CN106755361A - The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC - Google Patents
The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC Download PDFInfo
- Publication number
- CN106755361A CN106755361A CN201611110070.8A CN201611110070A CN106755361A CN 106755361 A CN106755361 A CN 106755361A CN 201611110070 A CN201611110070 A CN 201611110070A CN 106755361 A CN106755361 A CN 106755361A
- Authority
- CN
- China
- Prior art keywords
- primer
- mulberry
- seq
- sclerotiniose
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC, comprise the following steps：(1) the tissue sample DNA using the extraction of CTAB methods carries out the amplification of first round PCR as template using universal primer ITS1/ITS4；(2) the second wheel PCR amplifications are carried out by template of first round product, nested primer uses the specific primer of caruncula shape cup cup fungi, and sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2；(3) the amplified band diagnosis small graininess sclerotiniose of mulberry fruit according to step (2).Detection method of the invention has splendid accuracy and specificity, and substantially increases detection sensitivity.
Description
Technical field
The invention belongs to field of plant disease control, it is related to a kind of detection method, and in particular to a kind of based on nest-type PRC
The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit.
Background technology
Including China, the East Asia including India, the Central Asia and South Asia region, mulberry tree is used as a kind of important for breeding silkworms
Economic plants is planted extensively, and people mainly feed silkworm using its mulberry leaf, and most including including Turkey and Greece
Number European countries, people plantation mulberry tree is primarily used to produce mulberry fruit.Mulberry fruit as functional food potential source, because having
Numerous bioactivity and pharmacological action and receive much concern.Research show its have good anti-oxidant, anti-inflammatory, protection nerve,
Numerous activity such as anticancer, hypoglycemic and reducing blood lipid.As the transition and people of sericulture there are to the numerous health cares of mulberry fruit, pharmacological activity
Understanding, domestic gradually emerging a large amount of fruit mulberries and seedless mulberry field.Development fruit mulberry is not only the emerging product that soil is increased income
Industry, is also a big approach of silkworm and mulberry transition and upgrading.Fruit mulberry cultivated area is increased considerably year by year, only the fruit leaf of Chongqing City
Dual-purpose mulberry cultivated area is accumulative to reach hundreds thousand of mus.But it easily infects fatal sclerotiniose and (is commonly called as Sang Bai fruit diseases, is loose type bacterium
Core disease, constrictive sclerotinios, the general designation of small graininess sclerotiniose), the incidence of disease is up to more than 90% when serious, ruins product total crop failure, such as anti-
Control not in time, year after year superinfection, mulberry planter is suffered serious financial consequences.The disease becomes the bottle for hindering fruit mulberry industrialized development
Neck.
Diseases of mulberry fruits is the most fatal disease that fruit mulberry industry is faced at present, and it is in China In Middle And Lower Reaches of Changjiang River and Korea Spro
State's report is more, and its sclerotium can survive the several years in soil, and mulberry fruit is infected in circulation, and even No kernels or seeds are gathered, as in a year of scarcity when falling ill serious.
The detection and diagnosis of current diseases of mulberry fruits use conventional method, i.e., carry out experience according to mulberry fruit disease symptom
Property judges roughly, or collecting sample carries out isolating and purifying for pathogen, is then made a definite diagnosis according to Koch's Postulates.The method
Have the disadvantages that：
1st, need to wait until find to catch an illness after showing related symptoms.But it has been now " cancer of late stage ", almost without can rescue
Medicine, even if spray preventing and treating, also sheerly " mends the fold after the sheep is lost ", takes effect little.Because the disease is largely fallen ill from Pathogen Infection to sorosis,
Course is very short, and patient's condition is violent, once display symptom, most of disease fruit, to the infection later stage, is entirely that bacterium bag is inedible in mulberry field,
Suffer heavy losses.
2nd, time-consuming, empirical strong.Make a definite diagnosis, it is necessary to isolate and purify out pathogen, then carry out morphological observation, routine
The means such as Molecular Identification, reversal connection infection are made a definite diagnosis, and time-consuming reaches tens of days, or even all more long than the sorosis phase.
Therefore, new fast and accurate diseases of mulberry fruits detection of pathogens side is developed on the basis of forefathers' research
Method has important practical significance, and it can not only carry out early prediction forecast, have the more fully time to take prophylactico-therapeutic measures, while
New mulberry field and introduction seedling etc. can also be quarantined.
