CN114134052B

CN114134052B - Mao Cumu mould YW411, culture method, microbial inoculum and application thereof

Info

Publication number: CN114134052B
Application number: CN202111573777.3A
Authority: CN
Inventors: 赵敏; 杨洪岩; 王丽伟
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2021-12-21
Filing date: 2021-12-21
Publication date: 2023-05-12
Anticipated expiration: 2041-12-21
Also published as: CN114134052A

Abstract

The invention relates to the field of disease control, in particular to Mao Cumu mould YW411, a culture method, a microbial inoculum and application thereof. The invention provides trichoderma maackii YW411, wherein the preservation number of the Mao Cumu trichoderma maackii YW411 is CGMCC No.23202. The Mao Cumu mould YW411 can effectively prevent and treat plant fungal diseases, and has no pollution to the environment.

Description

Mao Cumu mould YW411, culture method, microbial inoculum and application thereof

Technical Field

The invention relates to the field of disease control, in particular to Mao Cumu mould YW411, a culture method, a microbial inoculum and application thereof.

Background

Ginseng (Panax ginseng) is perennial root herb of Panax of Araliaceae, is a rare Chinese medicinal material, has effects of nourishing and strengthening, and preventing and treating various diseases, is representative of modern natural tonic, and is known as "king of Chinese medicine". China is a large country for ginseng production, and the yield is about 70% of the total world yield. In the present stage, the forestation and the ginseng planting are forbidden by the order, and the future ginseng industry development will depend on high-quality farmland ginseng planting. However, compared with the soil for cultivating ginseng in the forests, the farmland soil has the problems of low organic matter content, poor soil fertility, small porosity, low activity of soil ore recycling enzyme, low beneficial microorganism ratio, serious soil-borne diseases and the like, and the quality of ginseng finished products is seriously affected.

In the ginseng planting process, root rot is one of the serious soil-borne diseases, and the damage is more serious in the field ginseng planting process. Root rot is caused by fusarium oxysporum (Fusarium oxysporum), spread and spread rapidly in recent years, ginseng plants after dying of diseases are weakened in growth vigor, overground parts die in severe cases, xylem of roots is completely rotted to black brown, yield is obviously reduced, and appearance characters and quality of the root rot are not in accordance with medicinal requirements. At present, chemical control is mainly adopted for controlling plant root rot, and the problems of pesticide residue and environmental pollution brought by the chemical control seriously threaten the development of the ginseng industry, so that a safe and environment-friendly disease control method is urgently required to be developed to promote the sustainable, stable and healthy development of the ginseng industry.

Disclosure of Invention

In order to solve the above problems, the present invention provides a Trichoderma viride (Trichoderma velutinum) YW411 strain. The Mao Cumu mould YW411 can effectively prevent and treat plant fungal diseases, is safe and has no pollution to the environment.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides trichoderma maackii (Trichoderma velutinum) YW411, wherein the preservation number of Mao Cumu mould YW411 is CGMCC No.23202.

The invention provides a culture method of Mao Cumu mould YW411, which comprises the following steps: and (3) inoculating Mao Cumu mould YW411 into a culture medium, and culturing under a constant temperature condition to obtain the Mao Cumu mould YW411 after propagation.

Preferably, the constant temperature is 28-32 ℃; the rotation speed of the culture is 150-200 rmp; the time of the culture is 5-7 d.

The invention provides a biocontrol microbial inoculum for preventing and treating root rot, and the effective components of the biocontrol microbial inoculum comprise the fermentation broth of Mao Cumu mould YW411 in the technical scheme or the fermentation broth of Mao Cumu mould YW411 obtained by culturing in the culture method in the technical scheme.

Preferably, the concentration of Mao Cumu mould YW411 in the Mao Cumu mould YW411 fermentation broth is 1.0X10 ^8～ 1×10 ⁹ Individual spores/mL.

Preferably, the biocontrol microbial agent further comprises a filler.

Preferably, the volume mass ratio of Mao Cumu mould YW411 fermentation liquor and filler in the biocontrol microbial inoculum is (0.5-1.5) mL: (0.5-2 g).

Preferably, the filler comprises calcite, polyvinyl alcohol, corn starch; the mass ratio of calcite to polyvinyl alcohol to corn starch is (1-2): (1-2): (1-3).

The invention provides Mao Cumu mould YW411 or application of the microbial inoculum in preventing and treating root rot and/or promoting plant growth.

Preferably, the plant comprises a medicinal plant.

The beneficial effects are that: the invention provides trichoderma maackii YW411, wherein the preservation number of the Mao Cumu trichoderma maackii YW411 is CGMCC No.23202. The Mao Cumu mould YW411 can effectively prevent and treat plant fungal diseases, relieve disease symptoms, promote plant growth, is safe and has no pollution to the environment. According to the invention, a plate counter experiment shows that the inhibition rate of Mao Cumu mould YW411 on fusarium oxysporum can reach 76.89%, and the antibacterial activity of fermentation filtrate is stable. The biocontrol microbial inoculum obtained by utilizing the Mao Cumu mould YW411 disclosed by the invention has a remarkable effect of preventing and treating root rot after being inoculated on the rhizosphere of ginseng, and has a good practical application value.

Description of biological preservation

Mao Cumu mould (Trichoderma velutinum) YW411 is preserved in China general microbiological culture Collection center (CGMCC) with a preservation address of 1 (North Chen Xili No. 3) in the Korean area of Beijing city, a preservation date of 2021, 8 months and 5 days, and a preservation number of 23202.

Drawings

FIG. 1 is a colony morphology of Mao Cumu mould YW411;

FIG. 2 is a phylogenetic tree of Mao Cumu mould YW411;

FIG. 3 is a diagram showing a counter experiment, wherein only fusarium oxysporum is inoculated on the left side, and Mao Cumu mould YW411 is co-cultured with fusarium oxysporum on the right side, wherein Mao Cumu mould is Mao Cumu mould YW411;

FIG. 4 is a graph showing experimental growth of potted ginseng;

FIG. 5 is a graph showing root rot of two ginseng plants;

FIG. 6 is a comparative plot of the roots of each treatment in a potting experiment, wherein Mao Cumu mold is Mao Cumu mold YW411.

Detailed Description

The invention provides trichoderma maackii YW411, wherein the preservation number of the Mao Cumu trichoderma maackii YW411 is CGMCC No.23202. In the present invention, the mycoses preferably include root rot, more preferably root rot caused by fusarium oxysporum. The colony morphology of Mao Cumu mould YW411 of the invention is as follows: colony growth is rapid, hypha is sparse, early stage is white, and about 5d is yellow-green; conidiophores are alternately produced from aerial hyphae, single-born and upright; conidiophore parietal grows into small clusters, which are light green and spherical.

In the invention, the ITS sequence of Mao Cumu mould YW411 is preferably represented by SQE ID No. 1: TTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTTCAGAAGTTGGGTGTTTAACGGCTGTGGACGCGCCGCGCTCCCGATGCGAGTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGAGACGGCCCCCGTGAAGGAAGGCCGATCCCCAACGCCGACCCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTCGAAACGCCTACGAGAGGCGCCGAGAAGGCTCAGATTATAAAAAAACCCGCGAGGGGGTATACAATAAGAGTTTTGGTTGATTCCTCCGGCGGGCGCCTTGGTCCGGGGCTGCGACGCACCCGGGGCAGAAGATCCCGCCGAGGCAACAGTTTGGTAACGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCT.

The Mao Cumu mildew YW411 can effectively prevent and treat plant fungal diseases, especially root rot, can relieve disease symptoms, promotes plant growth, is safe and has no pollution to the environment.

The invention provides a culture method of Mao Cumu mould YW411, which comprises the following steps: and (3) inoculating Mao Cumu mould YW411 into a culture medium, and culturing under a constant temperature condition to obtain the Mao Cumu mould YW411 after propagation. In the present invention, the medium is preferably PDA medium; the components of the medium preferably include: each 1000mL of water contains 200g peeled potatoes, 20g glucose and 15-20 g agar. In the present invention, the constant temperature is preferably 30 ℃; the rotation speed of the culture is preferably 180rmp; the time of the culture is preferably 5 to 7 days, more preferably 7 days. The strain is cultured under the specific conditions, so that the strain is not easy to agglomerate in the growth process, the propagation is faster, and the antibacterial effect is strongest.

The invention provides a biocontrol microbial inoculum for preventing and treating root rot, the active ingredients of the biocontrol microbial inoculum comprise the fermentation liquid of Mao Cumu mould YW411 or the culture methodThe resulting Mao Cumu mould YW411 broth was cultured. In the invention, the concentration of Mao Cumu mould YW411 in the Mao Cumu mould YW411 fermentation broth is preferably 1×10 ⁸ ～1×10 ⁹ The number of spores per mL is more preferably (4-9). Times.10 ⁸ Spores per mL, (6-8). Times.10 ⁸ Individual spores/mL. In the present invention, the root rot is preferably a root rot caused by fusarium oxysporum.

In the invention, the biocontrol microbial agent also comprises a filler; the volume mass ratio of Mao Cumu mould YW411 fermentation liquor and filler in the biocontrol microbial inoculum is preferably (0.5-1.5) mL: (0.5-2) g, more preferably 1mL:1g; the filler preferably comprises calcite, polyvinyl alcohol, corn starch; the mass ratio of calcite to polyvinyl alcohol to corn starch is (1-2): (1-2): (1-3), more preferably 1:1:2. In the invention, polyvinyl alcohol is a dispersing agent, corn starch is a carrier of Mao Cumu mould YW411, and calcite is an ultraviolet protective agent of Mao Cumu mould YW411. The mutual matching of the components can further promote the control effect of Mao Cumu mould YW411 on controlling plant fungal diseases and promote plant growth.

The Mao Cumu mildew YW411 disclosed by the invention can effectively prevent and treat plant fungal diseases, relieve disease symptoms, promote plant growth and has no pollution to the environment. According to the invention, a plate counter experiment shows that the inhibition rate of Mao Cumu mould YW411 on fusarium oxysporum can reach 76.89%, and the antibacterial activity of fermentation filtrate is stable. The biocontrol microbial inoculum obtained by utilizing the Mao Cumu mould YW411 disclosed by the invention has a remarkable effect of preventing and treating root rot after being inoculated on the rhizosphere of ginseng, and has a good practical application value. Therefore, the strain can be used for preventing and treating plant mycosis and promoting plant growth.

The invention provides application of Mao Cumu mould YW411 or the microbial inoculum in preventing and treating root rot and/or promoting plant growth. In the present invention, the plant preferably includes a medicinal plant, further preferably a plant of the Araliaceae family, more preferably a plant of the Panax genus, most preferably Panax ginseng; the root rot is preferably a root rot caused by fusarium oxysporum.

The present invention preferably provides a method of plant growth comprising the steps of: the microbial inoculum is applied to plant rhizosphere.

In the present invention, the plant preferably includes a medicinal plant, more preferably a plant of the Araliaceae family, still more preferably a plant of the Panax genus, most preferably Panax ginseng. In the invention, the application mode is preferably root irrigation or soil mixing; the soil mixing amount is preferably 5-90 kg/mu, more preferably 7-89 kg/mu, and even more preferably 8-88 kg/mu based on the mass of the microbial inoculum; the root irrigation amount is preferably 2-20L/mu, more preferably 2.1-18L/mu, and most preferably 2.3-12L/mu, based on the volume of the Mao Cumu mould YW411 fermentation broth in the microbial inoculum.

In the specific embodiment of the invention, verification is carried out in a potting mode, and the bacterial agent is preferably mixed with water in the experimental process to obtain the diluted bacterial agent; applying a diluted microbial agent to plant rhizosphere; the ratio of the microbial inoculum to the water is preferably 1:100, namely diluting the microbial inoculum by 100 times. In the invention, the flower pot preferably has the upper opening diameter of 19cm, the height of 16cm and the bottom diameter of 14cm; the volume of the flowerpot is preferably 0.028m ² The method comprises the steps of carrying out a first treatment on the surface of the The application mode is preferably root irrigation, and the application mode is preferably root irrigation; the root irrigation amount is preferably 0.1-0.5 mL/basin, more preferably 0.2 mL/basin, based on the volume of Mao Cumu mould YW411 fermentation liquor in the microbial inoculum.

In the specific embodiment of the invention, when the verification is performed in a field test mode, plant rhizosphere is preferably applied in the test process; the application mode is preferably soil mixing; the dosage of the soil is 40-400 g/3m ² More preferably 50 to 350g/3m ² More preferably 60 to 300g/3m ² 。

For further explanation of the present invention, the Mao Cumu mould YW411, the cultivation method, the microbial inoculum and the application thereof provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

PDA medium preparation: peeling potato, washing with clear water, cutting into 1cm size ³ Weighing about 200g of potato, boiling in 800mL of water for about 30min, and stirring while boilingUntil the potatoes are soft and rotten. The mixture is filtered by 6 layers of gauze, 20g of glucose is added, and distilled water is added to a volume of 1000mL. Agar 20g/1000mL medium was added, and the pH was natural.

EXAMPLE 1 isolation and identification of Trichoderma reesei YW411

Respectively preparing 10 from 1, 2, 3 and 4 years of rhizosphere soil of ginseng serving as experimental materials ^-1 、10 ^-2 、10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 A soil dilution; 10 is as above ^-1 ～10 ^-6 The soil diluent is uniformly coated on a PDA flat plate, and bacterial is purified by a flat plate scribing method, and the specific steps are as follows: after the soil dilution is coated, the strains are classified according to colony morphology and the like, different hyphae are respectively picked by an inoculating loop, streaked inoculation is carried out on a new PDA flat plate by a three-line method, the culture is carried out for 7d at 28 ℃, the operation can be repeated until pure strains are obtained, 1 trichoderma viride is obtained, and the strain is marked as a strain I.

The bacterial strain I is biologically identified by adopting an optical microscope, and the colony morphology of the bacterial strain is shown in figure 1: colony growth is rapid, hypha is sparse, early stage is white, and about 5d is yellow-green; conidiophores are alternately produced from aerial hyphae, single-born and upright; conidiophore parietal grows into small clusters, which are light green and spherical.

Genomic DNA was extracted from strain I by benzyl chloride method, and PCR amplification was performed using 5'-CCGTA GGTGAACCTGCGG-3' (ITS 1, SEQ ID No. 2) and 5'-TCCTCCGCTTATTGATATGC-3' (ITS 4, SEQ ID No. 3) as primers, and then sequencing was performed, the reaction system was as shown in Table 1, and the amplification procedure was as follows: the ITS sequence is shown as SEQ ID No. 1; the sequence is compared and identified in NCBI database, the similarity with Trichoderma velutinum strain is 99.68%, and simultaneously, phylogenetic tree is produced, and the result is shown in figure 2 and belongs to Trichoderma velutinum branch. Therefore, this strain was named Mao Cumu mould YW411. One YW411 pellet after 7d of PDA plate culture was inoculated on CAS blue qualitative detection plate with a diameter of 5mm and incubated at 28℃for 7d. Orange-yellow halos formed around the colonies, indicating that they can produce siderophores, which were then quantitatively detected with the CAS detection solution. Inoculating 5 bacterial blocks with the diameter of 5mm into 200mL of PDB culture medium, culturing at 28 ℃ at 180rpm for 48h by shaking, sucking 1.5mL of bacterial liquid into an EP tube, centrifuging to obtain supernatant, and mixing with CAS detection liquid 1:1 volume, and after standing for 1 hour, absorbance (As) at 630nm wavelength was measured using a spectrophotometer, and zeroed with PDB liquid medium control. An equal volume of PDB broth was taken with CAS test solution 1:1, and determining the absorbance value as a reference value (Ar), and repeating for three times. The final value of As/Ar for Mao Cumu mould YW411 siderophores was 1.05.

The preparation method of the CAS blue qualitative detection plate comprises the following steps:

0.12g CAS (Luo Tian Qing) was dissolved in 100mL deionized water and combined with 20mL 1mmol/L FeCl ₃ Uniformly mixing the solutions to obtain a solution a; 0.15g of cetyl trimethyl ammonium bromide is taken and dissolved in 80mL of deionized water to obtain solution b; slowly adding the obtained solution a into the solution b, and fully and uniformly mixing to obtain 200mL of dye liquor c; 0.1mol/L phosphate solution (2.427 g Na) ₂ HPO ₄ ·12H ₂ O、0.5905g NaH ₂ PO ₄ ·2H ₂ O、0.075g KH ₂ PO ₄ 、0.125g NaCl、0.25g NH ₄ Cl and deionized water 100 mL), adding 10mL of piperazine diethanol sulfonic acid 6.04g into a clean triangular flask containing 150mL of distilled water, uniformly mixing, adjusting the pH to 6.8, and finally adding agar 4g to obtain a culture medium d; dye liquor c, culture medium d and 1mmol/L CaCl ₂ 、1mmol/L MgSO ₄ ·7H ₂ Sterilizing O, 20% glucose and 10% casein amino acid at 121deg.C for 15min. Measuring 1mmol/L CaCl obtained by the sterilization ₂ 0.2mL、1mmol/L MgSO ₄ ·7H ₂ O4 mL, 10% casein amino acid 6mL and 20% glucose solution 2mL are added into the sterilized culture medium d, then 20mL of the sterilized dye solution c is slowly added, and after full shaking, a blue qualitative detection culture medium is obtained, and the culture medium is immediately poured into a flat plate, namely a CAS blue qualitative flat plate.

The CAS detection solution configuration method comprises the following steps: adding 6.0mL of 10mmol/L hexadecyl trimethyl ammonium bromide (HDTMA) bath solution into a 100mL volumetric flask, adding deionized water for moderate dilution, and adding 1.5mL lmmol/L FeCl ₃ After the solution was mixed with 7.5mL of 2mmol/L of a luo Tian qing (CAS) solution, it was slowly added to the above-mentioned volumetric flask. 4.307g of anhydrous Shuangdi is weighedMethylamine was dissolved in about 30mL deionized water and the pH was adjusted to 5.6 with 6.25mL 12mol/L HCl. The buffer solution is transferred into the volumetric flask, mixed uniformly and the volume is fixed to 100mL by deionized water.

PCR reaction system: a negative control, i.e., 1ul of sterile water was added without adding DNA template to the reaction system. The 50ul system is as follows:

TABLE 1 reaction system

The addition sequence is as follows: ddH ₂ O、PCR Buffer、dNTP、MgCl ₂ Taq, primers.

Amplification procedure:

example 2 Mao Cumu mould YW411 challenge experiment

A small amount of fusarium oxysporum (https:// www.ddbj.nig.ac.jp/index-e.htmL) thalli is selected from the inclined plane by using a sterile inoculation loop, the thallus with the accession number of LC656545 is streaked and inoculated on a new PDA flat plate, the inoculation amount is one loop, the culture is carried out for 7 days at 28 ℃, and a 5mm puncher is used for taking fungus blocks to obtain fusarium oxysporum fungus blocks.

The above-mentioned fusarium oxysporum pellet having a diameter of 5mm was inoculated at a position 1cm from the edge of one side of the PDA plate, and a Mao Cumu mold YW411 pellet having a diameter of 5mm (obtained in example 1) was inoculated at the same distance from the other side, and the culture was allowed to stand at 28℃for 7d.

The antibacterial effect is identified through the opposite culture of the flat plates, and the calculation formula of the inhibition ratio (IE) is as follows: IE (%) = (1-Rc/Rs) ×100%, where Rc represents the radius of radial growth of pathogenic bacteria in co-culture and Rs represents the radius of radial growth of pathogenic bacteria in control. The mycelium morphology of the colony edge of fusarium oxysporum in the co-culture area is observed through an optical microscope, and the inhibition effect of antagonistic fungi on pathogenic fungus mycelium is analyzed by taking single-cultured fusarium oxysporum as a control, wherein the inhibition effect is shown in figure 3.

The stand-off experiment shows that: rc=1.228 cm, rs= 5.314cm, and the calculated inhibition rate of Mao Cumu mould YW411 to fusarium oxysporum can reach 76.89%, and it is seen from fig. 3 that Mao Cumu mould YW411 can significantly inhibit the growth of fusarium oxysporum.

Example 3 Trichoderma majordomom YW411 Ginseng rhizosphere inoculation experiment

The preparation method of Mao Cumu mould YW411 fermentation broth comprises the following steps: selecting Mao Cumu mould strain stored on the inclined surface of a test tube from a sterile inoculating loop, streaking and inoculating on a PDA plate, standing at 28 ℃ for 7d, then inoculating 5 bacterial blocks with the diameter of 5mm into 200mL of PDB culture medium, culturing at 28 ℃ at 180rpm for 7d in a shaking table to obtain fermentation liquor, calculating the spore concentration by microscopic examination, and finally obtaining the concentration of 1.8X10 used in the experiment ⁸ Individual spores/mL.

The preparation method of fusarium oxysporum bacterial liquid comprises the following steps: the preparation method is the same as the above method.

Potted experiments are carried out by adopting three-year-old ginseng seedlings, and the experiments are provided with 4 treatments, and the treatments are as follows: CK (non-inoculation), T (Mao Cumu mould YW411 fermentation liquor, spore concentration is 1.8X10) ⁸ spore/mL), FO (Fusarium oxysporum solution, spore concentration of 1.8X10) ⁸ spore/mL), T+FO (Mao Cumu mould YW411 fermentation broth+Fusarium oxysporum liquid, mao Cumu mould YW411 fermentation broth and Fusarium oxysporum in a volume ratio of 1:1); each treatment was repeated 3 times.

Root irrigation and inoculation are carried out after 2 weeks of growth of the ginseng in two years, the root irrigation amount of each pot is 0.2mL of fermentation liquor, the dilution is 20mL after 100 times, the cultivation is carried out continuously for 3 months after application, and the biological properties of plants are analyzed, and the results are shown in Table 2 and figures 4-6.

TABLE 2 biological Condition of the above-ground and below-ground parts treated by each treatment

Treatment of	Ground height (cm)	Underground length (cm)	Incidence (%)
				CK	43.3±2.9	15.8±0.8	0
FO	40±1.1	5.1±0.7	100
				T	49.1±6.5	19.4±3.6	0
T+FO	44.2±2.9	17.7±1.7	0

As can be seen from Table 2, FIGS. 4 to 6, the treated plants inoculated with Fusarium oxysporum group (FO) were weaker and smaller, and the roots of the ginseng had been rotted (FIG. 5); the grouping (T+FO) of the Mao Cumu mould YW411 and the fusarium oxysporum can be independently inoculated to effectively prevent and treat diseases caused by the fusarium oxysporum, has obvious prevention and treatment effects, can promote plant growth, and can be applied as an effective biocontrol microbial inoculum.

Example 4 biological inoculant field test

1. Preparation of microbial inoculum

1. Activating strains: mao Cumu mould YW411 obtained in example 1 was inoculated onto an activation medium PDA medium (preparation method of activation medium: 20g of peeled potato was boiled for 20 minutes to obtain juice, 100mL of the juice was prepared with 2g of glucose, 1.5g of agar and water, pH was 6.8 to 7.0, and sterilization was performed at 121℃for 15 minutes), and cultured at 28℃for 5 days.

2. Preparing fermentation liquid: the activated strain is processed according to 1 multiplied by 10 ⁸ Inoculating the spores/mL into sterilized liquid fermentation medium (1L of liquid fermentation medium contains 25g corn flour, 15g yeast powder, 2g CaC 0) ₃ 0.2g of MgSO ₄ ，0.1g MnSO ₄ ) Culturing at 28deg.C for 7 days with shaking at 200rpm to obtain Mortierella alpina solution, wherein the number of internal spores is determined by using a blood cell counting plate, and the concentration is 5×10 ⁸ Individual spores/mL.

3. And (3) preparing a solid microbial inoculum: mixing the obtained fermentation liquor with auxiliary materials (calcite, polyvinyl alcohol and corn starch, wherein the mass ratio of the calcite to the polyvinyl alcohol to the corn starch is 1:1:2) according to the following weight ratio of 1mL: mixing 1g, placing in a 50 ℃ oven after mixing, and baking for 8 hours to ensure that the water content is less than 10%. Detecting the number of viable bacteria in the bacterial powder by using a plate counting method, wherein the number of viable bacteria of penicillium citrinum contained in each gram of bacterial agent is 5 multiplied by 10 ⁸ Spores, and the obtained material is the biocontrol microbial agent of the embodiment.

2. Application of biocontrol microbial inoculum field test

1. Test bacterial liquid: the biocontrol microbial agent prepared by the invention.

2. Test crop and control object: the ginseng seedlings are grown for three years, and the control object is ginseng root rot.

3. Test site: ginseng planting area in peony river city of Heilongjiang province

4. Field test:

test design and arrangement:

cell setting: 1.5m wide and 2m long, and the soil is high-quality farmland ginseng planting soil: soil with outbreak of root rot = 7:3, wherein the control group is sterile culture medium and filling auxiliary material (the filling auxiliary material is formed by mixing calcite, polyvinyl alcohol and corn starch, wherein the mass ratio of calcite to polyvinyl alcohol to corn starch is 1:1:2), 3m ² Mixing 40g of the biological bactericide for test 1 group and 3m of the biological bactericide ² Mixing 40g of the biological bactericide for test group 2 and 3m of the biological bactericide ² The mixing amount is 400g; each process was repeated 3 times for a total of 9 cells, arranged randomly.

The test investigation and calculation method comprises the following steps:

since root rot occurs in the high-temperature high-humidity season of 7-8 months, the incidence rate of each group was investigated in the middle of 8 months.

Counting the total number of ginseng and the number of diseased plants in each group, and calculating the disease rate, the biocontrol rate and the yield, wherein the specific formula is as follows:

morbidity = number of attacks/total x 100%;

biocontrol rate= (control-test rate)/control rate x 100%.

Post-harvest samples were measured for aboveground, subsurface length and dry weight, and the findings are presented in table 3.

TABLE 3 control effects of microbial inoculum with different application amounts on root rot of ginseng

Note that: the total number of ginseng is different due to planting errors in field trials.

As shown in Table 3, the biocontrol microbial inoculum has good control effect on ginseng root rot. From the aspect of the morbidity and the biocontrol rate of the ginseng root rot, the biocontrol rate reaches more than 80 percent, and the effect is more remarkable along with the increase of the application amount.

The Mao Cumu mould YW411 can effectively prevent and treat plant fungal diseases, relieve disease symptoms, promote plant growth and has no pollution to the environment. According to the invention, a plate counter experiment shows that the inhibition rate of Mao Cumu mould YW411 on fusarium oxysporum can reach 76.89%, and the antibacterial activity of fermentation filtrate is stable. The biocontrol microbial inoculum obtained by utilizing the Mao Cumu mould YW411 disclosed by the invention has a remarkable effect of preventing and treating root rot after being inoculated on the rhizosphere of ginseng, and has a good practical application value.

While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.

Sequence listing

<110> university of northeast forestry

<120> Mao Cumu mould YW411, culture method, microbial inoculum and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 580

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ttaagttcag cgggtattcc tacctgatcc gaggtcaaca tttcagaagt tgggtgttta 60

acggctgtgg acgcgccgcg ctcccgatgc gagtgtgcaa actactgcgc aggagaggct 120

gcggcgagac cgccactgta tttcggagac ggcccccgtg aaggaaggcc gatccccaac 180

gccgaccccc cggaggggtt cgagggttga aatgacgctc ggacaggcat gcccgccaga 240

atactggcgg gcgcaatgtg cgttcaaaga ttcgatgatt cactgaattc tgcaattcac 300

attacttatc gcatttcgct gcgttcttca tcgatgccag aaccaagaga tccgttgttg 360

aaagttttga ttcattttcg aaacgcctac gagaggcgcc gagaaggctc agattataaa 420

aaaacccgcg agggggtata caataagagt tttggttgat tcctccggcg ggcgccttgg 480

tccggggctg cgacgcaccc ggggcagaag atcccgccga ggcaacagtt tggtaacgtt 540

cacattgggt ttgggagttg taaactcggt aatgatccct 580

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

ccgtaggtga acctgcgg 18

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

Claims

1. Trichoderma maackii strainTrichoderma velutinum) YW411, its characterized in that Mao Cumu mould YW 411's preservation number is CGMCC No.23202.

2. The method for culturing Mao Cumu mould YW411 of claim 1, comprising the steps of: and (3) inoculating Mao Cumu mould YW411 into a culture medium, and culturing under a constant temperature condition to obtain the Mao Cumu mould YW411 after propagation.

3. The culture method according to claim 2, wherein the constant temperature is 28-32 ℃; the rotation speed of the culture is 150-200 rmp; the culture time is 5-7 d.

4. The biocontrol microbial inoculum for preventing and treating root rot is characterized in that the effective components of the biocontrol microbial inoculum comprise a fermentation broth of Mao Cumu mould YW411 in claim 1 or a fermentation broth of Mao Cumu mould YW411 obtained by culturing in a culture method in claim 2 or 3; the root rot is caused by fusarium oxysporum.

5. The biocontrol microbial agent of claim 4, wherein the Mao Cumu mold YW411 concentration in said Mao Cumu mold YW411 fermentation broth is 1.0 x 10 ⁸ ~1×10 ⁹ Individual spores/mL.

6. The biocontrol microbial agent of claim 4, wherein said biocontrol microbial agent further comprises a filler.

7. The biocontrol microbial agent of claim 6, wherein the volume to mass ratio of Mao Cumu mould YW411 fermentation broth to filler in the biocontrol microbial agent is (0.5-1.5) mL: (0.5-2 g).

8. The biocontrol microbial agent of claim 6 or 7, wherein said filler comprises calcite, polyvinyl alcohol, corn starch; the mass ratio of calcite to polyvinyl alcohol to corn starch is (1-2): (1-2): (1-3).

9. Use of Mao Cumu mould YW411 according to claim 1 or of a fungicide according to any one of claims 4 to 8 for controlling root rot and/or for promoting plant growth, characterized in that said root rot is a root rot caused by fusarium oxysporum; the plant is ginseng.