CN113913301A - Trichoderma harzianum, microbial inoculum and application thereof - Google Patents
Trichoderma harzianum, microbial inoculum and application thereof Download PDFInfo
- Publication number
- CN113913301A CN113913301A CN202111347777.1A CN202111347777A CN113913301A CN 113913301 A CN113913301 A CN 113913301A CN 202111347777 A CN202111347777 A CN 202111347777A CN 113913301 A CN113913301 A CN 113913301A
- Authority
- CN
- China
- Prior art keywords
- ginseng
- trichoderma
- soil
- strain
- cfu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/38—Trichoderma
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K17/00—Soil-conditioning materials or soil-stabilising materials
- C09K17/14—Soil-conditioning materials or soil-stabilising materials containing organic compounds only
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K2101/00—Agricultural use
Abstract
The invention discloses trichoderma harlequin, a microbial inoculum and application thereof, and relates to the technical field of ginseng planting in farmlands. The trichoderma can be used for preparing a microbial agent, and can also be used for improving the ginseng planting farmland soil to improve the biological abundance of the soil, so that the trichoderma can adjust a rhizosphere micro-ecosystem and protect the microbial population structure of the soil. After trichoderma is applied, the cultivation environment of the existing ginseng is greatly improved, and the yield and the quality of the ginseng are improved. In addition, trichoderma harzianum provided by the invention can prevent and treat main diseases of ginseng and has a certain growth promoting effect on ginseng. The trichoderma screened by the method lays a good foundation for sustainable development of the ginseng industry.
Description
Technical Field
The invention relates to the technical field of farmland ginseng planting, in particular to trichoderma harzianum, a microbial inoculum and application thereof.
Background
At present, the problems of deterioration of soil physicochemical properties, increase of heavy metal and pesticide residues, accumulation of allelochemicals, imbalance of rhizosphere micro-ecological systems, nutrient deficiency, soil-borne diseases and the like exist in farmland ginseng planting. Although the soil conditioner formed by combining various substances such as bacillus, multi-vitamin, aspergillus oryzae, trace elements and the like can improve the soil environment for the growth of ginseng to a certain extent, the soil conditioner can promote the growth and development of ginseng and increase the yield by applying easily-consumed nutrient elements such as phosphorus, potassium, iron, boron, manganese and the like in cooperation with a plant growth regulator and spraying the soil conditioner at each stage of the growth of ginseng. However, the problems of high application cost, excessive application of phosphate fertilizer, potash fertilizer and the like still exist, and the problems that the mixing proportion is complex in the actual ginseng planting process and the agricultural popularization is not facilitated and the like still exist.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide trichoderma harzianum, a microbial inoculum and application thereof to solve the technical problems.
The invention is realized by the following steps:
the invention provides trichoderma harzianum, which is preserved in a microorganism strain preservation center at the preservation address: the preservation date of No. 3 Xilu Beijing Xiyang district, China academy of sciences, microbial research institute is as follows: 2021, 8/19, with a deposit number: CGMCC No.23211, the taxonomic name of the strain is Trichoderma Trichoderma velutinum.
In a preferred embodiment of the present invention, the above trichoderma harzianum exists in one of three forms, conidium, mycelium, conidium-containing form and mycelium.
In a preferred embodiment of the present invention, the above trichoderma is characterized by the following colony culture: culturing on a PDA (personal digital assistant) flat plate for 7 days, wherein the diameter of a bacterial colony is 80-90mm, white aerial hyphae are thin, 1-2 ring grains appear in the bacterial colony, the ring grains are initially white and then gradually become yellow, and the edges of the bacterial colony are green; the resulting conidial clusters, villous in appearance; conidia are mostly clustered, oval and yellow, and have the diameter of (3-4.2) mum multiplied by (1.5-2.6) mum; conidiophores are mostly opposite, branches at the top end are in acute angles or right angles, and sharp phialides are directly generated at the top end.
The invention provides a microbial inoculum which comprises trichoderma and/or spores generated after fermentation of the trichoderma.
In a preferred embodiment of the present invention, the form of the microbial agent is selected from any one of the following:
resuspended spore suspensions, powders, granules and water dispersible granules.
The invention also provides application of trichoderma harlequin or microbial inoculum in inhibiting ginseng pathogenic bacteria.
In a preferred embodiment of the present invention, the pathogenic bacteria of ginseng are selected from at least one of the following: ginseng black spot (alterna panax), ginseng Sclerotinia schiniflora (sclerotiniobacillus), ginseng anthracnose (Colletotrichum paniculatum), ginseng rust rot (illonectria robusta) and ginseng root rot (Fusarium oxysporum).