The content of the invention
In view of this, it is an object of the invention to provide a kind of small graininess sclerotiniose pathogen of mulberry fruit based on nest-type PRC
Early stage method for quick.
To reach above-mentioned purpose, the present invention provides following technical scheme：
The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC, comprises the following steps：
(1) the tissue sample DNA using the extraction of CTAB methods carries out the first round as template using universal primer ITS1/ITS4
PCR is expanded；
(2) the second wheel PCR amplifications are carried out by template of first round product, nested primer is special using caruncula shape cup cup fungi
Property primer, sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2；
(3) the amplified band diagnosis small graininess sclerotiniose of mulberry fruit according to step (2).
Preferably, the sample in step (1) is mulberry fruit.
Preferably, in step (1), the condition of first round PCR amplifications is as follows：95 DEG C of predegeneration 3min；94 DEG C of denaturation 30s,
55 DEG C of annealing 50s, 72 DEG C of extension 50s, 32 circulations, 72 DEG C of extension 10min, 4 DEG C, ∞.
Preferably, in step (1), the sequence such as SEQ ID NO.3 and SEQ ID NO.4 institutes of universal primer ITS1/ITS4
Show.
Preferably, in step (2), the second wheel amplification condition similar first round, annealing temperature is arranged to 56,58,60,62
Or the different gradients such as 64 DEG C, every kind of primer optimum condition is found with this.
It is further preferred that the annealing temperature of the second wheel amplification is 56,58,60 or 62 DEG C.
A pair of caruncula shape cup cup fungi primers, sequence is as shown in SEQ ID NO.3 and SEQ ID NO.4.
The screening technique of above-mentioned a pair of caruncula shapes cup cup fungi primer, be with mulberry reality cup cup fungi, core ground cane bacterium, sclerotinite and
Mulberry Phoma sp is control, by the corresponding germ ITS sequence in NCBI, Multiple Sequence Alignment, ESPript is carried out with ClustalX 2
3.0 carry out variance analysis, and Primer 5.0 carries out the design and assessment of primer and obtains.
The beneficial effects of the present invention are：
In the gene of fungal gene group encoding ribosomal, a transcriptional units are constituted by 18S, 5.8S and 28S rDNA, its
In spacer region be internal transcribed spacer region (Internal Transcribed Spacer, ITS).ITS regions include ITS1 and
Two regions of ITS2, wherein ITS1 is located between 18S and 5.8S, and ITS2 is located between 5.8S and 28S.Because ITS1 and ITS2 enter
Change relatively rapidly, with conservative in certain inter-species specificity and kind, have become fungi (especially filamentous fungi) and classify
The research emphasis of identification.Present invention employs nest-type PRC, its have quickly, high specific the features such as, using ITS as the first round
Amplimer, specific nested primer carries out diseases of mulberry fruits cause of disease quick detection as the second wheel amplimer, and method is feasible,
And with wider annealing temperature, early prediction forecast can be carried out, there is the more fully time to take prophylactico-therapeutic measures, while can also be right
New mulberry field and introduction seedling etc. are quarantined.Empirical tests, detection method of the invention has splendid accuracy and specificity, and
Substantially increase detection sensitivity.
Brief description of the drawings
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below and carries out
Explanation：
Fig. 1 is various pathogenic bacteria ITS sequence comparison result；
Fig. 2 a and Fig. 2 b are the nest-type PRC result of different annealing temperature, and 6 swimming lanes therein are respectively M-marker, 1-
56 DEG C, 2-58 DEG C, 3-60 DEG C, 4-62 DEG C, 5-64 DEG C；Fig. 2 a are the result of sample1, and Fig. 2 b are the result of sample2；
Fig. 3 a and Fig. 3 b are the application result of method for quick.
Specific embodiment
Below in conjunction with accompanying drawing, the preferred embodiments of the present invention are described in detail.
Material and reagent
Material：Adopt in the disease in It In Beibei, Chongqing West seed station mulberry field and Can Ye scientific and technical research institutes of Chongqing City mulberry field
Sorosis, is shown in Table 1.
Two parts of materials used by table 1.
Reagent：Main agents are as shown in table 2.
