CN112063538A

CN112063538A - Trichoderma hamatum, microbial agent containing trichoderma hamatum and application of trichoderma hamatum

Info

Publication number: CN112063538A
Application number: CN202011023723.5A
Authority: CN
Inventors: 王秋霞; 马莹莹; 关一鸣; 张淋淋; 金桥; 马琳; 张舒娜; 张悦; 潘晓曦
Original assignee: Institute Special Animal and Plant Sciences CAAS
Current assignee: Institute Special Animal and Plant Sciences CAAS
Priority date: 2020-09-25
Filing date: 2020-09-25
Publication date: 2020-12-11
Anticipated expiration: 2040-09-25
Also published as: CN112063538B

Abstract

The invention provides a hook-shaped trichoderma, a microbial agent containing the same and application thereof, and relates to the technical field of microorganisms. The Trichoderma hamatum (Trichoderma hamatum) MM3 provided by the invention is preserved in the China general microbiological culture Collection center, and the preservation number is as follows: CGMCC No. 19937; the preservation time is as follows: year 2020, month 07, and 31. The trichoderma hamatum MM3 and the microbial agent containing the trichoderma hamatum can effectively improve farmland soil for ginseng planting, relieve the occurrence of diseases, enable the ginseng seedling survival rate to be high, and can promote the growth of ginseng plants.

Description

Trichoderma hamatum, microbial agent containing trichoderma hamatum and application of trichoderma hamatum

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a trichoderma hamatum, a microbial agent containing the trichoderma hamatum and application of the trichoderma hamatum.

Background

Ginseng (Panax ginseng c.a.mey), belonging to the araliaceae perennial root herbaceous plant, mainly grows in the northeast Jilin Changbai mountain area, and is a traditional and rare Chinese medicinal material in China. For many years, in the process of developing ginseng industry in northeast China, in addition to under-forest nursing cultivation modes, ginseng is planted in forests and in farmlands. With the implementation policy of 'natural forest protection engineering' and the development of ginseng industry, traditional ginseng planting in forests is gradually changed into field ginseng planting. However, the common farmland has the problems of low soil volume weight, easy hardening, low nutrient content and the like, and the ginseng diseases are serious due to the direct ginseng planting. Moreover, some plots have pesticide residues, which are not suitable for the growth of ginseng.

The farmland ginseng planting is characterized in that the soil of a common farmland is reformed, so that the nutrient, microbial community and the like in the soil meet the requirements of ginseng growth. In the prior art, farmland improvement is realized through different technical means so as to improve the soil environment for planting ginseng, and the method comprises the steps of chemical soil disinfection, use of a soil conditioner (for example, the soil conditioner is formed by combining various substances such as bacillus, multivitamin, aspergillus oryzae, trace elements and the like) composed of various components, increase of nutrient elements, application of organic fertilizer, and application of a microbial compound bacteria fermentation broth, corn straw, bean cake, wheat bran and allicin microemulsion which are mixed in proportion and applied to farmland soil or old ginseng land and reasonable field management and the like. However, the use of chemical pesticides not only damages the soil environment and causes pesticide residues in the soil, but also poses certain safety risks to ginseng and affects the medicinal value of ginseng.

In the prior art, most of the ginseng is sprayed at each stage of the growth of the ginseng by matching the plant growth regulator with phosphorus, potassium, iron, boron, manganese and other nutrient elements which are easily consumed in the growth process of the ginseng, so as to promote the growth and development of the ginseng and increase the yield. However, the technical means not only wastes time and labor and has higher cost, but also has common effect. Therefore, it is one of the important problems in ginseng cultivation that how to promote ginseng growth safely and effectively and increase ginseng yield.

Disclosure of Invention

The invention aims to provide Trichoderma hamatum (Trichoderma hamatum) MM3, wherein Trichoderma hamatum MM3 can effectively improve soil for soil cultivation of ginseng in farmland, relieve the occurrence of diseases, enable the survival rate of ginseng to be high, and promote the growth of ginseng plants.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

the invention provides Trichoderma hamatum (Trichoderma hamatum) MM3, which is deposited in the China general microbiological culture Collection center, and has the address: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North; the preservation number is: CGMCC No. 19937; the preservation time is as follows: year 2020, month 07, and 31.

The Trichoderma hamatum (Trichoderma hamatum) MM3 is obtained by separating roots of ginseng collected from Wanlian town areas of Fusong county, mountain city, Jilin province.