In the preferred embodiment of the application of the invention, trichoderma is prepared into liquid, emulsion or suspension for use;
in an alternative embodiment, the amount of liquid, emulsion or suspension is 3X 108cfu/strain-9X 108cfu/strain.
In the preferred embodiment of the present invention, trichoderma harosum is prepared into powder, granule, wettable powder, water dispersible granule or seed coating agent.
In aIn an alternative embodiment, the powder, granules, wettable powder, water dispersible granules or seed coating agent is used in an amount of 3 × 108cfu/strain-9X 108cfu/strain.
The invention also provides a ginseng soil conditioner which comprises the trichoderma or microbial inoculum.
In an alternative embodiment, the ginseng soil conditioner is mainly composed of trichoderma.
In an alternative embodiment, the ginseng soil conditioner contains trichoderma in an amount of 1 x 108cfu·ml-1～3×108cfu·ml-1。
The invention has the following beneficial effects:
the trichoderma is separated and screened, can be used for preparing a microbial agent, can also be used for improving the soil of ginseng planting farmland, and improves the biological abundance of the soil, and can be used for adjusting a rhizosphere micro-ecological system and protecting the microbial population structure of the soil. After trichoderma is applied, the nutrients of farmland soil can be increased, the existing ginseng cultivation environment is greatly improved, and the yield and the quality of ginseng are improved. In addition, the inventor researches and discovers that trichoderma can prevent and treat main diseases of ginseng and has a certain growth promoting effect on ginseng. The trichoderma screened by the method lays a good foundation for sustainable development of the ginseng industry.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a culture diagram of the opposite of Tri401 and ginseng pathogenic bacteria;
FIG. 2 is a Tri401 phylogenetic tree;
FIG. 3 is a phylogenetic classification diagram of Tri401 treated soil bacteria at the phylum level;
FIG. 4 is a phylogenetic classification diagram of Tri401 treated soil fungi at the phylum level;
FIG. 5 shows the growth of ginseng in control soil and Tri 401-treated soil;
FIG. 6 shows the growth of Panax quinquefolium in control soil and Tri 401-treated soil.
Detailed Description
Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.
The trichoderma harzianum is separated and screened, can be used for preparing a microbial agent, and can also be used for improving the ginseng planting farmland soil, so that the biological abundance of the soil is improved, the rhizosphere micro-ecosystem is adjusted, the nutrients of the farmland soil are increased, the existing ginseng planting environment is greatly improved, and the yield and the quality of ginseng are improved. In addition, the inventor researches and discovers that trichoderma can prevent and treat main diseases of ginseng and has a certain growth promoting effect on ginseng. The trichoderma screened by the method lays a good foundation for sustainable development of the ginseng industry.
The trichoderma is preserved in a microorganism strain preservation center, and the preservation address is as follows: west road No.1, north west of the morning area, beijing, institute of microbiology, china academy of sciences, date of deposit: 2021, 8/19, with a deposit number: CGMCC NO.23211, strain taxonomic name Trichoderma velutinum. The biomaterial name is Tri 401.
The trichoderma is present in one of three forms, conidium, mycelium, conidium-containing and mycelium.
In a preferred embodiment of the present invention, the above trichoderma is characterized by the following colony culture: culturing on a PDA (personal digital assistant) flat plate for 7 days, wherein the diameter of a bacterial colony is 80-90mm, white aerial hyphae are thin, 1-2 ring grains appear in the bacterial colony, the ring grains are initially white and then gradually become yellow, and the edges of the bacterial colony are green; a thin cluster of conidia is generated, and the appearance is villous; conidia are mostly clustered, oval and yellow, and have the diameter of (3-4.2) mum multiplied by (1.5-2.6) mum; conidiophores are mostly opposite, branches at the top end are in acute angles or right angles, and sharp phialides are directly generated at the top end.
The inventors designed primers and performed sequencing analysis on the rDNA-ITS sequences of the isolated strains. As shown by sequencing, the rDNA-ITS sequence of the strain has the length of 589bp, and the sequence is shown as SEQ ID NO. 1.
CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGAATCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTCCTCTTGCGGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA。
The inventors further performed sequence analysis using software such as BLAST and DNAMAN, and compared ITS sequences of the isolated strains by BLAST, and found similar strain sequences having very high homology in GenBank. The strain with the highest similarity to Tri401 strain is T.velutinum, and the homology reaches 100%. A phylogenetic tree is constructed by an UPGMA method according to MEGA6.06 software, and the genetic branch of the same genus of Tri401 and T.velutinum is found to be very close in genetic relationship. The results of morphological classification and molecular biological identification are combined, and the strain Tri401 separated by the method can be confirmed to be trichoderma.
Based on this, the inventors provide a microbial inoculum comprising trichoderma hare and/or spores produced after fermentation of trichoderma hare.
The form of the microbial inoculum includes, but is not limited to, the following types: resuspended spore suspensions, powders, granules and water dispersible granules. Such as emulsifiers, suspensions, etc.
The inventor proves that the trichoderma or the microbial inoculum can inhibit various pathogenic bacteria of the ginseng through pathogenic bacteria bacteriostasis experiments, and has good application prospect for disease control of the ginseng. Particularly, the trichoderma can be applied to the control of soil pathogenic bacteria of the ginseng field, especially the control of pathogenic fungi.
The above control means that after trichoderma or microbial inoculum is applied, at least one of the following phenomena of pathogenic bacteria of ginseng is shown in the protection scope of the invention: a decrease in the number of pathogenic bacteria, a decrease in the number of types of pathogenic bacteria, inhibition or no growth of pathogenic bacteria, and the like.
The application of trichoderma or microbial inoculum in inhibiting ginseng pathogenic bacteria comprises the following ginseng pathogenic bacteria:
ginseng black spot (alterna panax), ginseng Sclerotinia schiniflora (sclerotiniobacillus), ginseng anthracnose (Colletotrichum paniculatum), ginseng rust rot (illonectria robusta) and ginseng root rot (Fusarium oxysporum).
In another embodiment, the pathogenic bacteria may be rhizoctonia solani, phytophthora ginsenii or gray mold of ginseng.
In the preferred embodiment of the application of the invention, trichoderma is prepared into liquid, emulsion or suspension for use;
in an alternative embodiment, the amount of liquid, emulsion or suspension is 3X 108cfu/strain-9X 108cfu/strain.
In an alternative embodiment, the trichoderma mycelium or conidia thereof is dispersed in a solvent, emulsifier or other dispersion medium for root irrigation, root soaking, seed soaking or spraying. The emulsifier can be a cationic emulsifier, an anionic emulsifier, or a nonionic emulsifier.
In the preferred embodiment of the present invention, trichoderma harosum is prepared into powder, granule, wettable powder, water dispersible granule or seed coating agent. The powder, granules, wettable powder and water dispersible granules can be bacterial powder prepared by vacuum freeze drying or bacterial powder and bacterial granules prepared by spray drying. When in use, the bacterial powder is dissolved.
In an alternative embodiment, the powder, granules, wettable powder, water dispersible granules or seed coating is used in an amount of 3X 108cfu/strain-9X 108cfu/strain. Before use, the composition may be diluted as required.
The invention also provides a ginseng soil conditioner which comprises the trichoderma or microbial inoculum.
In an alternative embodiment, the ginseng soil conditioner is mainly composed of trichoderma.
In an alternative embodiment, the ginseng soil conditioner contains trichoderma in an amount of 1 x 108cfu·ml-1～3×108cfu·ml-1。
The situation that the soil after the ginseng soil conditioner provided by the invention is applied presents at least one of the following situations is within the improvement scope of the invention: soil moisture conditions are improved (e.g., improved soil hardening), soil organic matter is increased resulting in improved soil fertility, increased soil beneficial microorganism abundance, and increased ginseng yield and/or quality.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Potato dextrose agar medium (PDA) purchased from Qingdao haibo biotechnology limited, product number: HB 0233.
The culture solution for fermentation is Potato Dextrose Broth (PDB). The PDB culture medium comprises: 200g/L of potato, 10g/L of glucose and 1000ml of distilled water.
The temperature of the culture is 25 ℃, the time is 96h, and the condition is 180 r/min.
And filtering after fermentation to obtain spores.
Example 1
This example provides methods for screening, isolating and identifying Trichoderma reesei (Trichoderma velutinum) Tri401 strains.
The trichoderma is separated from ginseng rhizosphere soil in a ginseng planting base in the town of the left town of Jilin city, Jilin province.
Collecting Ginseng radix rhizosphere soil from Ginseng radix rhizosphere soil of Ginseng radix planting base of left town of Jilin city, Jilin province, diluting and coating with flat plate method, adding 10g Ginseng radix rhizosphere soil into conical flask containing 90mL sterile water, oscillating for 30min on 150r/min shaking table, sucking 1mL uniformly mixed soil suspension from conical flask, diluting with sterile water in gradient, and respectively diluting from 10-3、10-4、10-5Sucking 200 mu L of the three gradients, adding the three gradients to a PDA culture medium plate, uniformly coating the PDA culture medium plate, culturing the plate at 25 ℃ for 3d, and picking out trichoderma single colony hyphae on the plate and transferring the trichoderma single colony hyphae to the PDA culture medium for purification. The purified strain was stored at 4 ℃.
After the culture is carried out on a PDA (personal digital assistant) plate for 7 days, the diameter of a bacterial colony is about 90mm, white aerial hypha is thin, 1-2 ring grains appear in the bacterial colony, the bacterial colony is initially white and then gradually turns yellow, and the edge of the bacterial colony is green. Producing a thin cluster of conidia, villous in appearance. Conidia are mostly clustered, oval and yellow, and have the diameter of (3-4.2) mum multiplied by (1.5-2.6) mum; conidiophores are mostly opposite, branches at the top end are in acute angles or right angles, and sharp phialides are directly generated at the top end. According to the culture characteristics and morphological characteristics of the strain Tri401, preliminarily judging that the screened strain is Trichoderma velutinum.
The inventors performed sequencing analysis of the rDNA-ITS sequences of the isolated strains by using the universal primers ITS4/ITS 5. As shown by sequencing, the rDNA-ITS sequence of the strain has the length of 589bp, and the sequence is shown as SEQ ID NO. 1:
CGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGAATCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTCCTCTTGCGGGGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA。
the inventors further performed sequence analysis using software such as BLAST and DNAMAN, and compared ITS sequences of the isolated strains by BLAST, and found similar strain sequences having very high homology in GenBank. The strain with the highest similarity to Tri401 strain is T.velutinum, and the homology reaches 100%. According to MEGA6.06 software, a phylogenetic tree (shown in figure 2) is constructed by an UPGMA method, and the genetic branches of Tri401 and T.velutinum belong to the same genus, and the genetic relations are very close. Combining the results of morphological classification and molecular biological identification, the strain Tri401 of the present invention can be confirmed to be Trichoderma trichoderma.
Example 2
In this example, an antagonistic action experiment of trichoderma on pathogenic bacteria of ginseng was performed.
5 pathogenic bacteria of main diseases of ginseng are selected: the five strains of ginseng black spot pathogen (Alternaria panax), ginseng Sclerotinia sclerotiorum (Sclerotinia schinseng), ginseng Colletotrichum paniculatum (Colletotrichum paniculatum), ginseng rust rot pathogen (Ilyonactria robusta) and ginseng root rot pathogen (Fusarium oxysporum) are provided by medicinal plant cultivation teams of special Proc research institute of Chinese academy of agricultural sciences. Respectively transferring the preserved trichoderma Tri401 and the pathogenic bacteria strain to a PDA (personal digital assistant) plate, culturing for 7 days at a constant temperature of 25 ℃ in the dark, and punching a bacterial cake at the edge of a bacterial colony by using a 5mm puncher. Two-point opposite plate culture method is adopted, the two-point opposite plate culture method is respectively placed on two symmetrical sides of a PDA plate, the distance between fungus cakes is 3cm, only pathogenic bacteria are inoculated as a Control (CK), each treatment is repeated for 3 times, after inoculation, the two-point opposite plate culture method is placed in a constant temperature incubator at 25 ℃ for culture for 7d, and the diameter of a bacterial colony is observed and measured.
The inhibition rate calculation formula is as follows: the bacteriostatic ratio (%) - (control colony radius-treated colony radius)/control colony radius × 100%.
Referring to fig. 1, the control group and the opposing group are test pictures cultured for 7 days, the control pathogenic bacteria grow faster, trichoderma hyphae in the opposing culture quickly occupy the growth space, the antagonistic action on the pathogenic bacteria can be observed after the opposing culture is carried out for 3 days, and the growth of the pathogenic bacteria is obviously limited; after 7 days the pathogenic bacteria were surrounded by the trichoderma and occupied the entire dish, leaving the pathogenic bacteria almost non-growing. During the plate confronting culture process, the bacteriostasis rates of the strain Tri401 to ginseng sclerotinia sclerotiorum (S.schinseng), ginseng rust rot (I.robusta), ginseng root rot (F.oxysporum), ginseng anthracnose (C.panicola) and ginseng black spot germ (A.panax) are respectively 87.89%, 89.73%, 87.80%, 90.35% and 84.91%.