The main agents of table 2.
The configuration of related reagent：
The configuration of 1M Tris-HCl：Accurate weighing 121.1g Tris are placed in 1L beakers.Add the deionization of about 800mL
Water, is sufficiently stirred for dissolving.Add about 42mL concentrated hydrochloric acids regulation pH to 8.0.By solution constant volume to 1L.After autoclave sterilization, room
Temperature is preserved.
The configuration of 0.5M EDTA (pH 8.0)：The water disodium ethylene diamine tetraacetates of 90.05g bis- are added in 400mL water
(EDTANa22H2O), stirring and dissolving, pH to 8.0 (about 10g NaOH particles) is adjusted with NaOH, is settled to 500mL, and high pressure is gone out
Bacterium.
4×CTAB：CTAB 4g, NaCl 16.364g, 1M Tris-HCl 20mL (PH8.0), 0.5M EDTA 8mL.First
Use 70mL ddH2O dissolves, and is settled to 100mL and autoclaving.Use preceding plus 1mL beta -mercaptoethanols.
Instrument and equipment：
Experiment key instrument equipment used is as shown in table 3
The key instrument equipment of table 3.
Embodiment 1：
The design of nested primer：
From NCBI (National Center for Biotechnology Information, US National biotechnology
Information centre, http://www.ncbi.nlm.nih.gov/nuccore/) on download three kinds of tradition (hypertrophy (mulberry reality cup disk
Bacterium), small graininess (caruncula shape cup cup fungi), contractility (core ground cane bacterium)) diseases of mulberry fruits pathogen ITS sequence (sclerotinite and mulberry
Phoma sp is control), Multiple Sequence Alignment is carried out with ClustalX 2, ESPript 3.0 carries out variance analysis, and Primer 5.0 enters
The design and assessment of row primer, obtain the specific primer of every kind of diseases of mulberry fruits pathogen, and its comparison result is as shown in Figure 1.
Downloaded correlated series is as shown in table 4.
The ITS sequence accession number of the diseases of mulberry fruits pathogen of table 4.
Primer sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2.
The foundation of diseases of mulberry fruits method for quick：
Using nest-type PRC as the method for quick detection diseases of mulberry fruits pathogen, with CTAB methods, (Liu Li, Zhang Yongjun is perhaps long
Levy, Luo Feng, a kind of CTAB methods of improvement are extracted and produce polysaccharide fungal DNA, Chinese biological engineering magazine, 2014,34 (5)：75-79)
The tissue sample DNA of extraction carries out the amplification of first round PCR, primer sequence (this as template using universal primer ITS1/ITS4
Literary listed primer sequence is defaulted as 5 ' -3 ' directions) be：ITS1 (TCCGTAGGTGAACCTGCGG, such as SEQ ID NO.3 institutes
Show) and ITS4 (TCCTCCGCTTATTGATATGC, as shown in SEQ ID NO.4) (purchased from Hua Da gene), with first round product
For template carries out the second wheel PCR amplifications, nested primer uses foregoing corresponding specific primer, amplification system to use 25 μ L bodies
System, specific consumption is as shown in table 5.
The specific consumption of table 5.PCR amplification systems
First round PCR amplification condition is as shown in table 6.
6. first round of table PCR Amplifications
The second wheel amplification condition similar first round, annealing temperature is arranged to the different gradients such as 56,58,60,62 or 64 DEG C,
Every kind of primer optimum condition is found with this.
Embodiment 2：
The checking of method for quick
The theory testing of primer specificity：
The primer designed in embodiment 1 is brought into common mulberry tree fungal disease ITS sequence and is compared, to its specificity
Carry out preliminary test.
The practice test of primer specificity：
The method set up in embodiment 1 is tested with two parts of materials (referring to table 1), the material in table 1 is expanded
Increase.
Product after nested PCR amplification is linked into pMD 19-T carriers, connector after glue reclaim kit is reclaimed
System is as shown in table 7.
The linked system of table 7.
After fully mixing, 16 DEG C of connection 4h.
Connection product transformed competence colibacillus Escherichia coli are enterprising after Amp (ampicillin, ampicillin) resistant panel
Row screening, after choosing spot amplification, carries out bacterium solution PCR detections, and positive colony bacterium solution is delivered into Hua Da gene sequencing.
