CN117230239A

CN117230239A - Kit capable of rapidly detecting corn stalk rot pathogen fusarium, application and detection method thereof

Info

Publication number: CN117230239A
Application number: CN202311209639.6A
Authority: CN
Inventors: 郭文超; 姜帆; 丁新华; 付开赟; 贾尊尊; 王小武; 吐尔逊.阿合买提
Original assignee: Institute Of Plant Protection Of Xinjiang Academy Of Agricultural Sciences; Chinese Academy of Inspection and Quarantine CAIQ
Current assignee: Institute Of Plant Protection Of Xinjiang Academy Of Agricultural Sciences; Chinese Academy of Inspection and Quarantine CAIQ
Priority date: 2023-09-18
Filing date: 2023-09-18
Publication date: 2023-12-15

Abstract

The invention discloses a kit capable of rapidly detecting corn stalk rot pathogen fusarium and a detection method, wherein Cas protein is Cas12, the kit comprises RPA primers and crRNA, the fusarium comprises fusarium graminearum, and the RPA primers and crRNA of the fusarium graminearum are respectively primer combination FgraF2/FgraR2 and Fg-crRNA. The invention develops a field visual rapid detection technology of corn stem rot pathogen based on combining CRISPR/Cas12a by a recombinase polymerase amplification technology aiming at corn stem rot pathogen with wide distribution, high separation frequency and strong pathogenicity. The technology can react at the constant temperature of 37-42 ℃, complicated instruments and equipment are not needed, and the CRISPR/Cas12a can recognize and cut specific nucleic acid sequences, so that the specificity and the sensitivity of detection are further increased on the basis of RPA.

Description

Kit capable of rapidly detecting corn stalk rot pathogen fusarium, application and detection method thereof

Technical Field

The invention relates to the technical field of molecular detection, in particular to a kit capable of rapidly detecting fusarium of corn stem rot pathogen, application thereof and a detection method.

Background

Corn is the first crop in the world and is also one of the most important grain crops in China. The corn stalk rot is taken as a soil-borne disease seriously threatening the corn production in China, the incidence rate is 15% -20% in the general year, the yield loss caused by the disease is about 20% when the disease is serious, and the yield loss caused by the disease is more than 50% when the disease is serious, and the disease becomes an important factor affecting the lodging and grain loss before the mechanized harvesting of the corn in the region in China, and has adverse effects on the construction of a grain safety system in China and the safety production of the corn in the region.

A large number of researches at home and abroad show that more pathogenic bacteria causing corn stem rot are available, more than 30 species are known at present, china is mainly divided into two main categories of Pythumflatum and Fusarium graminearum Fusarium graminearum, and the two main categories can be caused by single or compound infection of Fusarium, humic acid and anthrax, and pathogenic bacteria of corn stem rot in different areas are different. In 2017, he Juan et al reported that Fusarium graminearum and Fusarium verticillium F.vernicifluum are dominant populations of corn stalk rot in Yunnan province; in 2019, liu Shusen and the like are used for researching stem rot in main production areas of yellow-Huaihai summer corns, and it is considered that Fusarium verticillium F.verilioides detection rate is highest in Hebei province, and Fusarium roseum F.pro liferatum and P. Aristospora are used as dominant species in Shandong province; in the same year, guo finds that F.graminearum species complex and F.verticillium of Fusarium graminearum are dominant pathogens of corn stalk rot in four ecological regions of Gansu province.

In 2020-2021, song Zishuo total 335 corn stalk rot samples were collected in Xinjiang to obtain 601 isolates, wherein fusarium 560 strain accounts for 93.18%, wherein fusarium verticillatum f.verilioides, fusarium graminearum, fusarium oxysporum, fusarium solani f.solani are the main dominant pathogenic bacteria.

Recombinase polymerase amplification (Recombinase polymerase amplification, RPA) is a novel isothermal amplification technique developed by piebenburg et al in 2006 using protein recombination and repair involving cellular DNA synthesis. Compared with the conventional PCR which requires an instrument to carry out cyclic amplification, the RPA is operated at 37-42 ℃, only a small amount of sample preparation is needed, and 1-10 DNA copies can be amplified within 10min, so that the method has the advantages of high sensitivity, selectivity, portability, rapidness, capability of carrying out multiplex amplification and the like. There is a wide range of applications for amplifying a variety of different targets, including RNA, miRNA, ssDNA and dsDNA. The RPA reaction utilizes a recombinase to form a protein-DNA complex with an oligonucleotide primer that is capable of finding homologous sequences in double stranded DNA. Once the homologous sequence is located, a strand displacement reaction occurs to form and initiate DNA synthesis, allowing exponential amplification of the target on the template. Single-stranded DNA binding (SSB) proteins combine with the displaced DNA strand to form a D-loop, preventing further substitution. The entire amplification reaction is rapid, starting from several copies of the target DNA, and reaches a detectable level within minutes.

