CN101235411A - Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique - Google Patents
Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique Download PDFInfo
- Publication number
- CN101235411A CN101235411A CNA2008100523210A CN200810052321A CN101235411A CN 101235411 A CN101235411 A CN 101235411A CN A2008100523210 A CNA2008100523210 A CN A2008100523210A CN 200810052321 A CN200810052321 A CN 200810052321A CN 101235411 A CN101235411 A CN 101235411A
- Authority
- CN
- China
- Prior art keywords
- minutes
- add
- lamp
- tris
- mediated isothermal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a reagent kit and a detecting method for using loop-mediated isothermal amplification (LAMP) technique to detect aeromonas caviae, which belongs to the pathogen diagnosis field. The main technical scheme of the invention comprises: utilizing the LAMP technique, designing four pairs of high specificity primers aiming at six zones of 16s and 23s ribosome RNA gene transcription spacer region, and achieving the purpose for detecting the aeromonas caviae with specificity. Compared with a traditional method, equipment and operational steps which are needed in the method are simple, the method has the advantages of rapidness and high specificity, and the detecting cost is lower, which is suitable for common clinics and field detections.
Description
Technical field
The invention belongs to the pathogenic bacteria diagnostic field, to the effect that by with district between the transcribing of ring mediated isothermal amplification (loop-mediatedisothermal amplification LAMP) technology specific amplification 16S and 23S ribosomal RNA gene, (Aeromonas caviae) carries out rapid detection to pathogenic mouse Aeromonas.Can reach the purpose of distinguishing Aeromonas caviae (Aeromonas caviae) and similar pathogenic bacterium in isothermal condition (about 65 ℃) insulation dozens of minutes.Can improve the efficient of clinical diagnosis Aeromonas caviae greatly.
Background technology
Aeromonas caviae (Aeromonas caviae) extensively distributes in physical environment, especially is distributed in the various water bodies.There is bibliographical information from fresh water, salt water, tap water and soil and in animal and human's class ight soil, to isolate Aeromonas caviae.This bacterium is relevant with numerous disease, and it can cause infectious diarrhea, can cause that also multiple enteron aisle infects outward, as respiratory system, and urinary system, wound, abdominal cavity, site infections such as gall-bladder and bile duct.Aeromonas caviae is especially serious to immunocompromised crowd's harm, individual cases even entail dangers to life.Children are easy infection colonies.Other the new illness that is caused by Aeromonas caviae is also constantly reported in recent years, (van der Gaag et al., Aeromonas caviaeinfection mimicking inflammatory bowel disease in a child such as inflammatory bowel and microbemia for example; Teiraet al., Bacteremia of biliary origin caused by Aeromonas caviae in a healthypatient).
Diagnose mainly based on biochemical investigation for Aeromonas in the world at present, diagnosis for Aeromonas need be got rid of other extremely close on biochemical trait kind, and will just can make a definite diagnosis through a numerous group reaction, and the result is inaccurate in some cases.Especially identifying on the level of planting, relatively difficulty.It is longer to add the used time of biochemical reaction, makes very lowly for the detection efficiency of these pathogenic bacterium, and making a definite diagnosis fully needs the 1-3 time-of-week.Conventional sense wastes time and energy, and is very unfavorable in time definite patient scheme, and the labor capacity that traditional detection method need be bigger, therefore can increase the detection cost.The molecular Biological Detection method develops rapidly in recent years, but mainly detects based on conventional polymerase chain reaction (PCR).Though it is also more fast and convenient that the polymerase chain reaction is detected,, make its accuracy be subjected to certain limitation because the specificity that a pair of primer can reach is limited.In addition, this method multipotency in check sensitivity reaches 10
3-10
4CFU/ml, its effect is very desirable (M.N.Gonza ' lez-Rodri ' guez et al., PCR detection of potentially pathogenicaeromonads in raw and cold-smoked freshwater fish) not.Also having some molecular Biological Detection technology such as 16S rRNA gene sequencing authenticate technology also to can be used for Aeromonas detects.Though sequencing technologies has higher accuracy, be with isolated bacterial pure growth and polymerase chain reaction product as the basis, process is long, and technical sophistication is had relatively high expectations to operator, is unfavorable for applying.Domestic report for the Aeromonas diagnosis is not a lot, and only a small amount of report all is confined to use the inspection technology of having developed abroad.The domestic case relevant with Aeromonas caviae report is much, but still lacks the detection method fast and accurately to these pathogenic bacterium.Therefore, develop a kind of fast, the high accuracy and the highly sensitive Aeromonas caviae method of inspection and test kit are necessary very much.
Summary of the invention
The purpose of this invention is to provide a kind of Aeromonas caviae loop-mediated isothermal amplification fast detecting reagent kit and detection method.The utilization loop-mediated isothermal amplification technique detects the method for Aeromonas caviae, can improve the accuracy of detection efficiency and detection, the present invention is directed to the 16S-23S ribosome-RNA(rRNA) transcribe between 4 kinds of special primers of 6 zone design in district, have high specificity and sensitivity.Only need about 2 hours detection time.In addition, because this detection method and required equipment are simple, therefore also can be used for the field and detect on the spot.
1. test kit composition
In order to solve the problem of this pathogenic bacterium conventional sense method inefficiency, the present invention realizes that by utilizing a kind of Aeromonas caviae loop-mediated isothermal amplification fast detecting reagent kit its composition and concentration are as follows:
1) specific oligonucleotide primer: FIP, BIP, F3, B3 (each primer concentration is 5-15 μ mol/L)
FIP：5’AGGCCCGCCGAGGCTGCGATTTTAGCGATAACAACGTTGA3’
BIP：5’AATAAAGCATGATTTTCGTTTTTCCGTGAGAAGGGCGGTGTC3’
F3：?5’AAGTTCGTTACCCAATGTAGAG3’
B3：?5’CCCTTCTACCGCCGTGCAAG3’
2) DNA extraction reagent: TE damping fluid (pH 8.0 for 5-15mmol/L Tris, 0.5-1.5mmol/L EDTA); Proteinase K solution (concentration 10-20mg/mL, pH8.0); The saturated phenol of Tris (pH8.0); Sodium acetate (concentration 2-5mol/L); Ethanol (concentration 95%).
3) PCR reaction system:
10 * reaction buffer (200mmol/L Tris-HCl (pH 8.8), 100mmol/L KCl, 100mmol/L (NH
4)
2SO
4, 20mmol/L MgSO
4, 1%Triton X-100)
4) dNTPs (dCTP, the mixture of dGTP, every kind of concentration is 5-15mmol/L for dATP, dTTP).
5) distilled water.
6) BstDNA polysaccharase (8u/ μ L)
2. test kit using method
1) DNA extracting
The doubtful bacterium colony of picking joins vibration mixing in the 0.4mL TE damping fluid (pH8.0).Add Proteinase K solution 10 μ L in 55 ℃ of insulations 1-2 hour, add with the saturated phenol of volume Tris (pH8.0), strong vibration, 8000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting; Get supernatant liquor, add the sodium acetate (3mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, centrifugal 5 minutes of following 12000 rev/mins of room temperature, abandon supernatant, add 50 μ LTE solution, put-20 ℃ of preservations.
2) ring mediated isothermal amplification (LAMP)
Add following reagent in PCR reagent pipe, making cumulative volume is 25 μ L:
10 * reaction buffer (2.5 μ L)
(200mmol/L?Tris-HCl(pH?8.8)，100mmol/L?KCl，100mmol/L(NH
4)
2SO
4，20mmol/LMgSO
4，1％Triton?X-100)
Bst archaeal dna polymerase 8U (1 μ L)
FIP 40pmol(4μL)
BIP 40pmol(4μL)
F3 5pmol(0.5μL)
B3 5pmol(0.5μL)
Every kind of 80nmol/L of dNTPs (10mmol/L 0.5 μ L)
DNA sample 50ng (2 μ L)
Distilled water 10 μ L
LAMP amplification program: 1., be inserted into immediately on ice with 95 ℃ of sex change of template DNA 5 minutes; 2. 62 ℃ kept 60 minutes; 3. 80 ℃ kept 2 minutes.
3) electrophoretic examinations
The LAMP product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose, and electrophoresis result is observed under uv analyzer, and positive findings should be to be the band that scalariform distributes, and spacing is about 160bp.
The present invention utilizes Aeromonas 16S-23S ribosomal RNA gene to transcribe the specificity of a region sequence, by four pairs of Auele Specific Primers of six zone design, amplify the scalariform band of easy judgement, in tested 109 other malignant bacterias, all do not find false positive results.
The present invention's advantage compared with prior art is: the authentication method based on DNA is applicable to directly direct utilization loop-mediated isothermal amplification method specific amplification target gene from clinical samples such as patient's mycetome liquid, tissue, thereby detects Aeromonas caviae.The LAMP method have detect accurately, high specificity, easy to operate, the equipment characteristic of simple can be identified special target bacteria quickly and accurately.It has avoided cultivating repeatedly with loop-mediated isothermal amplification method amplification bacterium specific target gene, and tediously long a series of biochemical reactions save time, labor force and cost.The LAMP authentication method is not subjected to the influence of culture condition and bacterium physiological status, and is more accurate than the Physiology and biochemistry authentication method, can get rid of the interference bacterium that some Physiology and biochemistry authentication methods can not be got rid of.
Description of drawings
Accompanying drawing: primer specificity test pattern and patient's sample detected result figure
Embodiment
Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.
Embodiment 1: patient's sample 1
1.DNA extracting
The doubtful bacterium colony of picking joins vibration mixing in the 0.4mLTE damping fluid (pH8.0).Add Proteinase K solution 10 μ L in 55 ℃ of insulations 1-2 hour.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 8000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (3mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, centrifugal 5 minutes of following 12000 rev/mins of room temperature, abandon supernatant, add 50 μ L TE solution, put-20 ℃ of preservations.
2) ring mediated isothermal amplification (LAMP)
Add following reagent in PCR reagent pipe, making cumulative volume is 25 μ L:
Each component final concentration and volume in the composition system
10 * reaction buffer (2.5 μ L)
(200mmol/L?Tris-HCl(pH?8.8)，100mmol/L?KCl，100mmol/L(NH
4)
2SO
4，20mmol/LMgSO
4，1％Triton?X-100)
Bst archaeal dna polymerase 8U (1 μ L)
FIP 40pmol(4μL)
BIP 40pmol(4μL)
F3 5pmol(0.5μL)
B3 5pmol(0.5μL)
Every kind of 80nmol/L of dNTPs (10mmol/L 0.5 μ L)
DNA sample 50ng (2 μ L)
Distilled water 10 μ L
LAMP amplification program: 1., be inserted into immediately on ice with 95 ℃ of sex change of template DNA 5 minutes; 2. 62 ℃ kept 60 minutes; 3. 80 ℃ kept 2 minutes.
3. detected sample purpose LAMP amplification and electrophoretic examinations
The LAMP product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose.Electrophoresis result is observed under uv analyzer, and positive findings should be to be the band that scalariform distributes.And spacing is (accompanying drawing, a swimming lane 4) about 160bp, is the accuracy that guarantees to detect, and the product of amplification carries out enzyme with Bgl I and Xba I respectively and cuts (seeing accompanying drawing, swimming lane 11-14).
The sample that each swimming lane is represented in the accompanying drawing is as follows
1,9,10,15: molecular weight maker
2: Aeromonas caviae (ATCC 15468)
3: the Aeromonas caviae clinical separation strain
4: patient's sample 1 LAMP amplified production
5: patient's sample 2 LAMP amplified productions
6: patient's sample 3 LAMP amplified productions
7: Aeromonas hydrophila (ATCC 7966)
8: Aeromonas sobria (ATCC43979)
11, the figure as a result after the 12:LAMP amplified production is cut with Bgl I enzyme
13, the figure as a result after the 14:LAMP amplified production is cut with Xba I enzyme
Embodiment 2: patient's sample 2
1.DNA extracting
The doubtful bacterium colony of picking joins vibration mixing in the 0.4mLTE damping fluid (pH8.0).Add Proteinase K solution 10 μ L in 55 ℃ of insulations 1-2 hour.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 8000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (3mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, centrifugal 5 minutes of following 12000 rev/mins of room temperature, abandon supernatant, add 50 μ LTE solution, put-20 ℃ of preservations.
2) ring mediated isothermal amplification (LAMP)
Add following reagent in PCR reagent pipe, making cumulative volume is 25 μ L:
10 * reaction buffer (2.5 μ L)
(200mmol/L?Tris-HCl(pH?8.8)，100mmol/L?KCl，100mmol/L(NH
4)
2SO
4，20mmol/LMgSO
4，1％Triton?X-100)
Bst archaeal dna polymerase 8U (1 μ L)
FIP 40pmol(4μL)
BIP 40pmol(4μL)
F3 5pmol(0.5μL)
B3 5pmol(0.5μL)
Every kind of 80nmol/L of dNTPs (10mmol/L 0.5 μ L)
DNA sample 50ng (2 μ L)
LAMP amplification program: 1., be inserted into immediately on ice with 95 ℃ of sex change of template DNA 5 minutes; 2. 62 ℃ kept 60 minutes; 3. 80 ℃ kept 2 minutes.
3. detected sample purpose LAMP amplification and electrophoretic examinations
The LAMP product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose.Electrophoresis result is observed under uv analyzer, and positive findings should be to be the band that scalariform distributes.And spacing is (accompanying drawing, a swimming lane 5) about 160bp, is the accuracy that guarantees to detect, and the product of amplification carries out enzyme with Bgl I and Xba I respectively and cuts.
Embodiment 3: patient's sample 3
1.DNA extracting
The doubtful bacterium colony of picking joins vibration mixing in the 0.4mLTE damping fluid (pH8.0).Add Proteinase K solution 10 μ L in 55 ℃ of insulations 1-2 hour.Add with the saturated phenol of volume Tris (pH8.0), strong vibration, 8000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting.Get supernatant liquor, add the sodium acetate (3mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, centrifugal 5 minutes of following 12000 rev/mins of room temperature, abandon supernatant, add 50 μ LTE solution, put-20 ℃ of preservations.
2) ring mediated isothermal amplification (LAMP)
Add following reagent in PCR reagent pipe, making cumulative volume is 25 μ L:
10 * reaction buffer (2.5 μ L)
(200mmol/L?Tris-HCl(pH?8.8)，100mmol/L?KCl，100mmol/L(NH
4)
2SO
4，20mmol/LMgSO
4，1％Triton?X-100)
Bst archaeal dna polymerase 8U (1 μ L)
FIP 40pmol(4μL)
BIP 40pmol(4μL)
F3 5pmol(0.5μL)
B3 5pmol(0.5μL)
Every kind of 80nmol/L of dNTPs (10mmol/L 0.5 μ L)
DNA sample 50ng (2 μ L)
LAMP amplification program: 1., be inserted into immediately on ice with 95 ℃ of sex change of template DNA 5 minutes; 2. 62 ℃ kept 60 minutes; 3. 80 ℃ kept 2 minutes.
3. detected sample purpose LAMP amplification and electrophoretic examinations
The LAMP product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose.Electrophoresis result is observed under uv analyzer, and positive findings should be to be the band that scalariform distributes.And spacing is (accompanying drawing, a swimming lane 6) about 160bp, is the accuracy that guarantees to detect, and the product of amplification carries out enzyme with Bgl I and Xba I respectively and cuts.
Sequence list
SEQUENCE?LISTING
Claims (2)
1. test kit that utilizes loop-mediated isothermal amplification technique to detect Aeromonas caviae is characterized in that it comprises the activity of following composition and each composition:
(1) specific oligonucleotide primer: FIP, BIP, F3, B3, (each primer concentration is 5-15 μ mol/L);
FIP：5’AGGCCCGCCGAGGCTGCGATTTTAGCGATAACAACGTTGA3’
BIP：5’AATAAAGCATGATTTTCGTTTTTCCGTGAGAAGGGCGGTGTC3’
F3：?5’AAGTTCGTTACCCAATGTAGAG3’
B3：?5’CCCTTCTACCGCCGTGCAAG3’
(2) DNA extraction reagent: TE damping fluid (pH 8.0 for 5-15mmol/L Tris, 0.5-1.5mmol/L EDTA); Proteinase K solution (concentration 10-20mg/mL, pH8.0); The saturated phenol of Tris (pH8.0); Sodium acetate (concentration 2-5mol/L); Ethanol (concentration 95%);
(3) PCR reagent pipe composition is:
10 * reaction buffer (200mmol/L Tris-HCl (pH 8.8), 100mmol/L KCl, 100mmol/L (NH
4)
2SO
4, 20mmol/L MgSO
4, 1%Triton X-100)
(4) dNTPs (dCTP, the mixture of dGTP, every kind of concentration is 5-15mmol/L for dATP, dTTP);
(5) distilled water;
(6) BstDNA polysaccharase (8u/ μ L).
2. according to the described a kind of test kit that utilizes loop-mediated isothermal amplification technique to detect Aeromonas caviae of claim 1, it is characterized in that it is as follows that this test kit detects using method:
(1) DNA extracting
Picking bacterium colony to be detected joins vibration mixing in the 0.4mL TE damping fluid (pH8.0).Add Proteinase K solution 10 μ L in 55 ℃ of insulations 1-2 hour, add with the saturated phenol of volume Tris (pH8.0), strong vibration, 8000 rev/mins centrifugal 3 minutes, get supernatant liquor, repeat the phenol extracting; Get supernatant liquor, add the sodium acetate (3mol/L) of 0.1 times of volume, mixing adds isopyknic ice ethanol again, stand at low temperature is 30 minutes behind the mixing, 12000 rev/mins centrifugal 5 minutes, abandon supernatant, add 70% cold washing with alcohol once, centrifugal 5 minutes of following 12000 rev/mins of room temperature, abandon supernatant, add 50 μ LTE solution, put-20 ℃ of preservations;
(2) ring mediated isothermal amplification (LAMP)
Add following reagent in PCR reagent pipe, making cumulative volume is 25 μ L:
The PCR reaction system:
10 * reaction buffer (2.5 μ L)
(200mmol/L?Tris-HCl(pH?8.8)，100mmol/L?KCl，100mmol/L(NH
4)
2SO
4，20mmol/LMgSO
4，1％Triton?X-100)
Bst archaeal dna polymerase 8U (1 μ L)
FIP 40pmol(4μL)
BIP 40pmol(4μL)
F3 5pmol(0.5μL)
B3 5pmol(0.5μL)
Every kind of 80nmol/L of dNTPs (10mmol/L 0.5 μ L)
DNA sample 50ng (2 μ L)
Distilled water 10 μ L
The LAMP amplification program:
1. with 95 ℃ of sex change of template DNA 5 minutes, be inserted into immediately on ice;
2. 62 ℃ kept 60 minutes;
3. 80 ℃ kept 2 minutes;
(3) electrophoretic examinations
The LAMP product carries out using ethidium bromide staining behind the electrophoresis with 1.5% sepharose, and electrophoresis result is observed under uv analyzer, and positive findings should be to be the band that scalariform distributes, and spacing is about 160bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100523210A CN101235411A (en) | 2008-02-26 | 2008-02-26 | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100523210A CN101235411A (en) | 2008-02-26 | 2008-02-26 | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101235411A true CN101235411A (en) | 2008-08-06 |
Family
ID=39919317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100523210A Pending CN101235411A (en) | 2008-02-26 | 2008-02-26 | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101235411A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002523A (en) * | 2009-09-03 | 2011-04-06 | 通威股份有限公司 | Method and detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria |
| CN106701994A (en) * | 2017-02-20 | 2017-05-24 | 中国水产科学研究院淡水渔业研究中心 | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer |
| CN107338314A (en) * | 2017-08-09 | 2017-11-10 | 集美大学 | Stopped pipe visualization eel source Aeromonas hydrophila loop-mediated isothermal amplification detection method |
| CN110093430A (en) * | 2019-01-30 | 2019-08-06 | 宁波大学 | It is a kind of for detecting the high-throughput quantification detection kit of bathing beach pathogenic bacteria |
-
2008
- 2008-02-26 CN CNA2008100523210A patent/CN101235411A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002523A (en) * | 2009-09-03 | 2011-04-06 | 通威股份有限公司 | Method and detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria |
| CN102002523B (en) * | 2009-09-03 | 2012-08-15 | 通威股份有限公司 | Method and detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria |
| CN106701994A (en) * | 2017-02-20 | 2017-05-24 | 中国水产科学研究院淡水渔业研究中心 | Double PCR (Polymerase chain reaction) primer for simultaneous detection of Klebsiella pneumoniae and Aeromonas caviae and detection method of double PCR primer |
| CN107338314A (en) * | 2017-08-09 | 2017-11-10 | 集美大学 | Stopped pipe visualization eel source Aeromonas hydrophila loop-mediated isothermal amplification detection method |
| CN107338314B (en) * | 2017-08-09 | 2020-08-25 | 集美大学 | Closed-tube visual eel-derived aeromonas hydrophila loop-mediated isothermal amplification detection method |
| CN110093430A (en) * | 2019-01-30 | 2019-08-06 | 宁波大学 | It is a kind of for detecting the high-throughput quantification detection kit of bathing beach pathogenic bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102140512B (en) | LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila | |
| CN101153342B (en) | Primer group and detection reagent kit for detection of group A type G3 rotavirus | |
| CN102367475B (en) | M-PCR (multiplex-polymerase chain reaction) detection kit for different serotype vibrio cholerae and detection method thereof | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN111154900B (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN102154497B (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN101113473A (en) | Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique | |
| CN101348835B (en) | Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology | |
| CN101235411A (en) | Kit for detecting guinea pig aeromonas by utilizing Loop-mediated isothermal amplification technique | |
| CN101333557B (en) | Simultaneous quantitative determination process for various enteric pathogenic bacteria in environment water body example | |
| CN102925548A (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| Bölske et al. | Diagnosis of paratuberculosis by PCR. | |
| CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| CN101153341B (en) | Primer, detection method and detection reagent kit for detecting type G2 norovirus | |
| CN101748197A (en) | Target sequence for detection of yersinia enterocolitica and kit | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN1904064B (en) | Star shaped nocardia multiple PCR fast detection kit and detection method | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN113493846B (en) | Citrus flavedo virus molecular fluorescence RAA detection primer probe set, kit and method | |
| CN116162731B (en) | Rolling ring amplification primer group for Larix Gmelini based on lock probe and application | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20080806 |