The Preliminary Applications of method for quick：
Spring in 2016 does not show illness in the field collection occurred frequently of It In Beibei, Chongqing different regions mulberry field diseases of mulberry fruits
And immature mulberry fruit, 14 parts are allocated as altogether, concrete condition is shown in Table 8, is detected using the above method.
The prematurity mulberry fruit that table 8. is gathered
Embodiment 3：
The experimental result of embodiment 2 and analysis：
Different sclerotiniose pathogen ITS sequence comparison results：
Found after being compared using ClustalX 2, same pathogen different strains ITS sequence indifference, therefore final choosing
Five groups of cane bacterium, sclerotinite and mulberry Phoma sp compare with taking mulberry reality cup cup fungi, caruncula shape cup cup fungi, core, and its result is such as
Shown in Fig. 1, the primer combined using Primer 5.0 designed by Fig. 1 is as shown in table 9.
The nested primer sequence gone out designed by table 9.
The foundation of sclerotiniose method for quick：
Grads PCR measure, primer SW-XL2F/1R (caruncula shapes are carried out using two kinds of materials in the primer pair table 1 in table 9
Cup cup fungi) expected clip size be 366bp, measurement result as shown in Figure 2 a and 2 b, from Fig. 2 a and Fig. 2 b can be seen that
Temperature is little on primer influence on three, in addition to expanding effect is not so good when 64 DEG C, 56~62 DEG C.But Fig. 2 a and Fig. 2 b
In have a faint miscellaneous band near faintly visible 700bp, it may be mulberry tree ITS sequence；500bp or so has a faint miscellaneous band, can
Can template used (first round amplified production) excessive concentration cause.And amplified production concentration is slightly higher, there are some hangovers existing
As.In general, the method has certain feasibility, and with wider annealing temperature.
The result of diseases of mulberry fruits method for quick is shown in Table 10.
The theoretical validation of the primer specificity of table 10.
As shown in table 10, as can be seen from Table 10, designed primer can only be specific for the theoretical validation of specific primer
Detected in pathogen, other mulberry tree fungal diseases without same clip, in theory with certain specificity.
Shown by sequencing, amplified production fits like a glove (as shown in SEQ ID NO.5) with expected fragment, shows the method
With accuracy and specificity.
SW-XL2F/SW-XL1R 366bp
CAGGCCAATCTCATCACACACTATTTTTTATCGTCTGAGCACTATATAACATTAAAACTTTCAACAACGGATCTCTT
GGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGTAGTGAATCATCGAATCTTTGA
ACGCACATTGCGCCCTTGGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATATAGCCATCAAGAGGCGTAGCCTGG
GAACAGGGTATAGCCAGCTTGGTATTGAGCCGTGTCAGCGATGGCAGGCTCTAAAATCAGTGGCGGCGCCGTTGGGT
CCTGAACGTAGTAACCTCTCGTTACGGGCCTCGACGGCTTCCGCCTATCAATTCTA CG, as shown in SEQ ID NO.5.
The application result of method for quick：
14 parts are not showed with symptom for the method for quick set up using the present invention and prematurity mulberry fruit detects, as a result
As shown in Figure 3 a and Figure 3 b shows, after the amplification of first round ITS1/ITS4 primers, only a1-a4 this 4 parts of samples have amplified disease fungus
Band in the range of a 500~1000bp has been amplified in ITS sequence (size 500bp or so), also 8 parts of samples such as c1, c2,
It may be mulberry tree ITS sequence.Although the ITS1/ITS4 primers of the first round only amplify 4 parts, the second wheel in 14 parts of samples
After nested primer amplification, most sample standard deviations can amplify respective strap, show that the method can greatly improve the sensitive of detection
Degree, can detect the routine single PCR more lower bound degree to be detected, while complete with expected fragment after the recovered cloning and sequencing of product
Complete consistent, indicating the method has specificity well, also illustrates the main mulberry field infection diseases of mulberry fruits situation in Beibei district
It is more serious.
Finally illustrate, preferred embodiment above is merely illustrative of the technical solution of the present invention and unrestricted, although logical
Cross above preferred embodiment to be described in detail the present invention, it is to be understood by those skilled in the art that can be
Various changes are made to it in form and in details, without departing from claims of the present invention limited range.