CRISPR (Clustered regularly interspaced short palindromic repeats, CRISPR) is a set of immune systems derived from bacteria and archaea that recognize and resist exogenous nucleic acids. Researchers have found that Cas12 and Cas13 families have collateral cleavage capability (or cleavage in trans), i.e., cas protein-crRNA binary complexes, after recognizing and binding substrates, can cleave not only substrates, but also any substrates that are free in the environment. The principle of a molecular detection technology based on a Recombinase Polymerase Amplification (RPA) technology combined into a cluster regularly-spaced short palindromic repeated sequence and a CRISPR related protein system (CRISPR associated enzyme systems, cas protein) -CRISPR/Cas protein is as follows: the substrate DNA or RNA is amplified by RPA or RT-RPA (Reverse transcription RPA) to increase the substrate concentration; subsequently, the amplified DNA is transcribed into RNA by the transcriptase, and mixed with RNA endonuclease and crRNA reaction solution. After the Cas protein-crRNA complex recognizes the substrate RNA, cis-cleavage and trans-cleavage occur, and finally, a suitable detection method, such as electrophoresis, real-time fluorescence, colorimetric method, etc., is selected according to experimental requirements for detection and analysis.

Detection of Fusarium has been reported using RPA detection, but its specificity and sensitivity of detection is limited. There are few reports of detection of fusarium using RPA in combination with CRISPR/Cas.

Disclosure of Invention

One of the purposes of the invention is to provide a kit capable of rapidly detecting fusarium graminearum, which is a corn stalk rot pathogen, wherein Cas protein is Cas12, the kit comprises an RPA primer and crRNA, the fusarium graminearum comprises fusarium graminearum, the RPA primer and the crRNA of the fusarium graminearum are respectively a primer combination FgraF2/FgraR2 and Fg-crRNA, and the sequences are as follows:

FgraF2:5’-GGGCGCTCATCATCACGTGTCAACCAGTC-3’，

FgraR2:5’-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3’，Fg-crRNA:UAAUUUCUACUAAGUGUAGAUAGCUUGUCAAGAACCCAGGC。

preferably, the Fusarium bacteria further comprise Fusarium verticillium and/or Fusarium layering,

the RPA primer and crRNA of the Fusarium verticillium are respectively primer combination FverF1/FverR1 and Fv-crRNA, and the sequences are as follows:

FverF1：5’-GATTTCTCAAAGAAAACATGCTGACATCGC-3’，

FverR1：5’-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3’，Fv-crRNA：UAAUUUCUACUAAGUGUAGAUCCCAUCGAUUCCCCCCUACGAC；

the RPA primer and crRNA of Fusarium are primer combination FproF2/FproR3 and Fp-crRNA2 respectively, and the sequences are as follows:

FproF2:5’-CGCGTCCTCTGCCCACCGATTTCACTTG-3’，

FproR3:5’-AGCGGCTTCCTATTGTCGAATGGTTAGTCG-3’，Fp-crRNA2:UAAUUUCUACUAAGUGUAGAUGUCUCGAGCGGGGUAGCAGGC。

preferably, the kit further comprises a signal reporter molecule, and the sequence of the signal reporter molecule is: 5'-TTATTATT-3' or 5'-TTTTTTTTTT-3';

preferably, a fluorescent reporter group is marked at the 5 'end of the signal reporter molecule, a biotin affinity group is marked at the 3' end of the signal reporter molecule, or a fluorescent reporter group and a fluorescence quenching group are respectively arranged at two ends of the signal reporter molecule and used for detecting fluorescent signals, preferably, the fluorescent reporter group is FAM, and the fluorescence quenching group is BHQ1.

Preferably, the kit further comprises an RPA amplification reagent comprising: RPA enzyme, mgOAc.

Preferably, the kit further comprises a CRISPR/Cas detection reagent comprising: cas12a protein, RNAse inhibitor, DTT,

the Cas12a protein is selected from the group consisting of AsCas12a, lb4Cas12a, lb5Cas12a, fnCas12a, hkCas12a, osCas12a, TCas 12a, bbCAs12a and BoCas12a,

preferably the cas12a protein is LbaCas12a.

It is a further object of the present invention to provide the use of a kit as defined in any one of the above in the detection of fusarium, including fusarium layering.

Still another object of the present invention is to provide a detection method for rapidly detecting fusarium pathogenic bacteria of corn stalk rot, using at least one primer combination in the kit of any one of the above, comprising the steps of:

s1, extracting DNA of a sample to be detected;

s2, RPA amplification: preparing an RPA reaction system, and amplifying the DNA of the sample to be detected obtained by extraction by an RPA method to obtain an amplified product;

s3, CRISPR/Cas system reaction detection: adding signal reporter molecules, cas proteins and crRNA into the amplification products, performing CRISPR reaction detection, and reading detection signals to obtain the amplification products;

preferably, the reaction system for RPA amplification comprises 28.5-30.5 mu L Rehydration buffer, 10.5-12 mu LddH ₂ O, 10 mu M of upstream and downstream primer, 1-3 mu L, RPA enzyme freeze-dried powder, 1-3 mu L of template DNA and 1.5-3.5 mu L of MgOAc with the concentration of 280 mu mol/L; preferably 29.5 mu L Rehydration buffer, 11.2 mu L ddH ₂ O, 10. Mu.M upstream and downstream primer each 2.4. Mu. L, RPA enzyme lyophilized powder, 2. Mu.L template DNA, 2.5. Mu.L MgOAc at 280. Mu. Mol/L;

the reaction conditions for RPA amplification are: reacting for 10-30 min at 37-42 ℃.

It is a final object of the present invention to provide another detection method: a one-step detection method for rapidly detecting fusarium pathogenic bacteria of corn stalk rot, which utilizes at least one primer combination in the kit of any one of the above, and comprises the following steps:

extracting DNA of a sample to be detected as template DNA; adding a template DNA and an RPA reaction system into a PCR tube, dripping a CRISPR/Cas system reaction system into a tube cover of the PCR tube, covering the tube cover, placing the PCR tube at the RPA reaction temperature for RPA amplification, then throwing the PCR tube or briefly centrifuging to enable a CRISPR/Cas system reaction system solution in the tube cover to completely enter an RPA amplification product solution in the PCR tube, placing the PCR tube at the CRISPR/Cas system reaction temperature for reaction, and reading a detection signal after the reaction is finished to obtain the PCR tube;

preferably, in the one-step detection method, the reaction system for RPA amplification comprises 5.7-6.1 mu L Rehydration buffer, 2.1-2.4 mu L ddH ₂ O, 10 mu M of upstream and downstream primer, 0.2-0.6 mu L, RPA enzyme freeze-dried powder, 0.2-0.6 mu L of template DNA and 0.3-0.7 mu L of MgOAc with the concentration of 280 mu mol/L.

In any of the above detection methods, the reaction system of the CRISPR/Cas system reaction comprises: NEBuffer 1.5-2.5. Mu.L, 5. Mu.M LbaCas12a 0.8-1.2. Mu.L, 40U/. Mu. L RNAse Inhibitor 0.4-0.6. Mu.L, 0.1M DTT 0.4-0.6. Mu.L, 10. Mu.M signal reporter 1.5-2.5. Mu.L and 10. Mu.M crRNA 0.8-1.2. Mu.L;

the CRISPR/Cas system reaction conditions are: reacting for 5-30 min at 37-42 ℃;

and the read detection signal adopts a real-time quantitative PCR instrument to read the fluorescent signal or adopts a CRISPR/Cas test strip to judge the result.

The beneficial effects of the invention are as follows:

the invention develops a corn stem rot pathogen on-site visual rapid detection technology based on combination of a recombinase polymerase amplification technology and a CRISPR and CRISPR related protein system CRISPR/Cas12a aiming at corn stem rot pathogens with wide distribution, high separation frequency and strong pathogenicity. The technology can react at the constant temperature of 37-42 ℃, complicated instruments and equipment are not needed, and the CRISPR/Cas12a can recognize and cut specific nucleic acid sequences, so that the specificity and the sensitivity of detection are further increased on the basis of RPA.

Drawings

FIG. 1 shows the result of electrophoresis detection of RPA primer RPA reaction products, wherein FIG. A shows the result of detection of a specific primer of Fusarium verticillium, FIG. B shows the result of detection of a specific primer of Fusarium layering, FIG. C shows the result of electrophoresis detection of FgraF1/FgraR1 RPA, and FIG. D shows the result of detection of a specific primer of Fusarium graminearum; in panels A-D, lanes are, in order from left to right: d2000 Samples number 1-8 in Marker, table 1.

FIG. 2 is a test strip detection result of Fusarium verticillium RPA-CRISPR/Cas12 a.

FIG. 3 is a strip test result of Fusarium RPA-CRISPR/Cas12 a.

FIG. 4 is a test strip detection result of Fusarium graminearum RPA-CRISPR/Cas12 a.

FIG. 5 is a sensitivity detection result of a one-step RPA-CRISPR/Cas12a detection system at a total reaction time of 20min, wherein FIG. A is a Fusarium verticillium detection result, and the concentration of the template on the test strip is as follows from left to right: 78.4 ng/. Mu.L, 7.84 ng/. Mu.L, 784 pg/. Mu.L, 78.4 pg/. Mu.L, 7.8 pg/. Mu.L, 0.78 pg/. Mu.L; the graph B shows the detection result of Fusarium, and the concentration of the template on the test strip is as follows from left to right: 104.9 ng/. Mu.L, 10.49 ng/. Mu.L, 1.049 ng/. Mu.L, 0.11 ng/. Mu.L, 11 pg/. Mu.L; graph C shows the detection result of Fusarium graminearum, and the concentration of the template on the test strip is as follows from left to right: 130.2 ng/. Mu.L, 13.02 ng/. Mu.L, 1.302 ng/. Mu.L, 0.13 ng/. Mu.L, 13 pg/. Mu.L.

FIG. 6 is a sensitivity detection result of a one-step RPA-CRISPR/Cas12a detection system at a total reaction time of 30min, wherein FIG. A is a Fusarium verticillium detection result, and the concentration of the template on the test strip is as follows from left to right: 78.4 ng/. Mu.L, 7.84 ng/. Mu.L, 784 pg/. Mu.L, 78.4 pg/. Mu.L, 7.8 pg/. Mu.L, 0.78 pg/. Mu.L, 78 fg/. Mu.L; the graph B shows the detection result of Fusarium, and the concentration of the template on the test strip is as follows from left to right: 104.9 ng/. Mu.L, 10.49 ng/. Mu.L, 1.049 ng/. Mu.L, 0.11 ng/. Mu.L, 11 pg/. Mu.L, 1.1 pg/. Mu.L; graph C shows the detection result of Fusarium graminearum, and the concentration of the template on the test strip is as follows from left to right: 130.2 ng/. Mu.L, 13.02 ng/. Mu.L, 1.302 ng/. Mu.L, 0.13 ng/. Mu.L, 13 pg/. Mu.L, 1.3 pg/. Mu.L.

FIG. 7 is a one-step sensitivity test result of the RPA-CRISPR/Cas12a test system at a total reaction time of 40min, wherein FIG. A is a Fusarium verticillium test result, and the concentration of the template on the test strip is as follows from left to right: 78.4 ng/. Mu.L, 7.84 ng/. Mu.L, 784 pg/. Mu.L, 78.4 pg/. Mu.L, 7.8 pg/. Mu.L, 0.78 pg/. Mu.L, 78 fg/. Mu.L, 7.8 fg/. Mu.L; the graph B shows the detection result of Fusarium, and the concentration of the template on the test strip is as follows from left to right: 104.9 ng/. Mu.L, 10.49 ng/. Mu.L, 1.049 ng/. Mu.L, 0.11 ng/. Mu.L, 11 pg/. Mu.L, 1.1 pg/. Mu.L, 0.11 pg/. Mu.L, 11 fg/. Mu.L; graph C shows the detection result of Fusarium graminearum, and the concentration of the template on the test strip is as follows from left to right: 130.2 ng/. Mu.L, 13.02 ng/. Mu.L, 1.302 ng/. Mu.L, 0.13 ng/. Mu.L, 13 pg/. Mu.L, 1.3 pg/. Mu.L, 0.13 pg/. Mu.L, 13 fg/. Mu.L.

In fig. 2 to 7, the upper strip of the test strip is a detection strip, and the lower strip is a quality control strip.

Detailed Description

The invention is further illustrated, but is not limited, by the following examples.

The experimental methods in the following examples are conventional methods unless otherwise specified.

The sources of the experimental strains in the examples of the present invention are shown in table 1:

TABLE 1

Sequence number	Chinese name	School name	Source
				1	Fusarium verticillium	Fusarium verticillioides	Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences
2	Fusarium verticillium	Fusarium verticillioides	Northwest A & F University
				3	Fusarium roseum (L.) kuntze	Fusarium proliferatum	Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences
4	Fusarium graminearum	Fusarium graminearum	Institute of Plant Protection, Xinjiang Academy of Agricultural Sciences
				5	Fusarium graminearum	Fusarium graminearum	Northwest A & F University
6	Fusarium flavum	Fusariam culmorum	XINJIANG AGRICULTURAL University
				7	Fusarium vine	Fusarium fujikuroi	XINJIANG AGRICULTURAL University
8	Fusarium solani	Fusarium solani	XINJIANG AGRICULTURAL University

Example 1, primer design, screening, establishment of RPA-CRISPR/Cas12a detection System

1. Target species RPA primer and crRNA design

RPA primers and crRNA of the target species were designed based on the target species (Fusarium verticillium F. Ver. Calides, fusarium layering F. Prograferatum and Fusarium graminearum F. Graminearum) and the translational elongation factor gene (Translation Elongation Factor alpha, TEF-1 alpha) of the closely related species in GenBank. To improve the specificity of the primer and crRNA, different haplotype sequences of a plurality of target species and related species thereof are selected for sequence comparison and analysis according to the relatedness of Fusarium, and the RPA specific primer and crRNA are designed manually according to SNP loci, and the sequence of the TEF-1 alpha gene used for designing the primer and crRNA is shown in Table 2. Primers and crRNA were synthesized by beijing qingke biotechnology, inc.

TABLE 2

The species in Table 2 are Fusarium species, belonging to the same genus as the closely related species. Wherein Fusarium verticillium Fusarium verticillioides is a related species of the same monoclinic group as Fusarium oxysporum F.sub-glutinins and Fusarium pseudolarium F.progroferum; fusarium graminearum Fusarium graminearum is a related species of the same monoclinic group as Fusarium semitectum F.incarnatum, fusarium equiseti F.culmorum.

The multiple sequence alignment of Table 2 was performed by DNAMAN software to find SNP sites of TEF-1. Alpha. Genes of the target species and its closely related species. Meanwhile, the TEF-1 alpha gene sequences of Fusarium verticillium, fusarium layering and Fusarium graminearum strains stored in the laboratory are detected to further confirm the correctness of the strains, and the RPA specific primers and crRNA are designed manually by using the detected TEF-1 alpha gene sequences according to the found SNP loci. The TEF-1 alpha gene sequences of the fusarium verticillium, the fusarium graminearum and the fusarium graminearum strains are shown in SEQ ID NO. 1-3 in sequence.

The sequences of the designed RPA-specific primers and crrnas are shown below:

1. fusarium verticillium:

FverF1 (SEQ ID NO. 4) 5'-GATTTCTCAAAGAAAACATGCTGACATCGC-3', primer design position is 112-141bp interval.

FverF2 (SEQ ID NO. 5) 5'-TCCTTCTATCGCGCGTTCTTTGCCCATCGATTC-3', primer design position is 224-256bp interval.

FverR1 (SEQ ID NO. 6) 5'-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3', primer design position is 368-400bp interval.

For the target sequence, crrnas were designed as follows, underlined to label the target sequence binding region, bold-labeled moiety can bind cas12a protein:

Fv-crRNA(SEQ ID NO.7):

2. fusarium roseum:

FproF1 (SEQ ID NO. 8) 5'-GATCCTGACCAAGATCTGGCGGGGTACATCTTGG-3', primer design position is 92-125bp interval.

FproF2 (SEQ ID NO. 9) 5'-CGCGTCCTCTGCCCACCGATTTCACTTG-3', primer design position is in the interval of 240-267 bp.

FproR1(SEQ ID NO.10):

5'-CACGTTTCGAATCGCAAGTGAAATCGGTGGGCAG-3', the primer design position is 248-281bp interval.

FproR2(SEQ ID NO.11):

5'-CGCTGCTTGACACGTGACAATGCGCTCATTGAGGTTGTGGAC-3', the primer design position is 387-428bp interval.

FproR3 (SEQ ID NO. 12) 5'-AGCGGCTTCCTATTGTCGAATGGTTAGTCG-3', primer design position is 427-456bp interval.

Fp-crRNA1(SEQ ID NO.13):

Fp-crRNA2(SEQ ID NO.14):

3. fusarium graminearum:

FgraF1 (SEQ ID NO. 15) 5'-TGTGAGTACCACCGCATCCCAACCCCGCCGACAC-3', primer design position is in the interval of 56-89 bp.

FgraF2 (SEQ ID NO. 16) 5'-GGGCGCTCATCATCACGTGTCAACCAGTC-3', primer design position is in the interval of 403-431 bp.

FgraR1(SEQ ID NO.17):

5'-GACGACTGTCGCTCGAGTGGCAGGGTATGAGCCCCAACGG-3', the primer design position is 337-376 bp.

FgraR2 (SEQ ID NO. 18) 5'-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3', primer design position is 602-634 bp.

Fg-crRNA(SEQ ID NO.19):

2. primer screening and establishment of RPA-CRISPR/Cas12a detection system

1. DNA extraction

The test strain uses a high-efficiency plant genome DNA extraction kit (DP 350) (Tiangen Biochemical technology (Beijing) Co., ltd.) to extract DNA, and uses a Nanodrop ultra-micro spectrophotometer (Sesameimer Feishier technology Co.) to accurately quantify the DNA.

2. Primer screening

Using the Twitdx company (uk)The Basic RPA KIT (goods number: TABAS03 KIT) carries out RPA reaction, and the reaction system refers to the specification of the KIT and comprises the following specific proportions: 29.5 mu L Rehydration buffer, 11.2 mu L ddH, respectively ₂ O and 2.4 mu L of each of the upstream and downstream primers (10 mu M) are added into RPA enzyme freeze-dried powder, after the dry powder is dissolved, 2 mu L of template DNA is added, and finally 2.5 mu L of MgOAc (280 mu mol/L) is added, and after being uniformly mixed, the mixture is put into a metal bath and incubated for 20min at 39 ℃. Mixing RPA reaction product with Tris saturated phenol/chloroform/isoamyl alcohol (25:24:1), centrifuging at 12000rpm for 5min, taking 5 μl supernatant, electrophoretically detecting RPA product, and screening specific RPA primer。

The strain of Table 1 was subjected to the RPA reaction using the primers designed previously as described above:

fusarium verticillium respectively adopts primer combinations FverF1/FverR1 and FverF2/FverR1 to carry out RPA reaction, and under the condition that the concentration of the template, the reaction time, the concentration of the primer and other reagents are the same, the amplified band of FverF2/FverR1 has light color, low amplification efficiency and low sensitivity; the amplified product of FverF1/FverR1 has high electrophoresis band brightness and obvious band, which shows that the primer has high amplification efficiency and high sensitivity, so that the FverF1/FverR1 is selected for subsequent experiments, the samples with the sequence numbers 1-8 in the table 1 are subjected to RPA reaction by adopting the FverF1/FverR1, and only Fusarium pseudolarix is amplified to obtain the band, which shows that the FverF1/FverR1 has specificity to Fusarium pseudolarix (figure 1A).

Fusarium layering is subjected to RPA reaction by adopting primer combinations FproF1/FproR1, fproF1/FproR2 and FproF2/FproR3 respectively, and three pairs of primers only amplify specific bands of Fusarium layering. However, in the subsequent CRISPR/Cas cleavage experiments, the cleavage efficiency of FproF1/FproR1/Fp-crRNA1 and FproF1/FproR2/Fp-crRNA1 is found to be low, the experimental result is unstable, the CRISPR/Cas cleavage system needs to react for more than 1 hour under the condition of highest template concentration, and FproF2/FproR3/Fp-crRNA2 can show a clear detection band on a test strip after cleavage for 10 minutes, so that the subsequent experiment with FproF2/FproR3 is determined. The RPA reaction was performed on samples numbered 1-8 of Table 1 using FproF2/FproR3, with only Fusarium rosenbergii amplified bands, indicating that FproF2/FproR3 is specific for Fusarium rosenbergii (FIG. 1B).

Fusarium graminearum adopts primer combination FgraF1/FgraR1 and FgraF2/FgraR2 to carry out RPA reaction, and FgraF1/FgraR1 amplifies bands of Fusarium graminearum and also amplifies bands of other species (figure 1C), and has poor specificity. While 8 samples of Table 1 were tested using FgraF2/FgraR2, which amplified specific bands only for Fusarium graminearum (FIG. 1D), but not for other species, indicating that FgraF2/FgraR2 was specific for Fusarium graminearum, the subsequent experiments with FgraF2/FgraR2 were ultimately determined.

After screening, 3 target species determine the optimal primers and crrnas for subsequent experiments: fusarium verticillium adopts FverF1/FverR1/Fv-crRNA, fusarium pseudolarium adopts FproF2/FproR3/Fp-crRNA2, fusarium graminearum adopts FgraF2/FgraR2/Fg-crRNA.

3. Establishment of CRISPR/Cas12a detection System

CRISPR/Cas12a detection System Using New England Biolabs company (UK)LbaCas12a (Cpf 1) nuclease and co-reagents. Adopts->The visual detection is carried out on a special nucleic acid detection test strip (Beijing Baozhen Yinghui biotechnology Co., ltd., china) for Cas 12/13.

The CRISPR/Cas12a detection system of Fusarium verticillium Fusarium verticillioides comprises 12.2 mu LDEPC-H ₂ O, 2. Mu.L NEBuffer, 0.4. Mu.L LbaCas12a (Cpf 1) (5. Mu.M), 0.5. Mu. L RNAse Inhibitor (RNAse inhibitor) (40U/. Mu.L), 0.5. Mu.L DTT (0.1M), 2. Mu.L reporter molecule (10. Mu.M), 0.4. Mu.L crRNA (10. Mu.M), 2. Mu.L RPA reaction product were mixed and placed in a metal bath for incubation at 37℃for 20min. After the reaction was completed, 80. Mu.L of deionized water was added, and after mixing well, the sample end of the test strip was immersed in the reaction solution, and the strip was observed. Wherein the sequence of the reporter molecule is 5'-FAM-TTATTATT-Biotin-3' or 5'-FAM-TTTTTTTTTT-Biotin-3' (SEQ ID NO. 20), and experiments prove that the two reporter molecules can be applied to the embodiment.

The CRISPR/Cas12a detection system of Fusarium roseum Fusarium proliferatum and Fusarium graminearum Fusarium graminearum comprises 12.2. Mu.L DEPC-H ₂ O, 2. Mu.L NEBuffer, 1. Mu.L LbaCas12a (Cpf 1) (5. Mu.M), 0.5. Mu. L RNAse Inhibitor (40U/. Mu.L), 0.5. Mu.L DTT (0.1M), 2. Mu.L reporter molecule (FAM-TTATTATTT-Biotin or FAM-TTTTTTTTTT-Biotin) (10. Mu.M), 1. Mu.L crRNA (10. Mu.M), 2. Mu.L RPA reaction product were mixed and placed in a metal bath for incubation at 37℃for 20min. After the reaction is completed, 80 mu L of deionized water is added, and after the mixture is uniformly mixed, the sample end of the test strip is immersed in the reaction liquid, so that the appearance is achievedAnd (5) inspecting the strip.

8 strains in table 1 are detected by adopting an RPA-CRISPR/Cas12a detection system (FverF 1/FverR 1/Fv-crRNA) of Fusarium verticillium, the detection results of test strips are shown in fig. 2, test strips from left to right are respectively represented by detection results of strains with the sequence numbers 1-8 in table 1, and as can be seen from the graph, only Fusarium verticillium with the sequence numbers 1 and 2 in table 1 shows detection bands (when amplification and cleavage efficiency is high, quality control bands are not usually generated), and the rest strains have no detection bands, so that the detection system has specificity to the Fusarium verticillium.

8 strains in the table 1 are detected by adopting a layer-out fusarium RPA-CRISPR/Cas12a detection system (FproF 2/FproR3/Fp-crRNA 2), the detection results of test strips are shown in fig. 3, test strips from left to right 1-8 respectively represent the detection results of strains with the sequence numbers of 1-8 in the table 1, and as can be seen from the figure, only the layer-out fusarium with the sequence number of 3 in the table 1 shows a detection band, and the rest strains have no detection band, so that the detection system has specificity for the layer-out fusarium.

8 strains in the table 1 are detected by adopting an RPA-CRISPR/Cas12a detection system (FgraF 2/FgraR 2/Fg-crRNA) of the fusarium graminearum, the detection results of test strips are shown in fig. 4, test strips from left to right are respectively represented by detection results of strains with the sequence numbers 1-8 in the table 1, and as can be seen from the graph, only the fusarium graminearum with the sequence numbers 4 and 5 in the table 1 shows detection bands, and the rest strains have no detection bands, so that the detection system has specificity for the fusarium graminearum.

The results show that only the target species has a detection strip, and other control species have no detection strip, which indicates that the specific primer of the target species and crRNA have good specificity for detecting the target species.

The inventors also studied different cleavage times of CRISPR/Cas12a, and under the condition that enough substrates are available, target species can be detected by the test strip after 5 minutes of cleavage, and by adopting the RPA primer determined by the invention, target species can be detected by the test strip after 10 minutes of cleavage.

Example 2, establishment optimization of RPA-CRISPR/Cas12a detection System and sensitivity detection

The RPA-CRISPR/Cas12a detection system established in the embodiment 1 is further optimized, so that the whole reaction is quicker and more efficient, and the cost is greatly reduced. Compared with a method of adding the CRISPR/Cas12a detection system after the RPA is finished, the one-step method has the advantages that the operation is saved, and meanwhile, the uncovering pollution is avoided.

1. One-step RPA-CRISPR/Cas12a detection system

(1) The one-step method RPA-CRISPR/Cas12a detection system of Fusarium verticillium is as follows:

29.5 mu L Rehydration buffer, 11.2 mu L ddH, respectively ₂ O and 2.4 mu L of each upstream and downstream primer (10 mu M) are added into RPA enzyme freeze-dried powder, after the dry powder is dissolved, the powder is split into five equal parts and then is divided into five PCR tubes, namely, the RPA reaction system is reduced to 1/5 of the RPA reaction system in the example 1, and 0.5 mu L of template DNA and 0.5 mu LMg OAc (280 mu mol/L) are added into the PCR tubes; then dripping the mixed fusarium verticillium cutting system on the PCR tube covers, wherein the cutting system on each PCR tube cover comprises: 2. Mu.L NEBuffer, 0.4. Mu.L LbaCas12a (Cpf 1) (5. Mu.M), 0.5. Mu. L RNAse Inhibitor (40U/. Mu.L), 0.5. Mu.L DTT (0.1M), 2. Mu.L reporter (10. Mu.M) and 0.4. Mu.L crRNA (10. Mu.M). Covering a tube cover, placing the PCR tube into a metal bath, incubating for 10-30 min at 39 ℃ (RPA reaction time), then manually swinging the PCR tube or briefly centrifuging to ensure that the solution on the tube cover is completely mixed into the reaction solution, placing the PCR tube into the metal bath, and incubating for 10min at 39 ℃ (cutting time); after the reaction was completed, 30. Mu.L of deionized water was added, and after mixing well, the sample end of the test strip was immersed in the reaction solution, and the strip was observed.

(2) One-step RPA-CRISPR/Cas12a detection systems for fusarium and fusarium graminearum are as follows:

29.5 mu L Rehydration buffer, 11.2 mu L ddH, respectively ₂ O and 2.4 mu L of each upstream and downstream primer (10 mu M) are added into RPA enzyme freeze-dried powder, after the dry powder is dissolved, the powder is split into five equal parts and then is divided into five PCR tubes, namely, the RPA reaction system is reduced to 1/5 of the RPA reaction system in the example 1, and 0.5 mu L of template DNA and 0.5 mu LMg OAc (280 mu mol/L) are added into the PCR tubes; dripping the mixed Fusarium layering or Fusarium graminearum cutting system on the PCR tube caps, each PCR tube capThe above cleavage system comprises: 2. Mu.L NEBuffer, 1. Mu.L LbaCas12a (Cpf 1) (5. Mu.M), 0.5. Mu. L RNAse Inhibitor (40U/. Mu.L), 0.5. Mu.L DTT (0.1M), 2. Mu.L reporter (10. Mu.M) and 1. Mu.L crRNA (10. Mu.M). Covering a tube cover, placing the PCR tube into a metal bath, incubating for 10-30 min at 39 ℃ (RPA reaction time), then manually swinging the PCR tube or briefly centrifuging to ensure that the solution on the tube cover is completely mixed into the reaction solution, placing the PCR tube into the metal bath, and incubating for 10min at 39 ℃ (cutting time); after the reaction was completed, 30. Mu.L of deionized water was added, and after mixing well, the sample end of the test strip was immersed in the reaction solution, and the strip was observed.

2. Sensitivity detection

The template DNA of the target species (Fusarium verticillium template concentration 78.4 ng/. Mu.L, fusarium layering template concentration 104.9 ng/. Mu.L, fusarium graminearum template concentration 130.2 ng/. Mu.L) was diluted 10-fold with a 10-fold gradient, respectively ⁰ 、10 ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 、10 ^-7 The detection sensitivity is determined by adopting a one-step method RPA-CRISPR/Cas12a detection system with 8 concentrations, wherein the RPA reaction time is respectively 10min, 20min and 30min, and the cutting time is 10 min. Each concentration gradient was repeated 3 times.

The sensitivity test results are shown in fig. 5-7:

as shown in FIG. 5, the total reaction time was within 20min (RPA reaction 10min, cleavage 10 min), the detection sensitivity of Fusarium verticillium RPA-CRISPR/Cas12a strip was 7.8 pg/. Mu.L (FIG. 5A), the detection sensitivity of Fusarium layering RPA-CRISPR/Cas12a strip was 0.11 ng/. Mu.L (FIG. 5B), and the sensitivity of Fusarium graminearum RPA-CRISPR/Cas12a strip was 0.13 ng/. Mu.L (FIG. 5C).

As shown in FIG. 6, the total reaction time was within 30min (RPA reaction 20min, cleavage 10 min), the detection sensitivity of Fusarium verticillium RPA-CRISPR/Cas12a strip was 0.78pg/μL (FIG. 6A), the detection sensitivity of Fusarium layering RPA-CRISPR/Cas12a strip was 11pg/μL (FIG. 6B), and the sensitivity of Fusarium graminearum RPA-CRISPR/Cas12a strip was 13pg/μL (FIG. 6C).

As shown in FIG. 7, the total reaction time was within 40min (RPA reaction 30min, cleavage 10 min), the detection sensitivity of Fusarium verticillium RPA-CRISPR/Cas12a strip was 78 fg/. Mu.L (FIG. 7A), the detection sensitivity of Fusarium layering RPA-CRISPR/Cas12a strip was 0.11 pg/. Mu.L (FIG. 7B), and the sensitivity of Fusarium graminearum RPA-CRISPR/Cas12a strip was 0.13 pg/. Mu.L (FIG. 7C).

Example 3, application

Performing DNA crude extraction on a suspected corn stem rot disease sample collected in the field, adding tissues of the disease sample into a 1.5mL centrifuge tube, adding 30 mu L of buffer solution (10 mM Tris-HCl pH 8.0,1mM EDTA pH 8.0) into the tube, placing the centrifuge tube at 95 ℃ for reaction for 5min, taking supernatant as a DNA template, and detecting the disease sample by adopting a one-step RPA-CRISPR/Cas12a detection system established in the embodiment 2, wherein the total reaction time is 20min (RPA reaction for 10min and cutting for 10 min). Meanwhile, the pathogenic species are identified by adopting a conventional fusarium separation and culture medium culture method.

A total of 5 samples were collected and the results of one-step RPA-CRISPR/Cas12a detection and conventional pathogen isolation culture identification methods are shown in table 3:

TABLE 3 Table 3

The field disease sample can detect the fusarium verticillium, the fusarium graminearum and the fusarium graminearum by a one-step method RPA-CRISPR/Cas12a, three pathogenic bacteria are also separated by the traditional separation culture method, the detection results of two methods of each sample are consistent, and the one-step method RPA-CRISPR/Cas12a detection method established by the invention can realize the field rapid detection of the corn stalk rot pathogen in the field, and the result is accurate and reliable.

Claims

1. A kit capable of rapidly detecting fusarium which is a pathogenic bacterium of corn stem rot is characterized in that: the Cas protein is Cas12, the kit comprises an RPA primer and crRNA, and the kit comprises an RPA primer and crRNA primer combination FgraF2/FgraR2 and Fg-crRNA for detecting fusarium graminearum, and the sequences are as follows:

FgraF2:5’-GGGCGCTCATCATCACGTGTCAACCAGTC-3’，

FgraR2:5’-CCATGTTAGTATGAGAATGTGATGACAGCAGTG-3’，

Fg-crRNA:UAAUUUCUACUAAGUGUAGAUAGCUUGUCAAGAACCCAGGC。

2. the kit of claim 1, wherein: the kit further comprises an RPA primer and crRNA primer combination for detecting Fusarium verticillium and/or Fusarium layering,

the primer combination FverF1/FverR1 and Fv-crRNA of the Fusarium verticillium RPA primer and crRNA has the following sequences:

FverF1：5’-GATTTCTCAAAGAAAACATGCTGACATCGC-3’，

FverR1：5’-AGCTCAGTGAGGTTGTGGAATGGGAGAGGGCAG-3’，

Fv-crRNA：UAAUUUCUACUAAGUGUAGAUCCCAUCGAUUCCCCCCUACGAC；

the layer shows the primer combination FproF2/FproR3, fp-crRNA2 of the RPA primer and crRNA of Fusarium, the sequence of which is as follows:

FproF2:5’-CGCGTCCTCTGCCCACCGATTTCACTTG-3’，

FproR3:5’-AGCGGCTTCCTATTGTCGAATGGTTAGTCG-3’，

Fp-crRNA2:UAAUUUCUACUAAGUGUAGAUGUCUCGAGCGGGGUAGCAGGC。

3. the kit of claim 1, wherein: the kit also comprises a signal reporter molecule, wherein the sequence of the signal reporter molecule is as follows: 5'-TTATTATT-3' or 5'-TTTTTTTTTT-3';

4. The kit of claim 1, wherein: also included are RPA amplification reagents comprising: RPA enzyme, mgOAc.

5. The kit of claim 1, wherein: also included is a CRISPR/Cas detection reagent comprising: cas12a protein, RNAse inhibitor, DTT,

preferably the cas12a protein is LbaCas12a.

6. Use of a kit according to any one of claims 1 to 5 for detecting fusarium, characterized in that: the Fusarium includes Fusarium graminearum.

7. A detection method for rapidly detecting fusarium which is a pathogen of corn stalk rot, characterized in that the following steps are performed by using at least one primer combination in the kit according to any one of claims 1 to 5:

s1, extracting DNA of a sample to be detected;

preferably, the reaction system for RPA amplification comprises 28.5-30.5 mu L Rehydration buffer, 10.5-12 mu L ddH ₂ O, 10 mu M of upstream and downstream primer, 1-3 mu L, RPA enzyme freeze-dried powder, 1-3 mu L of template DNA and 1.5-3.5 mu L of MgOAc with the concentration of 280 mu mol/L; preferably 29.5 mu L Rehydration buffer, 11.2 mu L ddH ₂ O, 10. Mu.M upstream and downstream primer each 2.4. Mu. L, RPA enzyme lyophilized powder, 2. Mu.L template DNA, 2.5. Mu.L MgOAc at 280. Mu. Mol/L;

8. A one-step detection method capable of rapidly detecting corn stalk rot pathogen fusarium is characterized by comprising the following steps: detection using the kit of any one of claims 1 to 5, comprising the steps of:

preferably, the reaction system for RPA amplification comprises 5.7-6.1 mu L Rehydration buffer, 2.1-2.4 mu L ddH ₂ O, 10 mu M of upstream and downstream primer, 0.2-0.6 mu L, RPA enzyme freeze-dried powder, 0.2-0.6 mu L of template DNA and 0.3-0.7 mu L of MgOAc with the concentration of 280 mu mol/L.

9. The detection method according to claim 7 or 8, characterized in that:

the reaction system of the CRISPR/Cas system reaction comprises: NEBuffer 1.5-2.5. Mu.L, 5. Mu.M LbaCas12a 0.8-1.2. Mu.L, 40U/. Mu. L RNAse Inhibitor 0.4-0.6. Mu.L, 0.1M DTT 0.4-0.6. Mu.L, 10. Mu.M signal reporter 1.5-2.5. Mu.L and 10. Mu.M crRNA0.8-1.2. Mu.L;

the CRISPR/Cas system reaction conditions are: reacting for 5-30 min at 37-42 ℃.

10. The detection method according to any one of claims 7 to 9, characterized in that: and the read detection signal adopts a real-time quantitative PCR instrument to read the fluorescent signal or adopts a CRISPR/Cas test strip to judge the result.