Strain morphology: after 3 days of culture on a PDA culture medium, the colony is circular, white hyphae are uniformly spread on the culture medium and spread to the periphery in an annular shape, 7 days of culture are full of the whole culture dish, the diameter of the colony is 8.5cm, conidia are produced in light green spore-forming clusters and distributed in a concentric ring-shaped pattern or gather at the edge of the colony, no special odor exists, and light yellow small drops are sometimes produced at the edge of the colony. The front of the colony is white in the initial stage and is light green in the later stage, and part of aerial hyphae exist; white on the back and no pigment infiltration. Hyphae have a branched structure, conidiophores are branched and are multi-geminal, and a few of conidiophores are single or recurrent; the length can reach 62 mu m. The primary branches are longer as far as the primary branches are away from the main shaft, obvious sterile extended filaments are grown at the top end of the main shaft and slightly bent, the sterile extended filaments can also be re-branched, hook-shaped or zigzag bent is formed at the top of the extended filaments, the spore-producing bottle body is in an ampoule shape and bent at the top, the shrinkage of the base part of the bottle body is obvious, the spore is grown in 3-5 rounds, and a few of the spore is grown singly and sparsely and irregularly grown on the spore stalks. Conidiophores are green, ellipsoidal or oval, and have an inner nucleus. The diameter of the conidium is 3.1-4.2 multiplied by 2.3-2.8 μm.

According to another aspect of the present invention, the present invention also provides a microbial agent containing the Trichoderma hamatum MM 3.

In a specific embodiment, the microbial agent is a solid microbial agent or a liquid microbial agent.

In a preferred embodiment, when the microbial agent is a solid microbial agent, the microbial agent contains 0.5 x 10 viable bacteria of the trichoderma hamatum MM3⁴To 3X 10⁵cfu·g^-1(ii) a When the microbial agent is a liquid microbial agent, the number of viable bacteria of the trichoderma hamatum MM3 contained in the microbial agent is 0.5 multiplied by 10⁴To 3X 10⁵cfu·mL^-1。

In a specific embodiment, when the microbial agent is a solid microbial agent, the microbial agent further comprises a solid support. Preferably, the solid support comprises one or more of silica, talc, kaolin, diatomaceous earth, attapulgite, montmorillonite, bentonite and calcium carbonate.

In a specific embodiment, the solid microbial inoculum further comprises one or more of an antioxidant, a binder and a water-retaining agent.

Preferably, the antioxidant is selected from one or more of vitamin C, vitamin E and citric acid.

Preferably, the binder is selected from maltose and/or dextrin.

Preferably, the water retaining agent is selected from at least one of water absorbent resin, mannitol, and trehalose.

According to another aspect of the invention, the invention also relates to the use of a strain or microbial agent as described above for soil improvement.

In one embodiment, the soil improvement comprises one or more of adsorbing heavy metals from the soil, improving soil fertility, altering soil ph, increasing soil colony ecological diversity, reducing soil hardening, and enhancing soil permeability.

In a specific embodiment, the application of the strain or microbial agent in soil improvement comprises the step of uniformly mixing the strain or microbial agent with soil in ploughing. Specifically, the number of viable bacteria of 15ml applied to each 1kg of soil is 0.5X 10⁴cfu·mL^-1The microbial agent of (3) is uniformly mixed with the soil.

According to another aspect of the present invention, the present invention also relates to the use of the strain or microbial agent as described above in ginseng cultivation.

The ginseng is selected from conventional ginseng varieties, such as including but not limited to: korean ginseng, east American ginseng, etc.

In one embodiment, the application of the strain or microbial agent in ginseng cultivation comprises dipping roots and/or irrigating roots of ginseng seedlings by using a spore suspension; preferably, the root irrigation is performed after the ginseng seedling is cultivated in the soil.

In a particular embodiment, the spore suspension has a spore content of 0.5X 10⁴cfu·mL^-1To 3X 10⁵cfu·mL^-1。

The trichoderma hamatum strain can effectively relieve the occurrence of diseases of the planted ginseng seedlings by improving the farmland soil under the condition that the common farmland soil is not treated, improves the seedling survival rate and has obvious growth promotion effect on the growth of roots, stems and leaves of ginseng. Optimizes the colony ecological environment of the soil and enriches the beneficial flora of the soil. Meanwhile, the trichoderma hamatum is safe to ginseng, and ginseng seedlings can grow healthily without other treatment after the microbial inoculum is used for improving the farmland. Is beneficial to improving the quality of the ginseng and improving the economic benefit.

The Trichoderma hamatum provided by the application has the strain name of MM3, and is preserved in the China general microbiological culture Collection center, address: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North; preservation number CGMCC No. 19937; the strain was detected as a viable strain by the depository at 31/07/2020 and deposited.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

Isolation and identification of Trichoderma hamatum strain MM3

The root of ginseng collected in the Wanlian town region of Fusong county, mountain city, Jilin province was subjected to a separation test by a conventional tissue separation method: washing root of Ginseng radix with clear water, sterilizing in 70% ethanol for 2min under aseptic condition, sterilizing in 0.1% mercuric chloride for 30s, washing root with aseptic water for 3-5 times, and drying surface water with aseptic filter paper; cutting epidermal tissue (3mm × 3mm) with a sterilizing knife, placing the tissue blocks on potato glucose agar (PDA) culture medium, culturing at constant temperature of 25 deg.C, separating and purifying by single cell separation method when hypha grows around the tissue blocks and forms colony, and storing the purified strain at 4 deg.C. Potato dextrose agar medium (PDA) purchased from Qingdao haibo biotechnology limited, product number: HB 0233.

And (3) strain identification: PCR amplification is carried out by using primers ITS4 and ITS5 and using genome DNA of the strain MM3 as a template, an amplification product is sent to Kumami biology Limited company for sequencing, ITS sequences of the strains are input into NCBI for comparison, and similar strain sequences with very high homology can be found in GenBank by analyzing by using software such as BLAST, DNAMAN and the like. The sequence length of rDNA-ITS is 621bp, the strain with the highest similarity to MM3 strain is Trichoderma hamatum, and the homology reaches 100%. According to MEGA6.06 software, a phylogenetic tree is constructed by an UPGMA method, and the discovery shows that the genetic relationship of MM3 and Trichoderma hamatum is very close to each other, and the relative source reaches 100%. Combining the results of morphological classification and molecular biological identification, the strain MM3 of the invention can be confirmed to be Trichoderma hamatum (Trichoderma hamatum). The rDNA-ITS sequence of the strain is shown in SEQ ID NO. 1.

AAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGG GATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAA ACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTAAAAGCCCCGGA ACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCC TCGCGGACGTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCA AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCA GCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA ATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTG TCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGG GGATCGGGACCCCTCACCGGGTGCCGGCCCTGAAATACAGTGGCGGT CTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGG AGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTG ACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAG CGGAGG

Example 2

Improving effect of trichoderma hamatum strain MM3 on farmland soil

Preparation of a strain culture solution:

activating Trichoderma hamatum MM3 test tube slant seeds, inoculating 25 MM fungus cakes into 100mL potato glucose liquid culture medium (PDB) bottled by 250mL triangle, and culturing at 25 deg.C at 170r/min for 48h to obtain seed solution;

inoculating the Trichoderma hamatum MM3 seed solution into a fermentation culture solution at a volume ratio of 10% for culture, and culturing at 25 ℃ for 96h at 170r/min to obtain a culture solution;

filtering Trichoderma hamatum MM3 culture solution with 2 layers of sterile gauze, counting the filtrate with a blood ball counting plate, dispersing the spore suspension to 6 g.L^-1Sodium carboxymethylcellulose (CMC) solution to obtain spore suspension with spore content of 3 × 10⁵cfu·mL^-1；

Soil improvement experiment of farmland:

experimental group (MM 3): the farmland soil (ordinary corn field soil without ginseng planting, impurities such as straw and stone are removed by a 10-mesh screen before use) is filled into flowerpots with the diameter of 20cm, and each pot is filled with 2kg of soil. Annual ginseng seedlings with consistent size and good growth are selected for transplanting, 6 plants are planted in each pot, and 6 pots are planted in each group. The prepared trichoderma hamatum MM3 spore suspension (with the bacterial content of about 3X 10) is added⁵cfu·ml^-1) Diluting 50 times of solution with sterile water, dipping the ginseng seedling into root with MM3 spore suspension, and irrigating the root with 30ml MM3 spore suspension after cultivating soil.

Control group (CK): the control group was given fresh PDB liquid medium.

And after 90 days, taking the soil of the ginseng root area, and detecting the physical and chemical properties of the soil.

Table 1: physical and chemical properties of soil

Index (I)	CK	MM3
			All N (g/kg)	2.94±0.12	3.70±0.20
Organic matter (g/kg)	68.96±0.30	73.96±4.30
			Ammonium nitrogen (mg/kg)	80.72±2.46	97.41±9.46
Nitrate nitrogen (mg/k)g)	8.64±2.13	24.05±6.78

The test results show that: the physical and chemical indexes of the soil treated by the trichoderma hamatum and the control soil are different (table 1). The organic matter content of the soil treated by the MM3 is about 7.2 percent higher than that of the control group, the total nitrogen content of the soil treated by the MM3 is obviously higher than that of the control group (CK) by 25.9 percent, and the contents of ammonium nitrogen and nitrate nitrogen of the soil treated by the MM3 are respectively 20.7 percent and 178.3 percent higher than those of the soil treated by the control group.

This yields: the physicochemical property of the soil is influenced by the treatment of the trichoderma hamatum strains, and the total nitrogen content and the organic matter content in the soil are improved and the ammonium nitrogen and nitrate nitrogen content in the soil are increased after the trichoderma hamatum spore suspension is added.

Example 3

Growth promoting effect of trichoderma hamatum on ginseng cultivated in farmland soil

A pot culture test method is adopted to determine the growth promoting effect of trichoderma hamatum MM3 strain on ginseng, and the preparation of a strain culture solution comprises the following steps: activating Trichoderma hamatum MM3 test tube slant seeds, inoculating 25 MM fungus cakes into 100mL potato glucose liquid culture medium (PDB) bottled by 250mL triangle, and culturing at 25 deg.C at 170r/min for 48h to obtain seed solution; inoculating the Trichoderma hamatum MM3 seed solution into a fermentation culture solution at a volume ratio of 10% for culture, and culturing at 25 ℃ for 96h at 170r/min to obtain a culture solution; filtering Trichoderma hamatum MM3 culture solution with 2 layers of sterile gauze, counting the filtrate with a blood ball counting plate, dispersing the spore suspension to 6 g.L^-1Sodium carboxymethylcellulose (CMC) solution to obtain spore suspension with spore content of 3 × 10⁵cfu·mL^-1(ii) a A preparation method of a potato dextrose liquid medium (PDB) comprises the following steps: 200g/L of potato, 10g/L of glucose and 1000mL of distilled water, and the pH value is 6.8-7.2. Filling 300mL of culture solution into a 1000mL triangular flask, sealing the triangular flask opening with a double-layer sealing film, performing moist heat sterilization at 121 ℃ for 30min, and cooling for later use.

Mixing with agricultural soil (ordinary corn field without radix Ginseng)Soil, impurities such as straw and stones are screened out by a 10-mesh screen before use) are filled into flowerpots with the diameter of 20cm, and 2kg of soil is filled in each pot. Annual ginseng seedlings with consistent size and good growth are selected for transplanting, 6 plants are planted in each pot, and 6 pots are planted in each group. The prepared trichoderma hamatum MM3 spore suspension (with the bacterial content of about 3X 10) is added⁵cfu·ml^-1) Diluting 50 times of solution with sterile water, dipping the ginseng seedling into root with MM3 spore suspension, and irrigating the root with 30ml MM3 spore suspension after cultivating soil. The control group was given fresh PDB liquid medium.

After the ginseng seedlings grow to 90 days, digging out the whole ginseng seedlings of the treatment group and the control group respectively, washing away soil at the roots, and measuring the fresh weight of stems and leaves and the fresh weight of roots. Then dried to constant temperature at 105 ℃, and the dry weight of the stem leaves and the dry weight of the roots are measured. The results are as follows:

table 2: growth promoting effect of trichoderma hamatum MM3 on ginseng

The results show (table 2) that the dry weight of the overground stem and leaf part of the ginseng in the MM3 spore suspension-treated group is increased by 16.30% and the fresh weight is increased by 32.23% compared with the control group; the dry weight of the ginseng root is increased by 18.56 percent, and the fresh weight is increased by 50.50 percent. The trichoderma hamatum MM3 is proved to have a remarkable growth promoting effect (p is less than 0.05) on the growth of roots, stems and leaves of ginseng, and simultaneously, the trichoderma hamatum MM3 is also proved to be safe for ginseng.

Table 3: survival and disease infection conditions of hook trichoderma MM3 on ginseng seedlings

Treatment of	Survival Rate (%)	Index of disease condition
			Control group	53.80％	35.7
MM3 spore suspension	83.30％	13.3

Disease index [ Σ (number of diseased plants at each stage × representative value)/(total number of plants × highest disease-level representative value) ] × 100

The results show that (table 3), after the trichoderma hamatum microbial inoculum is applied, the defects of soil-cultivated ginseng in farmland can be overcome, the occurrence of diseases is relieved, and the seedling survival rate is ensured. The survival rate of the seedlings of the ginseng planted in the common farmland soil was 53.8%, while the survival rate of the seedlings of the MM 3-treated group was 83.3%. The disease index of the ginseng planted in the common farmland is 35.7, while the disease index of the MM3 treatment group is 13.3.

The hook-shaped trichoderma preparation can improve the farmland soil, is safe, does not influence the growth vigor of ginseng, can relieve the occurrence of diseases, ensures the seedling storage rate and promotes the accumulation of dry matters of plants.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> institute of specialty products of Chinese academy of agricultural sciences

<120> Trichoderma hamatum, microbial agent containing the same and application thereof

<130> PA20019207

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 621

<212> DNA

<213> Trichoderma hamatum (Trichoderma hamatum) MM3 rDNA-ITS

<400> 1

aagtaaaagt cgtaacaagg tctccgttgg tgaaccagcg gagggatcat taccgagttt 60

acaactccca aacccaatgt gaacgttacc aaactgttgc ctcggcgggg tcacgccccg 120

ggtgcgtaaa agccccggaa ccaggcgccc gccggaggaa ccaaccaaac tctttctgta 180

gtcccctcgc ggacgtattt cttacagctc tgagcaaaaa ttcaaaatga atcaaaactt 240

tcaacaacgg atctcttggt tctggcatcg atgaagaacg cagcgaaatg cgataagtaa 300

tgtgaattgc agaattcagt gaatcatcga atctttgaac gcacattgcg cccgccagta 360

ttctggcggg catgcctgtc cgagcgtcat ttcaaccctc gaacccctcc gggggatcgg 420

cgttggggat cgggacccct caccgggtgc cggccctgaa atacagtggc ggtctcgccg 480

cagcctctcc tgcgcagtag tttgcacaac tcgcaccggg agcgcggcgc gtccacgtcc 540

gtaaaacacc caacttctga aatgttgacc tcggatcagg taggaatacc cgctgaactt 600

aagcatatca ataagcggag g 621

Claims

1. Trichoderma hamatum (Trichoderma hamatum) strain MM3, which is deposited in China general microbiological culture Collection center, and the deposit numbers are as follows: CGMCC No. 19937; the preservation time is as follows: year 2020, month 07, and 31.

2. A microbial inoculant comprising trichoderma hamatum MM3 of claim 1.

3. The microbial agent according to claim 2, wherein the microbial agent is a solid microbial agent or a liquid microbial agent;

preferably, when the microbial agent is a solid microbial agent, the number of live bacteria of the trichoderma hamatum MM3 contained in the microbial agent is 0.5 multiplied by 10⁴To 3X 10⁵cfu·g^-1(ii) a When the microbial agent is a liquid microbial agent, the number of viable bacteria of the trichoderma hamatum MM3 contained in the microbial agent is 0.5 multiplied by 10⁴To 3X 10⁵cfu·mL^-1。

4. The microbial agent according to claim 3, wherein when the microbial agent is a solid microbial agent, the microbial agent further comprises a solid carrier.

5. The microbial inoculant according to claim 4, wherein said solid carrier comprises one or more of silica, talc, kaolin, diatomaceous earth, attapulgite, montmorillonite, bentonite and calcium carbonate.

6. The microbial inoculant according to claim 3 or 4, wherein said solid inoculant further comprises one or more of an antioxidant, a binder and a water-retaining agent;

preferably, the antioxidant is selected from one or more of vitamin C, vitamin E and citric acid;

preferably, the binder is maltose and/or dextrin;

7. Use of trichoderma hamatum MM3 according to claim 1 or a microbial agent according to any one of claims 2 to 6 for improving soil.

8. Use of trichoderma hamatum MM3 as defined in claim 1 or a microbial agent as defined in any one of claims 2 to 6 for cultivation of ginseng.

9. The application according to claim 8, wherein the application is: dipping and/or irrigating roots of the ginseng seedling with the spore suspension to promote the growth of ginseng;

preferably, the root irrigation is performed after the ginseng seedling is cultivated in the soil.

10. Use according to claim 9, wherein the spore suspension has a spore content of 0.5 x 10⁴cfu·mL^-1To 3X 10⁵cfu·mL^-1。