SEQUENCE LISTING
<110>Southwest University
<120>The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Caruncula shape cup cup fungi SW-XL2F
<400> 1
caggccaatc tcatcacaca ct 22
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Caruncula shape cup cup fungi SW-XL1R
<400> 2
cgtagaattg ataggcggaa gc 22
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223> ITS1
<400> 3
tccgtaggtg aacctgcgg 19
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<220>
<223> ITS4
<400> 4
tcctccgctt attgatatgc 20
<210> 5
<211> 366
<212> DNA
<213>Artificial sequence
<220>
<223> SW-XL2F/ SW-XL1R
<400> 5
caggccaatc tcatcacaca ctatttttta tcgtctgagc actatataac attaaaactt 60
tcaacaacgg atctcttggt tctggcatcg atgaagaacg cagcgaaatg cgataagtaa 120
tgtgaattgc agtagtgaat catcgaatct ttgaacgcac attgcgccct tgggtattcc 180
gaagggcatg cctgttcgag cgtcatatag ccatcaagag gcgtagcctg ggaacagggt 240
atagccagct tggtattgag ccgtgtcagc gatggcaggc tctaaaatca gtggcggcgc 300
cgttgggtcc tgaacgtagt aacctctcgt tacgggcctc gacggcttcc gcctatcaat 360
tctacg 366
Claims (6)
1. the small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit of nest-type PRC is based on, it is characterised in that including following
Step：
(1) the tissue sample DNA using the extraction of CTAB methods carries out the expansion of first round PCR as template using universal primer ITS1/ITS4
Increase；
(2) the second wheel PCR amplifications are carried out by template of first round product, nested primer is drawn using the specificity of caruncula shape cup cup fungi
Thing, sequence is as shown in SEQ ID NO.1 and SEQ ID NO.2；
(3) the amplified band diagnosis small graininess sclerotiniose of mulberry fruit according to step (2).
2. detection method according to claim 1, it is characterised in that in step (1), the condition of first round PCR amplifications is such as
Under：95 DEG C of predegeneration 3min；94 DEG C of denaturation 30s, 55 DEG C of annealing 50s, 72 DEG C of extension 50s, 32 circulate, 72 DEG C of extension 10min,
4 DEG C, ∞.
3. detection method according to claim 1, it is characterised in that in step (1), the sequence of universal primer ITS1/ITS4
Row are as shown in SEQ ID NO.3 and SEQ ID NO.4.
4. detection method according to claim 1, it is characterised in that in step (2), the second wheel amplification condition similar first
Wheel, 56,58,60,62 or 64 DEG C of different gradients are arranged to by annealing temperature, and every kind of primer optimum condition is found with this.
5. a pair of caruncula shapes cup cup fungi primer, it is characterised in that sequence is as shown in SEQ ID NO.3 and SEQ ID NO.4.
6. the screening technique of a pair of caruncula shapes glass cup fungi primer described in claim 5, it is characterised in that be with mulberry reality cup disk
Bacterium, core ground cane bacterium, sclerotinite and mulberry Phoma sp are control, by the small graininess sclerotiniose pathogen ITS sequences of traditional mulberry fruit in NCBI
Row, Multiple Sequence Alignment is carried out with ClustalX 2, and ESPript 3.0 carries out variance analysis, and Primer 5.0 carries out setting for primer
Count and assess and obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611110070.8A CN106755361A (en) | 2016-12-06 | 2016-12-06 | The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611110070.8A CN106755361A (en) | 2016-12-06 | 2016-12-06 | The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755361A true CN106755361A (en) | 2017-05-31 |
Family
ID=58879194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611110070.8A Pending CN106755361A (en) | 2016-12-06 | 2016-12-06 | The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755361A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592252A (en) * | 2019-09-05 | 2019-12-20 | 湖北省农业科学院经济作物研究所 | Primer group and kit for mulberry granule sclerotinia sclerotiorum qPCR detection and application of primer group and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792795A (en) * | 2009-12-29 | 2010-08-04 | 中国水稻研究所 | Identification method for determining anastomosis groups of rhizoctonia solani |
-
2016
- 2016-12-06 CN CN201611110070.8A patent/CN106755361A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101792795A (en) * | 2009-12-29 | 2010-08-04 | 中国水稻研究所 | Identification method for determining anastomosis groups of rhizoctonia solani |
Non-Patent Citations (2)
| Title |
|---|
| RAZIA SULTANA等: "Identification of Ciboria carunculoides RS103V, a Fungus Causing Popcorn Disease on Mulberry Fruits in Korea", 《RESEARCH IN PLANT DISEASE》 * |
| 胡君欢: "宁波桑果基地菌核病菌的多样性与ITS 初步分析", 《宁波大学学报（ 理工版）》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592252A (en) * | 2019-09-05 | 2019-12-20 | 湖北省农业科学院经济作物研究所 | Primer group and kit for mulberry granule sclerotinia sclerotiorum qPCR detection and application of primer group and kit |
| CN110592252B (en) * | 2019-09-05 | 2022-10-14 | 湖北省农业科学院经济作物研究所 | Primer group and kit for mulberry granule sclerotinia sclerotiorum qPCR detection and application of primer group and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bonde et al. | Evaluation of virulence of Phakopsora pachyrhizi and P. meibomiae isolates | |
| Sil et al. | Thermally dimorphic human fungal pathogens—Polyphyletic pathogens with a convergent pathogenicity trait | |
| Sayler et al. | Genetic characterization and real-time PCR detection of Burkholderia glumae, a newly emerging bacterial pathogen of rice in the United States | |
| CN103352078B (en) | Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology | |
| Engelbrecht et al. | Development of a nested quantitative real-time PCR for detecting Phytophthora cinnamomi in Persea americana rootstocks | |
| CN103498000B (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| Adikini et al. | Development of a specific molecular tool for detecting Xanthomonas campestris pv. musacearum | |
| Hu et al. | Genetically diverse long-lived clonal lineages of Phytophthora capsici from pepper in Gansu, China | |
| CN106350453A (en) | Separation/purification and pathogenicity identification method for pathogenic bacteria of fusarium root rot of Medicago sativa | |
| CN104263813A (en) | Sequences of primer for identifying fusarium solani and/or fusarium oxysporum, kit and method thereof | |
| CN108588249A (en) | A kind of primer pair and its detection method for detecting sweet potato Pathogen | |
| CN106434997A (en) | Early rapid detection method for detecting Ciboria shiraiana pathogenic bacteria based on nested PCR (polymerase chain reaction) | |
| Jang et al. | Direct detection of cylmdrocarpon destructans, root rot pathogen of ginseng by nested PCR from soil samples | |
| CN106755361A (en) | The small graininess sclerotiniose pathogen early stage method for quick of mulberry fruit based on nest-type PRC | |
| Ellis et al. | Association of putative fungal effectors in Fusarium oxysporum with wilt symptoms in soybean | |
| Gharbi et al. | Genetic diversity of Verticillium dahliae from olive trees in Tunisia based on RAMS and IGS-RFLP analyses | |
| Zamanmirabadi et al. | Genetic structure and phylogenetic relationships of Leptosphaeria maculans and L. biglobosa in Northern regions of Iran | |
| Wang et al. | Genome-wide analysis and characterization of eggplant F-box gene superfamily: gene evolution and expression analysis under stress | |
| CN101985652B (en) | High-throughput molecular detection of Fusarium graminearum on carbendazim medicament-resistant gene frequency | |
| CN102453742B (en) | Detection kit for Sclerotinia sclerotiorum strain drug-resistance and detection method of Sclerotinia sclerotiorum strain drug-resistance | |
| Mishchenko et al. | Detection of Soybean mosaic virus in some left-bank forest-steppe regions of Ukraine | |
| CN106434999A (en) | Method for rapidly detecting constrictive sclerotinia pathogenic bacteria of mulberry at early stage on basis of nested PCR (polymerase chain reaction) | |
| Bawage et al. | Morphological and molecular description of Phytophthora insolita isolated from citrus orchard in India | |
| Naji Abdulrahman et al. | Morphological and molecular characterization of Neoscytalidium isolates that cause canker and dieback in Eucalyptus and Chinaberry trees in Iraq. | |
| Ascari | Taxonomic and pathogenic diversity of the blast pathogen populations infecting wheat and grasses in Minas Gerais |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |