two parts of materials used
Reagent：Main agents are as shown in table 2.
Table 2. main agents
The configuration of related reagent：
The configuration of 1M Tris-HCl：Accurate weighing 121.1g Tris is placed in 1L beaker.Add the deionization of about 800mL
Water, is sufficiently stirred for dissolving.About 42mL concentrated hydrochloric acid is added to adjust pH to 8.0.By solution constant volume to 1L.After autoclave sterilization, room
Temperature preserves.
The configuration of 0.5M EDTA (pH 8.0)：90.05g bis- water disodiumedetate is added in 400mL water
(EDTANa2 2H2O), stirring and dissolving, adjust pH to 8.0 (about 10g NaOH granule) with NaOH, be settled to 500mL, high pressure goes out
Bacterium.
4×CTAB：CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20mL (PH8.0), 0.5M EDTA 8mL.First
Use 70mL ddH2O dissolves, and is settled to 100mL autoclaving.Using front plus 1mL beta -mercaptoethanol.
Instrument and equipment：
Used by test, key instrument equipment is as shown in table 3
Table 3. key instrument equipment
Embodiment 1：
The design of nested primer：
From NCBI (National Center for Biotechnology Information, US National biotechnology
Information centre, http://www.ncbi.nlm.nih.gov/nuccore/) the upper big property of traditional fertilizer (Mulberry reality cup cup fungi), little downloaded
Graininess (caruncula shape cup cup fungi), contractility (core ground cane bacterium)) diseases of mulberry fruits pathogen ITS sequence (sclerotinite and Mulberry Phoma sp
For comparison), Multiple Sequence Alignment is carried out with ClustalX 2, ESPript 3.0 carries out variation analyses, Primer 5.0 carries out primer
Design and assessment, obtain the specific primer of Fructus Mori hypertrophy sclerotiniose pathogen, its comparison result is as shown in Figure 1.
Downloaded correlated serieses are as shown in table 4.
The ITS sequence accession number of table 4. diseases of mulberry fruits pathogen
Primer sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
The foundation of diseases of mulberry fruits method for quick：
Using nest-type PRC as the method for quick detection diseases of mulberry fruits pathogen, with CTAB method (Liu Li, Zhang Yongjun, perhaps long
Levy, Luo Feng, a kind of CTAB method of improvement is extracted and produced polysaccharide fungal DNA, Chinese biological engineering magazine, 2014,34 (5)：75-79)
The tissue sample DNA extracting, as template, carries out the amplification of first round PCR, primer sequence (this using universal primer ITS1/ITS4
Primer sequence listed by literary composition is all defaulted as 5 ' 3 ' directions) be：(TCCGTAGGTGAACCTGCGG, as SEQ ID NO.3 institute for ITS1
Show) and ITS4 (TCCTCCGCTTATTGATATGC, as shown in SEQ ID NO.4) (purchased from Hua Da gene), with first round product
Carry out the second wheel PCR amplification for template, nested primer adopts aforesaid corresponding specific primer, and amplification system is all using 25 μ L bodies
System, concrete consumption is as shown in table 5.
The concrete consumption of table 5.PCR amplification system
First round PCR amplification condition is as shown in table 6.
6. first round of table PCR Amplification
Second wheel amplification condition is similar to the first round, and annealing temperature is arranged to the different gradients such as 56,58,60,62 or 64 DEG C,
Every kind of primer optimal condition is found with this.
Embodiment 2：
The checking of method for quick
The theory testing of primer specificity：
The primer of design in embodiment 1 is brought in common mulberry fungal disease ITS sequence and compares, to its specificity
Carry out preliminary test.
The practice test of primer specificity：
With two parts of materials (referring to table 1), the method set up in embodiment 1 is tested, the material in table 1 is expanded
Increase.
Purpose product after nested PCR amplification is linked to pMD 19-T carrier after the recovery of glue reclaim test kit, even
Junctor system is as shown in table 7.
Table 7. linked system
After fully mixing, 16 DEG C of connection 4h.
Connection product transformed competence colibacillus escherichia coli are enterprising after Amp (ampicillin, ampicillin) resistant panel
Row screening, after choosing speckle amplification, carries out the detection of bacterium solution PCR, and positive colony bacterium solution is delivered to Hua Da gene sequencing.
The Preliminary Applications of method for quick：
Spring in 2016 does not show disease in the collection of It In Beibei, Chongqing different regions mulberry field diseases of mulberry fruits field occurred frequently
And immature Fructus Mori, it is allocated as 14 parts altogether, concrete condition is shown in Table 8, detected using said method.
The immaturity Fructus Mori that table 8. is gathered
Embodiment 3：
The experimental result of embodiment 2 and analysis：
Different sclerotiniose pathogen ITS sequence comparison results：
Find after being compared using ClustalX 2, same pathogen different strains ITS sequence indifference, therefore final choosing
Mulberry reality cup cup fungi, caruncula shape cup cup fungi, core ground cane bacterium, sclerotinite and five groups of Mulberry Phoma sp is taken to compare, its result is such as
Shown in Fig. 1, the primer being combined using Primer 5.0 designed by Fig. 1 is as shown in table 9.
The nested primer sequence going out designed by table 9.
The foundation of sclerotiniose method for quick：
Carry out grads PCR mensure, primer SW-FD3F/2R (Mulberry reality cup using the bi-material in the primer pair table 1 in table 9
Cup fungi) expected clip size be 254bp, measurement result as shown in Figure 2 a and 2 b, from Fig. 2 a and Fig. 2 b it can be seen that temperature
Degree is little on primer impact on three, in addition to when 64 DEG C, expanding effect is not so good, 56～62 DEG C.But in Fig. 2 a and Fig. 2 b
There is a faint miscellaneous band, it may be mulberry ITS sequence near faintly visible 700bp；500bp about have a faint miscellaneous band, may
Template used (first round amplified production) excessive concentration causes.And amplified production concentration is slightly higher, there are some conditions of streakings.
In general, the method has certain feasibility, and has wider annealing temperature.
The result of Fructus Mori hypertrophy sclerotiniose method for quick is shown in Table 10.
The theoretical validation of table 10. primer specificity
As shown in table 10, as can be seen from Table 10, designed primer can only be specific for the theoretical validation of specific primer
Detect in pathogen, other mulberry fungal disease no same clip, there is certain specificity in theory.
Shown by sequencing, amplified production fits like a glove (as shown in SEQ ID NO.5) with expected fragment, shows the method
There is accuracy and specificity.
SW-FD3F/SW-FD2R 254bp
CCAACACTATTCTTTGTCGTCGGAGCACTATAACATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATG
AAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGTAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCT
TGGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATATCGCCATCAAGGGGCGGAGCCTGGGAACGGGCTCCGGCCG
ACTTGGTCTTGAGCCGTGTCAGC, as shown in SEQ ID NO.5.
The application result of method for quick：
Do not show symptom using the method for quick that the present invention sets up to 14 parts and immaturity Fructus Mori detects, result
As shown in Figure 3 a and Figure 3 b shows, after first round ITS1/ITS4 primer amplification, this 4 parts of samples of only a1-a4 have amplified pathogenic fungi
ITS sequence (size 500bp about), also amplify band in the range of a 500～1000bp in 8 parts of samples such as c1, c2,
It may be mulberry ITS sequence.Although the ITS1/ITS4 primer of the first round only amplifies 4 parts in 14 parts of samples, the second wheel
After nested primer amplification, most sample standard deviations can amplify respective strap, shows that the method can greatly improve the sensitive of detection
Degree, can detect the more lower bound degree that conventional single PCR can not detect, respective segments after recovery cloning and sequencing with expect fragment
Fit like a glove, also the explanation main mulberry field in Beibei district infection diseases of mulberry fruits situation is more serious simultaneously.
Result display in figure effect non-specifically good (a1～a4 in Fig. 3 b and b2, b4 etc.), expands knot in conjunction with its first round
B3～b5 in fruit can be seen that, wherein still has ITS primer to continue in the second wheel amplification, therefore respective strap can be brighter, unnecessary one is wide
Band may lead to the pairing between the second wheel primer for ITS primer.Its non-specific amplification may be from ITS primer and institute
The primer amplification fragment of design.Because remaining band has certain gap with purpose band size, even if exist operating cause to do
Disturb, have no effect on the detection to pathogen.
Finally illustrate, preferred embodiment above only in order to technical scheme to be described and unrestricted, although logical
Cross above preferred embodiment the present invention to be described in detail, it is to be understood by those skilled in the art that can be
In form and various changes are made to it, without departing from claims of the present invention limited range in details.
SEQUENCE LISTING
<110>Southwest University
<120>Fructus Mori based on nest-type PRC hypertrophy sclerotiniose pathogen early stage method for quick
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>Mulberry reality cup cup fungi SW-FD3F
<400> 1
ccaacactat tctttgtcgt cgga 24
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence
<220>
<223>Mulberry reality cup cup fungi SW-FD2R
<400> 2
gctgacacgg ctcaagacca a 21
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223> ITS1
<400> 3
tccgtaggtg aacctgcgg 19
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223> ITS4
<400> 4
tcctccgctt attgatatgc 20
<210> 5
<211> 254
<212> DNA
<213>Artificial sequence
<220>
<223> SW-FD3F/ SW-FD2R
<400> 5
ccaacactat tctttgtcgt cggagcacta taacattaaa actttcaaca acggatctct 60
tggttctggc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa ttgcagtagt 120
gaatcatcga atctttgaac gcacattgcg cccttgggta ttccgaaggg catgcctgtt 180
cgagcgtcat atcgccatca aggggcggag cctgggaacg ggctccggcc gacttggtct 240
tgagccgtgt cagc 254
Claims (6)
1. the hypertrophy sclerotiniose of the Fructus Mori based on nest-type PRC pathogen early stage method for quick is it is characterised in that include following
Step：
(1) using the tissue sample DNA of CTAB method extraction as template, the expansion of first round PCR is carried out using universal primer ITS1/ITS4
Increase；
(2) the second wheel PCR amplification is carried out for template with first round product, nested primer is drawn using the specificity of Mulberry reality cup cup fungi
Thing, sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2；
(3) amplified band according to step (2) diagnoses the hypertrophy sclerotiniose of Fructus Mori.
2. detection method according to claim 1 is it is characterised in that in step (1), the condition of first round PCR amplification is such as
Under：95 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 55 DEG C of annealing 50s, 72 DEG C of extension 50s, 32 circulations, 72 DEG C of extension 10min,
4 DEG C, ∞.
3. detection method according to claim 1 is it is characterised in that in step (1), the sequence of universal primer ITS1/ITS4
Row are as shown in SEQ ID NO.3 and SEQ ID NO.4.
4. detection method according to claim 1 is it is characterised in that in step (2), the second wheel amplification condition is similar to first
Wheel, annealing temperature is arranged to 56,58,60,62 or 64 DEG C of different gradients, finds primer optimal condition with this.
5. a pair of Mulberry reality cup cup fungi primer is it is characterised in that sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
6. the screening technique of a pair of Mulberry reality cup cup fungi primer described in claim 5 is it is characterised in that be with caruncula shape cup disk
Bacterium, core ground cane bacterium, sclerotinite and Mulberry Phoma sp are comparison, by the traditional Fructus Mori hypertrophy sclerotiniose pathogen ITS sequence in NCBI
Row, carry out Multiple Sequence Alignment with ClustalX 2, ESPript 3.0 carries out variation analyses, Primer 5.0 carries out setting of primer
Count and assess and obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611109179.XA CN106434997A (en) | 2016-12-06 | 2016-12-06 | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611109179.XA CN106434997A (en) | 2016-12-06 | 2016-12-06 | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434997A true CN106434997A (en) | 2017-02-22 |
Family
ID=58222816
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611109179.XA Pending CN106434997A (en) | 2016-12-06 | 2016-12-06 | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434997A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251553A (en) * | 2018-03-29 | 2018-07-06 | 湖北省农业科学院中药材研究所 | A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria |
| CN109402215A (en) * | 2018-09-28 | 2019-03-01 | 西北农林科技大学 | A kind of identification and pathogenic detection method being isolated from the new cause of disease of mulberry fruit albefaction disease fruit |
-
2016
- 2016-12-06 CN CN201611109179.XA patent/CN106434997A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| SULTANA RAZIA，KIM KANGMIN: "Bacillus thuringiensis C25 suppresses popcorn disease caused by Ciboria shiraiana in mulberry (Morus australis L.)", 《BIOCONTROL SCIENCE AND TECHNOLOGY》 * |
| 胡君欢等: "宁波桑果基地菌核病菌的多样性与ITS 初步分析", 《宁波大学学报（ 理工版）》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108251553A (en) * | 2018-03-29 | 2018-07-06 | 湖北省农业科学院中药材研究所 | A kind of primer and its methods and applications for being used to detect Rhizoma Atractylodis Macrocephalae leaf spot pathogenic bacteria |
| CN108251553B (en) * | 2018-03-29 | 2021-06-18 | 湖北省农业科学院中药材研究所 | Primer for detecting pathogenic bacteria of leaf spot of bighead atractylodes rhizome, method and application thereof |
| CN109402215A (en) * | 2018-09-28 | 2019-03-01 | 西北农林科技大学 | A kind of identification and pathogenic detection method being isolated from the new cause of disease of mulberry fruit albefaction disease fruit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sayler et al. | Genetic characterization and real-time PCR detection of Burkholderia glumae, a newly emerging bacterial pathogen of rice in the United States | |
| Maropola et al. | Impact of metagenomic DNA extraction procedures on the identifiable endophytic bacterial diversity in Sorghum bicolor (L. Moench) | |
| Bonde et al. | Evaluation of virulence of Phakopsora pachyrhizi and P. meibomiae isolates | |
| Sasaki et al. | Genetic and pathogenic variability of Fusarium oxysporum f. sp. cepae isolated from onion and Welsh onion in Japan | |
| Fan et al. | Cytospora species associated with canker disease of three anti-desertification plants in northwestern China | |
| Adikini et al. | Development of a specific molecular tool for detecting Xanthomonas campestris pv. musacearum | |
| Engelbrecht et al. | Development of a nested quantitative real-time PCR for detecting Phytophthora cinnamomi in Persea americana rootstocks | |
| Azevedo et al. | Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences | |
| Vandemark et al. | Assessment of genetic relationships among isolates of Macrophomina phaseolina using a simplified AFLP technique and two different methods of analysis | |
| CN103498000A (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| CN108588249A (en) | A kind of primer pair and its detection method for detecting sweet potato Pathogen | |
| CN106399511A (en) | Method and primer for detecting soil watermelon fusarium oxysporum through fluorescent quantitative real-time PCR | |
| CN106434997A (en) | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) | |
| CN101805794A (en) | Real-time fluorescent PCR detection method of L.maculans as well as primer and probe used for detection | |
| Tirado-Ramirez et al. | Identification and virulence of Fusarium falciforme and Fusarium brachygibbosum as causal agents of basal rot on onion in Mexico | |
| Donnarumma et al. | Biogeography of Sinorhizobium meliloti nodulating alfalfa in different Croatian regions | |
| Li et al. | Incidence of sugarcane ratoon stunting disease in the major cane-growing regions of China | |
| Mourou et al. | Brassicaceae Fungi and Chromista Diseases: Molecular Detection and Host–Plant Interaction | |
| Zamanmirabadi et al. | Genetic structure and phylogenetic relationships of Leptosphaeria maculans and L. biglobosa in Northern regions of Iran | |
| CN104726595B (en) | The multiple PCR detection kit and its primer special and multi-PCR detection method of three kinds of bacillary seed-borne diseases | |
| CN106755361A (en) | The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC | |
| CN106434999A (en) | Method for rapidly detecting constrictive sclerotinia pathogenic bacteria of mulberry at early stage on basis of nested PCR (polymerase chain reaction) | |
| Mamba-Mbayi et al. | Characterization of Congolese Strains of Xanthomonas axonopodis pv. manihotis associated with Cassava Bacterial Blight | |
| Ibrahim et al. | Difficulties in identifying Xanthomonas citri subsp. citri A pathotypes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |