CN118147314A - A method for detecting and identifying the snails of the genus Polymorpha by PCR - Google Patents

Abstract

The invention belongs to the field of detection and identification of molecular biology, and particularly relates to a method for detecting and identifying marsh snails by PCR. The invention provides a molecular marker of the marsh snail, which comprises a sequence with at least 95%, 96%, 97%, 98%, 99% and 100% homology with SEQ ID NO. 1. The molecular marker is detected, the specificity is high, and the reliability of the result is fully ensured. When the traditional taxonomic method is difficult to identify the marsh snail and other bean snails, the invention uses the molecular biological technology to make up, thereby obtaining a PCR method for rapidly and accurately detecting and identifying the marsh snail. The practicality is strong, can satisfy the needs that carries out quick reliable detection and authentication to the marsh snail. The invention provides a new technical means for the detection and identification of the marsh snails, and has important significance for preventing the transmission and the spread of parasite diseases of the marsh snail intermediate host.

Description

A method for detecting and identifying the snails of the genus Polymorpha by PCR

Technical Field

The invention belongs to the field of molecular biological detection and identification, and specifically relates to a PCR detection and identification method for Marsh Snails.

Background technique

Parafossarulus striatulus (also known as Parafossarulus manchouricus) is a dominant species in shallow grass lakes. Parafossarulus striatulus belongs to the genus Parafossarulus in the class Gastropoda of the order Mesogastropoda of the family Bithyniidae of the phylum Mollusca. Parafossarulus striatulus is an important first intermediate host of Clonorchis sinensis in my country. It lives in a wide range of streams, lakes, ponds and rice fields. The eggs of Clonorchis sinensis can gradually develop into adults through the first intermediate host, the striatulus snail, the second intermediate host, fish and shrimp, and the final host, humans and cats, and then damage the liver of the final host, causing bile duct epithelial hyperplasia, obstructive jaundice, gallstones, cholecystitis and cholangitis, and even cirrhosis and bile duct cancer.

The study of the classification of intermediate host snails has practical significance for the prevention and control of Clonorchiasis sinensis and the biological research of snails. At present, some similar species of snails in the family of Myrmecophaga are difficult to distinguish, and it is difficult to identify species by combining morphological methods such as external morphology and internal anatomy. Therefore, a molecular biological identification method is needed to assist the morphological identification method to complete the identification of the Marsh Snail.

Summary of the invention

The purpose of the first aspect of the present invention is to provide a molecular marker.

The second aspect of the present invention aims to provide an application.

The third aspect of the present invention aims to provide a product.

The fourth aspect of the present invention aims to provide a reagent or a kit.

The purpose of the fifth aspect of the present invention is to provide the use of the product of the third aspect of the present invention and/or the reagent or kit of the fourth aspect of the present invention.

The sixth aspect of the present invention aims to provide a method.

In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

The first aspect of the present invention provides a group of molecular markers of the snail, characterized in that:

The molecular marker comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% homology to SEQ ID NO: 1; the base sequence of SEQ ID NO: 1 is: CGGGTGTCAGGCCTTTAGTTGGCGACTGG CGGGTCGGCTGCGAGCGTCCTAAGAGTCGGGTTGTTTGGGAATGCAGCCCAAAGCAGGTGGTAAACTCCATCTAAGGCTAAATACTGGCACGAGTCCGATAGCGGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGTTCAACAGTACGTGAAACCGCCTAGAGGTAAACGGGTGGATCCGCAAA (5'-3').

The second aspect of the present invention provides the use of a substance for detecting a molecular marker according to the first aspect of the present invention in at least one of (a1) to (a6):

(a1) Identification of the snail;

(a2) preparing products for identifying the Maresmea striata;

(a3) screening of Polystichum striata;

(a4) screening products of the Polypodium vulgare;

(a5) Detection of the snail;

(a6) preparing a product for detecting the snail.

Preferably, the substance comprises a substance related to one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip method, and nucleic acid sequencing method.

Preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, and a system.

The third aspect of the present invention provides a product comprising a substance for detecting the molecular marker of the first aspect of the present invention.

Preferably, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip, and nucleic acid sequencing.

Preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, and a system.

Preferably, the product comprises a primer pair for amplifying the molecular marker according to claim 1.

Preferably, the product may further comprise a probe for detecting the molecular marker according to claim 1.

Preferably, the sequence of the primer pair for amplifying the molecular marker described in claim 1 is as shown in SEQ ID 2 and 3; the base sequence of SEQ ID NO: 2 is: CGGGTGTCAGGCCTTTAGTT (5’-3’); the base sequence of SEQ ID NO: 3 is: TTTGCGGATCCACCCGTTTA (5’-3’).

The fourth aspect of the present invention provides a reagent or kit comprising the primer pair and/or probe of the third aspect of the present invention.

Preferably, the kit further comprises at least one of Taq DNA polymerase, dNTP, PCR buffer, and Mg ²⁺ .

A fifth aspect of the present invention provides use of any one of (1) to (2) in any one of (b1) to (b3);

(1) The product according to any one of claims 3 to 4;

(2) The reagent or kit according to any one of claims 5 to 6;

(b1) Identification of the snails;

(b2) Screening of Polystichum striata;

(b3) Detection of the snail.

The sixth aspect of the present invention provides a method according to any one of (c1) to (c3):

(c1) A method for identifying the snail, comprising detecting whether the genome of a snail sample to be tested contains the molecular marker described in claim 1; if the genome of the snail sample to be tested contains the molecular marker described in claim 1, the snail sample is the snail; otherwise, it is not;

(c2) A method for screening the snails, comprising detecting whether the genome of the snail sample to be tested contains the molecular marker according to claim 1, and selecting the snail sample whose genome contains the molecular marker according to claim 1;

(c3) A method for detecting the snail, detecting whether the genome of the sample to be tested contains the molecular marker described in claim 1, if the genome of the sample to be tested contains the molecular marker described in claim 1, then the sample to be tested contains the snail; otherwise, it does not contain it.

Preferably, the method for detecting whether the genome of the snail sample to be tested contains the molecular marker according to claim 1 is: mixing the DNA of the sample to be tested with the primer pair and/or probe in the reagent or kit according to claim 5 or 6, and performing PCR detection.

Preferably, the final concentration of the primer pair is 100-300 nM.

Preferably, the annealing temperature in the PCR reaction procedure is 50-60°C.

The beneficial effects of the present invention are:

The present invention provides a molecular marker of Marsh Snail, which comprises a sequence with at least 95%, 96%, 97%, 98%, 99%, and 100% homology to SEQ ID NO.1. The molecular marker is used for detection, and the specificity is high, and the reliability of the result is fully guaranteed. When traditional taxonomic methods are difficult to identify Marsh Snail and other bean snails, the present invention uses molecular biological technology to make up for it, thereby obtaining a PCR method for rapid and accurate detection and identification of Marsh Snail. It is highly practical and can meet the needs of rapid and reliable detection and identification of Marsh Snail. The present invention provides a new technical means for the detection and identification of Marsh Snail, which is of great significance for preventing the transmission and spread of parasitic diseases with Marsh Snail as an intermediate host.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 is a specificity test result of a specific primer pair of the present invention, wherein: M is a 1000 bp DNA ladderMarker; lanes 1-2 are the test results of Parafossarulus striatulus samples; lanes 3-4 are the test results of Pomacea canaliculata samples; and lanes 5-6 are the test results of Pomacea serrata.

Detailed ways

The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

The primer pairs used in the present invention were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.

Example 1 Primer Design

The present invention screens specific molecular markers from Parafossarulus manchouricus, compares sequences with other snails, searches for specific molecular markers, and finally finds that the partial sequences of 788 large subunit ribosomal RNA genes of Parafossarulus cf.manchouricus BS-2022 have specificity: CGGGTGTCAGGCCTTTAGTTGGCGACTGGCGGGTCGGCTGCGAGCGTCCTAAGAGTCGGGTTGTTTGGGAATGCAGCCCAAAGCAGGTGGTAAACTCCATCTAAGGCTAAATACTGGCACGAGTCCGATAGCGGACAAGTACCGTGAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAACAGTACGTGAAACCGCCTAGAGGTAAACGGGTGGATCCGCAAA (5'-3', SEQ ID NO.1). The NCBI website is used to assist in designing and analyzing primers. After the specificity is tested by NCBIBlast, the optimal primers determined are as follows:

Forward primer: Sequence (5' to 3'): CGGGTGTCAGGCCTTTAGTT (SEQ ID NO. 2);

Reverse primer: Sequence (5' to 3'): TTTGCGGATCCACCCGTTTA (SEQ ID NO. 3).

The amplified fragment size of this primer pair is 226 bp.

Example 2 PCR primer specificity test of the snail

1. Material preparation

The snails tested were: Pomfret, Pomacea canaliculata, and Pomfretida, two of each type.

The above test snails were collected through field surveys of parasites and kept in a laboratory with dechlorinated water for future use. The above snails purchased conventionally on the market can also achieve the effects of the present invention.

2. DNA Extraction

The sample genomic DNA was extracted using a kit extraction method (FlaPureAnimalTissue/Cell/BloodDNAExtractionKit High-Efficiency Animal Tissue/Cell/Blood Genomic DNA Extraction Kit from Beijing Jinsha Biotechnology Co., Ltd.). The specific steps are as follows:

1) Take a prepared snail sample, rinse it with clean water and wipe off the dust on its surface, rinse it again with 75% ethanol and wipe off the surface of the snail, then cut open the snail shell with scissors and tweezers disinfected with 75% ethanol, carefully remove the muscle tissue part, put it in 1*PBS buffer solution to wash several times, wipe off the surface moisture and put it in a sample freezing tube for later use.

2) Place the muscle tissue removed in the previous step into a mortar and grind it with liquid nitrogen. Place the ground sample in a 1.5 mL centrifuge tube and add 200 μL Buffer GA1.

3) Add 20 μL Proteinase K (20 mg/mL), vortex and oscillate to mix thoroughly, and fully lyse in a 56°C water bath for 3 h. During this period, invert or oscillate several times to disperse the sample.

4) Add 200 μL Buffer GA2, vortex and mix thoroughly, and place in a 70°C water bath for 10 min. After a brief centrifugation, add 200 μL anhydrous ethanol and immediately vortex and mix thoroughly to obtain a solution and flocculent precipitate.

5) Centrifuge briefly, add all the solution and flocculent precipitate obtained in the previous step to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

6) Add 500 μL Buffer GW1 (anhydrous ethanol has been added according to the instructions) to the adsorption column, centrifuge at 12,000 rpm for 30 s, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

7) Add 600 μL Buffer GW2 (anhydrous ethanol has been added according to the instructions) to the adsorption column, centrifuge at 12,000 rpm for 30 s, pour out the waste liquid in the collection tube, put the adsorption column back into the collection tube, and repeat this step once.

8) Centrifuge at 12,000 rpm for 2 min, and leave to dry at room temperature for 2 min with the lid open.

9) Place the adsorption column in a new centrifuge tube (self-prepared), add 50 μL ddH ₂ O to the middle of the adsorption membrane, place at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, collect the DNA solution, and store the DNA at -20°C.

3. PCR amplification reaction

The total volume of the PCR reaction system is 50 μL, including 25 μL of 2xTransStarfFastPfuFlyPCRSuperMix, 1 μL of upstream and downstream primers (0.4 μM), 2 μL of DNA template (1 ng/μL), and the rest is made up with sterile ddH2O. After mixing, it is placed in a PCR amplifier for amplification.

The PCR amplification reaction program was as follows: pre-denaturation at 98°C for 1 min; 35 cycles of 98°C for 10 s, 55°C for 5 s, and 72°C for 1 min; extension at 72°C for 1 min, and termination of the reaction at 4°C.

4. PCR product detection and identification

Take 9 μL of the PCR product and run it on a 1.5% agarose gel (containing ethidium bromide) at 130 V for about 30 minutes, and observe it with a gel imager. If a band is observed at the position of 226 bp, it means that the bean snail sample detected is the schizont.

As shown in Figure 1, the test results showed that only the product amplified by the primers of the Marsh Snail amplified a bright band at the position of 226bp, while the primers could not amplify bands for the other two snails: Pomacea canaliculata and Pomacea quadrilateral. This shows that the primers have good specificity and can identify Marsh Snail in morphologically similar snail samples.

Claims (10)

1. Molecular marker of marsh snail, its characterized in that:

The molecular marker comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 100% homology with SEQ ID NO. 1.

2. Use of a substance for detecting a molecular marker according to claim 1 in at least one of (a 1) to (a 6):

(a1) Identifying the biogas digester;

(a2) Preparing a product for identifying the biogas digester;

(a3) Screening the biogas digester;

(a4) Preparing a biogas digester screening product;

(a5) Detecting the biogas digester;

(a6) Preparing a biogas digester detection product;

Preferably, the substance comprises a substance that is associated with one or more detection techniques or methods selected from the group consisting of: northern blotting, PCR, biochip, and nucleic acid sequencing;

preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, a system.

3. A product comprising a substance that detects the molecular marker of claim 1.

4. A product according to claim 3, characterized in that:

the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: northern blotting, PCR, biochip, and nucleic acid sequencing;

preferably, the product comprises at least one of a reagent, a kit, a test paper, a chip, a system;

Preferably, the product comprises a primer pair for amplifying the molecular marker of claim 1;

preferably, the sequences of the primer pairs for amplifying the molecular markers of claim 1 are shown in SEQ ID 2 and 3.

5. A reagent or kit comprising the primer pair of claim 4.

6. The kit of claim 5, wherein: the kit also comprises at least one of Taq DNA polymerase, dNTP, PCR buffer solution and Mg ²⁺.

7. (1) The use of any one of (b 1) to (b 3) in any one of (2);

(1) A product as claimed in any one of claims 3 to 4;

(2) The reagent or kit of any one of claims 5 to 6;

(b1) Identifying the biogas digester;

(b2) Screening the biogas digester;

(b3) And detecting the biogas digester.

8. (C1) The method of any one of (c 3):

(c1) A method for identifying a mollusk, detecting whether the genome of a sample of the mollusk to be detected contains the molecular marker of claim 1, and if the genome of the sample of the mollusk to be detected contains the molecular marker of claim 1, the sample of the mollusk is the mollusk; otherwise, not;

(c2) A method for screening the marsh snails, detecting whether the genome of a sample to be detected contains the molecular marker of claim 1, and selecting a sample containing the molecular marker of claim 1;

(c3) A method for detecting the biogas digester, detecting whether the genome of a sample to be detected contains the molecular marker of claim 1, and if the genome of the sample to be detected contains the molecular marker of claim 1, the sample to be detected contains the biogas digester; otherwise, it does not.

9. The method according to claim 8, wherein:

the method for detecting whether the genome of the to-be-detected spiro sample contains the molecular marker of claim 1 comprises the following steps: mixing the DNA of the sample to be tested with the primer pair in the reagent or the kit according to claim 5 or 6, and performing PCR detection.

10. The method according to claim 9, wherein:

The final concentration of the primer pair is 100-300nM;

preferably, the annealing temperature in the reaction procedure of the PCR is 50-60 ℃.