Example 3
In this example, a growth promotion effect experiment of trichoderma on ginseng cultivated in soil in farmland was performed.
In this example, the growth promoting effect of Trichoderma trichoderma Tri401 strain on ginseng was determined by a potting test.
The preparation method of the strain culture solution comprises the following steps:
activating test tube slant strain of Trichoderma Tri401, inoculating 25 mm fungus cakes into 100mL potato glucose liquid culture medium (PDB) bottled with 250mL triangle, and culturing at 25 deg.C at 170r/min for 48 hr to obtain seed solution; inoculating the trichoderma Tri401 seed liquid into a fermentation culture solution at a volume ratio of 10% for culture, and culturing at 25 ℃ for 96h at 170r/min to obtain a culture solution; filtering trichoderma Tri401 culture solution by 2 layers of sterile gauze, counting filtrate by a blood ball counting plate, dispersing spore suspension to 6 g.L-1Obtaining a spore suspension with the spore content of 1-3 multiplied by 10 in a sodium carboxymethylcellulose (CMC) solution8Per ml-1。
A preparation method of a potato dextrose liquid medium (PDB) comprises the following steps: 200g/L of potato, 10g/L of glucose and 1000mL of distilled water, and the pH value is 6.8-7.2. Filling 300mL of culture solution into a 1000mL triangular flask, sealing the triangular flask opening with a double-layer sealing film, performing moist heat sterilization at 121 ℃ for 30min, and cooling for later use.
The farmland soil (ordinary corn field soil without ginseng planting, impurities such as straw and stone are removed by a 20-mesh screen before use) is filled into flowerpots with the diameter of 20cm, and each pot is filled with 2kg of soil. Annual ginseng seedlings with consistent size and good growth are selected for transplanting, 6 plants are planted in each pot, and 4 pots are processed in each pot. The prepared trichoderma Tri401 spore suspension (the bacterial content is about 1-3 multiplied by 10)8cfu·ml-1) Diluting the solution by 10 times with sterile water, dipping the ginseng seedlings into roots by using Tri401 spore suspension, and irrigating the roots by using 30ml of Tri401 spore suspension after the cultivation of soil. The control group was given fresh PDB liquid medium.
And after the ginseng seedlings grow for 90 days, digging out the complete ginseng seedlings of the treatment group and the control group respectively, taking the root soil of each treated ginseng, extracting the total genome of the soil sample, and detecting the structural change of the soil microbial community. Observing and measuring various growth indexes of the ginseng.
The soil genomes of the Tri 401-treated group and the control group were subjected to 16S sequencing to obtain 1806 and 1683 OTUs, respectively. Wherein the bacteria of the treatment group comprises 32 phyla, 85 class, 180 order, 289 family and 467 genus, and the bacteria of the control group comprises 29 phyla, 81 class, 172 order, 278 family and 440 genus; the ITS1 sequenced group of fungi covers 11 phyla, 26 class, 61 order, 110 family and 183 genus, and the control group of fungi covers 9 phyla, 22 class, 54 order, 108 family and 190 genus. On the phylum level, the same three positions of the ginseng soil bacteria dominant flora of the treated group and the control group (FIG. 3) were sequentially Proteobacteria (32.068% -34.196%), Acidobacter (25.051% -26.409%), and Chloroflexi (7.098% -8.704%). However, the bacteria Actinobacillus, Verrucomicrobia, bacteriodes, Firmicutes, Patescibacteria differ in their position in the soil treated with the addition of Tri401 biological agents (FIG. 3). The bacterium Proteobacteria is a key microorganism treated by the Tri401, and the abundance of the bacterium is obviously higher than that of a control (P is less than 0.05) after the Tri401 biological agent is added.
At the phylum level, the soil fungal dominant flora of ginseng of the treatment group and the control group were ascomyca, wherein the position of Chytridiomycota was different in the two; the abundance of the fungus Mortierellomycota in the soil with the addition of the Tri401 biological agent was second place, while the fungus Basidiomycota in the control soil was second place (fig. 4).
From the results of the microbial diversity analysis, it is known that: bacterial Proteobacteria (Proteobacteria) and Mortierella mortierella are key microorganisms for Tri401 to improve the field cultivated ginseng.
Washing the whole ginseng plant to remove soil at the root, and measuring the fresh weight of the whole ginseng plant and the fresh weight index of the root. Then, the whole plant was dried at 105 ℃ to a constant temperature, and the dry weight of the whole plant and the dry weight of the root were measured, and the statistical results are shown in the following table.
| Treatment of | Fresh weight on ground (g) | Fresh weight of root (g) | Ground dry weight (g) | Root weight (g) | Rate of stock of seedlings |
| Tri401 | 0.85±0.09a | 1.92±0.20a | 0.19±0.02a | 0.55±0.06a | 83.3％ |
| CK | 0.9±0.05a | 1.56±0.12b | 0.15±0.02b | 0.36±0.05b | 50％ |
As can be seen from the above table, after one growth cycle of ginseng is finished, from the overall growth vigor of ginseng, the fibrous roots are developed, the seedling rate is 83.3%, and the seedling rate is 50% in the control group. The seedling storage rate can be effectively ensured by the root irrigation treatment of trichoderma. The fresh mass ratio CK of the ginseng processed by the Tri401 is increased by 12.60 percent, and the dry mass ratio CK of the ginseng is increased by 45.10 percent. The trichoderma harlequin 401 is beneficial to the accumulation of dry matters of the ginseng and has obvious growth promotion effect on the ginseng.
The invention screens and separates out a biocontrol trichoderma, applies the microbial inoculum in the process of planting ginseng by farmland soil, plants ginseng seedlings, can effectively ensure the seedling storage rate, and has remarkable growth promotion effect on the growth of roots, stems and leaves of ginseng. The trichoderma harzianum provided by the invention can prevent and treat main diseases of ginseng and has a certain growth promoting effect on ginseng. The trichoderma screened by the method lays a good foundation for sustainable development of the ginseng industry.
Example 4
In this example, experiments on the control effect of trichoderma on ginseng blight were performed.
The ginseng leaf blight is mainly characterized in that ginseng is planted in soil of a farmland, after leaves expand and flower in a growing period, leaves are withered and curled from leaf tips or edges, gradually spread to a main leaf vein and a leaf stalk, tend to expand from old leaves to new leaves, and finally the whole plant is withered and dead in the ground. Seriously affecting plant photosynthesis, resulting in drastic decrease in ginseng yield and quality.
The experimental procedure was as in example 3.
The results show (fig. 5): the control group shows withered leaf tips and edges, namely ginseng withered leaf disease, and the symptoms of the ginseng withered leaf disease of the treatment group added with the Tri401 hardly appear or are relieved, which shows that the Tri401 can effectively relieve the occurrence of the farmland soil-planted ginseng withered leaf disease.
Example 5
In this example, an experiment of the effect of trichoderma on controlling panax quinquefolius blight was performed.
The American ginseng leaf blight is similar to the occurrence situation of ginseng leaf blight, and because the American ginseng leaf blight is planted in farmland soil, after the leaves expand and bloom in the growth period, the leaves are withered and curled from the leaf tips or edges, gradually spread to the main leaf vein and the leaf stalks, the trend is expanded from old leaves to new leaves, and finally the whole plant is partially withered on the ground. Seriously affecting the photosynthesis of the plant, resulting in the decrease of the yield of the American ginseng.
Selecting a land block for soil culture of American ginseng in a farmland as a test base, setting the area of a treatment cell to be 1.5m multiplied by 1.5m, and repeating the treatment for 3 times; applying trichoderma 401 spore suspension to irrigate roots in 5-month late ten days, wherein the spore suspension (the bacterial content is about 1-3 multiplied by 10)8cfu·ml-1) After 10 times of dilution, the diluted solution is applied once at intervals of 10-15 days for 3 times. And observing the growth condition of the American ginseng.
The results of the survey showed (fig. 6): the control group without any treatment has dry leaf tips and edges, namely American ginseng leaf blight, and the disease degree of the leaf blight of the Tri401 treatment group is obviously lower than that of the control group. The Tri401 can effectively relieve the occurrence of American ginseng leaf blight.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> institute of specialty products of Chinese academy of agricultural sciences
<120> trichoderma harosum, microbial inoculum and application thereof
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 589
<212> DNA
<213> Artificial sequence
<400> 1
cggagggatc attaccgagt ttacaactcc caaacccaat gtgaacgtta ccaaactgtt 60
gcctcggcgg gatcttctgc cccgggtgcg tcgcagcccc ggaccaaggc gcccgccgga 120
ggaatcaacc aaaactctta ttgtataccc cctcgcgggt ttttttataa tctgagcctt 180
ctcggcgcct ctcgtaggcg tttcgaaaat gaatcaaaac tttcaacaac ggatctcttg 240
gttctggcat cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca 300
gtgaatcatc gaatctttga acgcacattg cgcccgccag tattctggcg ggcatgcctg 360
tccgagcgtc atttcaaccc tcgaacccct ccggggggtc ggcgttgggg atcggccctc 420
ctcttgcggg ggccgtctcc gaaatacagt ggcggtctcg ccgcagcctc tcctgcgcag 480
tagtttgcac actcgcatcg ggagcgcggc gcgtccacag ccgttaaaca cccaacttct 540
gaaatgttga cctcggatca ggtaggaata cccgctgaac ttaagcata 589
Claims (10)
1. Trichoderma harzianum, which is preserved in the culture collection of microorganisms at the following preservation address: the collection number of the microbial research institute of the Chinese academy of sciences, No. 3 Xilu-Beijing province, Chaoyang, and the collection number is: CGMCC No.23211, the taxonomic name of the strain is Trichoderma Trichoderma velutinum.
2. The trichoderma reesei of claim 1, wherein the trichoderma reesei exists in one of conidia, mycelium, conidia-containing and mycelium-containing forms.
3. The trichoderma of claim 1 or 2, wherein a colony culture characteristic of the trichoderma is: culturing on a PDA (personal digital assistant) flat plate for 7 days, wherein the diameter of a bacterial colony is 80-90mm, white aerial hyphae are thin, 1-2 ring grains appear in the bacterial colony, the ring grains are initially white and then gradually become yellow, and the edges of the bacterial colony are green; the resulting conidial clusters, villous in appearance; conidia are mostly clustered, oval and yellow, and have the diameter of (3-4.2) mum multiplied by (1.5-2.6) mum; conidiophores are mostly opposite, branches at the top end are in acute angles or right angles, and sharp phialides are directly generated at the top end.
4. A microbial preparation comprising Trichoderma reesei according to any one of claims 1 to 3 and/or spores produced by fermentation of said Trichoderma reesei.
5. The microbial inoculum according to claim 4, wherein the form of the microbial inoculum is selected from any one of the following forms:
resuspended spore suspensions, powders, granules and water dispersible granules.
6. Use of trichoderma as claimed in any one of claims 1 to 3 or a bacterial agent as claimed in any one of claims 4 to 5 for inhibiting a pathogenic bacterium ginseng.
7. The use of claim 6, wherein the ginseng pathogenic bacteria are selected from at least one of: ginseng black spot (alterna panax), ginseng Sclerotinia schiniflora (sclerotiniobacillus), ginseng anthracnose (Colletotrichum paniculatum), ginseng rust rot (illonectria robusta) and ginseng root rot (Fusarium oxysporum).
8. The use according to claim 6, wherein the Trichoderma trichoderma harzianum is used in the form of a liquid, emulsion or suspension;
preferably, the liquid, emulsion or suspension is used in an amount of 3X 108cfu/strain-9X 108cfu/strain.
9. The use according to claim 6, wherein the trichoderma is used in the form of a powder, granules, wettable powder, water dispersible granules or seed coating agent;
preferably, the powder, the granule, the wettable powder and the water dispersible granuleOr the seed coating agent is used in an amount of 3X 108cfu/strain-9X 108cfu/strain.
10. A ginseng soil conditioner, characterized by comprising the trichoderma viride of any one of claims 1 to 3 or the microbial agent of any one of claims 4 to 5;
preferably, the ginseng soil conditioner takes the trichoderma as a main effective component;
preferably, the ginseng soil conditioner contains the trichoderma in an amount of 1 x 108cfu·ml-1～3×108cfu·ml-1。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111347777.1A CN113913301B (en) | 2021-11-15 | 2021-11-15 | Trichoderma harzianum, microbial inoculum and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111347777.1A CN113913301B (en) | 2021-11-15 | 2021-11-15 | Trichoderma harzianum, microbial inoculum and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113913301A true CN113913301A (en) | 2022-01-11 |
| CN113913301B CN113913301B (en) | 2022-12-23 |
Family
ID=79246555
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111347777.1A Active CN113913301B (en) | 2021-11-15 | 2021-11-15 | Trichoderma harzianum, microbial inoculum and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113913301B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114134052A (en) * | 2021-12-21 | 2022-03-04 | 东北林业大学 | Trichoderma trichoderma harzianum YW411, culture method, microbial inoculum and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630071A (en) * | 2014-12-22 | 2015-05-20 | 吉林农业大学 | Polysporus trichoderma and application thereof |
| CN108148765A (en) * | 2017-12-19 | 2018-06-12 | 广州菌落生物科技有限公司 | One plant of acidproof plan trichodermaharzianum and its application on Rhizoctonia solani Kuhn is inhibited |
| CN110564627A (en) * | 2019-09-23 | 2019-12-13 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma strain HB20111 for preventing and treating soil-borne diseases of American ginseng and improving yield and application thereof |
| CN112063538A (en) * | 2020-09-25 | 2020-12-11 | 中国农业科学院特产研究所 | Trichoderma hamatum, microbial agent containing trichoderma hamatum and application of trichoderma hamatum |
-
2021
- 2021-11-15 CN CN202111347777.1A patent/CN113913301B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630071A (en) * | 2014-12-22 | 2015-05-20 | 吉林农业大学 | Polysporus trichoderma and application thereof |
| CN108148765A (en) * | 2017-12-19 | 2018-06-12 | 广州菌落生物科技有限公司 | One plant of acidproof plan trichodermaharzianum and its application on Rhizoctonia solani Kuhn is inhibited |
| CN110564627A (en) * | 2019-09-23 | 2019-12-13 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma strain HB20111 for preventing and treating soil-borne diseases of American ginseng and improving yield and application thereof |
| CN112063538A (en) * | 2020-09-25 | 2020-12-11 | 中国农业科学院特产研究所 | Trichoderma hamatum, microbial agent containing trichoderma hamatum and application of trichoderma hamatum |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114134052A (en) * | 2021-12-21 | 2022-03-04 | 东北林业大学 | Trichoderma trichoderma harzianum YW411, culture method, microbial inoculum and application thereof |
| CN114134052B (en) * | 2021-12-21 | 2023-05-12 | 东北林业大学 | Mao Cumu mould YW411, culture method, microbial inoculum and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113913301B (en) | 2022-12-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113913302B (en) | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria | |
| CN102676416B (en) | Rice sheath blight biocontrol strain RS-BC, microbial agent, preparation method and application | |
| CN111500501B (en) | Streptomyces misonii strain and application thereof in preventing and treating wheat root rot and stem basal rot | |
| CN113969247B (en) | Bacterium for inhibiting tobacco disease pathogenic bacteria and application thereof | |
| CN111073825B (en) | Bacterium with plant soil-borne disease resistance effect and application thereof | |
| CN111117924B (en) | Compound microbial inoculum and preparation method thereof, fertilizer and method for preventing and treating root rot | |
| CN112342173B (en) | Bacillus belgii and application thereof | |
| CN110982725B (en) | Bacillus for antagonizing fusarium wilt and promoting growth and application thereof | |
| CN111394261A (en) | Saline-alkali-tolerant trichoderma asperellum and application thereof | |
| CN113249242B (en) | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases | |
| CN109112069B (en) | Biocontrol endophytic fungus and application thereof | |
| CN110982724A (en) | Bacillus for antagonizing phytopathogen and promoting rooting and application thereof | |
| CN109971656B (en) | Ginger endogenetic trichoderma viride and application thereof | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN113913301B (en) | Trichoderma harzianum, microbial inoculum and application thereof | |
| CN112063538B (en) | Trichoderma hamatum, microbial agent containing trichoderma hamatum and application of trichoderma hamatum | |
| CN114806892B (en) | Trichoderma atroviride strain and application thereof in preventing and treating root rot of pseudo-ginseng | |
| CN115873770A (en) | Bacillus belgii and application thereof in prevention and treatment of tomato diseases | |
| CN114134053B (en) | Aspergillus ascomycete MR-86 and application thereof | |
| CN104974957B (en) | Bacillus（Bacillus sp.）ZY bacterial strains and its application | |
| CN113913303B (en) | Trichoderma pseudokoningii, root soaking solution and application | |
| CN113881578B (en) | Trichoderma viride and application thereof as soil conditioner for panax plants | |
| CN113913304B (en) | Bacteriostatic agent for pathogenic bacteria of trichoderma brevicompactum and ginseng and application thereof | |
| CN107603904B (en) | Streptomyces and application thereof | |
| CN117229985B (en) | Biocontrol strain bacillus atrophaeus BGB-98R and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |