CN113913302B - Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria - Google Patents
Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria Download PDFInfo
- Publication number
- CN113913302B CN113913302B CN202111349795.3A CN202111349795A CN113913302B CN 113913302 B CN113913302 B CN 113913302B CN 202111349795 A CN202111349795 A CN 202111349795A CN 113913302 B CN113913302 B CN 113913302B
- Authority
- CN
- China
- Prior art keywords
- ginseng
- trichoderma atroviride
- atroviride
- trichoderma
- soil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/38—Trichoderma
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K17/00—Soil-conditioning materials or soil-stabilising materials
- C09K17/14—Soil-conditioning materials or soil-stabilising materials containing organic compounds only
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K2101/00—Agricultural use
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Botany (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Plant Pathology (AREA)
- Biomedical Technology (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Dentistry (AREA)
- General Life Sciences & Earth Sciences (AREA)
- Soil Sciences (AREA)
- Materials Engineering (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses trichoderma atroviride and application of the trichoderma atroviride in inhibiting ginseng pathogenic bacteria, and relates to the technical field of farmland ginseng planting. A trichoderma atroviride is separated and screened from soil, and the screened trichoderma atroviride is found to be capable of effectively inhibiting the growth of various ginseng pathogenic bacteria through a ginseng pathogenic bacteria bacteriostasis test. Namely, the trichoderma atroviride provided by the invention has a certain prevention and treatment effect on diseases and has a good biocontrol application prospect. In addition, the trichoderma atroviride has a remarkable growth promoting effect on the growth of roots, stems and leaves of ginseng. After the trichoderma atroviride is applied, the cultivation environment of the existing ginseng is greatly improved, and the yield and the quality of the ginseng are further improved. The trichoderma atroviride can protect the population structure of soil microorganisms.
Description
Technical Field
The invention relates to the technical field of farmland ginseng planting, in particular to trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria.
Background
Trichoderma (Trichoderma spp.) is a type of soil-inhabiting filamentous fungi distributed worldwide and has good biocontrol potential against a variety of plant diseases. The biological control mechanism mainly comprises the heavy parasitic and antibiotic action on pathogenic bacteria, competition and the growth promotion and induced resistance action on plants. At present, trichoderma atroviride aiming at ginseng pathogenic bacteria is not available.
In view of the above, the present invention is particularly proposed.
Disclosure of Invention
The invention aims to provide trichoderma atroviride and application of the trichoderma atroviride in inhibiting ginseng pathogenic bacteria so as to solve the technical problems.
The invention is realized by the following steps:
the invention provides trichoderma atroviride, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation address is as follows: the preservation time of the microbial research institute of the Chinese academy of sciences, no. three of Xilu-I, beijing, chaoyang, beijing, and the area of the morning sun: 2021, 8/19, with a deposit number: CGMCC No.23214, strain taxonomic name Trichoderma atroviride (A.viride)Trichoderma atroviride）。
In a preferred embodiment of the present invention, the Trichoderma atroviride is present in one of three forms, conidia, mycelium, conidia-containing and mycelium.
In a preferred embodiment of the present invention, the culture of Trichoderma atroviride is characterized by: culturing on PDA plate for 3 days, wherein aerial hyphae can grow over the whole culture dish; the bacterial colony has no obvious ring veins, the spore production area is uniformly distributed, and the bacterial colony is thick; conidiophores are single or clustered, green, oval or elliptical; conidiophores are single or opposite, the included angle of the branches is acute angle or approximate right angle, and phialides are directly generated at the top ends of the conidiophores; the chlamydospores are spherical or pear-shaped and have base points.
The invention also provides a microbial inoculum which comprises the trichoderma atroviride and/or spores generated after fermentation of the trichoderma atroviride.
In a preferred embodiment of the present invention, the form of the microbial agent is selected from any one of the following:
resuspended spore suspensions, powders, granules and water dispersible granules.
The invention also provides application of trichoderma atroviride or a microbial inoculum in inhibiting ginseng pathogenic bacteria.
In a preferred embodiment of the present invention, the pathogenic bacteria of ginseng are selected from at least one of the following: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A. F.) (B. F.)Sclerotinia schinseng) Ginseng anthracnose pathogenColletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) And ginseng root rot (Fusarium oxysporum)。
In a preferred embodiment of the invention, trichoderma atroviride is used in the form of a liquid, emulsion or suspension.
In an alternative embodiment, the amount of liquid, emulsion or suspension is 3X 10 8 cfu/ml-9×10 8 cfu/ml。
In the embodiment with better application, the trichoderma atroviride is prepared into powder, granules, wettable powder, water dispersible granules or seed coating agents for use;
in an alternative embodiment, the powders, granules, wettable powders, water dispersible granules or seed coating agents are used in amounts of 3X 10 8 cfu/dose-9X 10 8 cfu/dose.
The invention also provides a ginseng soil conditioner which comprises the trichoderma atroviride or the microbial inoculum.
In an alternative embodiment, the ginseng soil conditioner comprises trichoderma atroviride as a main active ingredient.
In an alternative embodiment, the ginseng soil conditioner contains Trichoderma atroviride in an amount of 1X 10 8 cfu·ml -1 ~3×10 8 cfu·ml -1 。
The invention has the following beneficial effects:
according to the invention, trichoderma atroviride is separated and screened from soil, and through ginseng pathogenic bacteria bacteriostasis tests, the screened trichoderma atroviride can effectively inhibit the growth of various ginseng pathogenic bacteria. Namely, the trichoderma atroviride provided by the invention has a certain prevention and treatment effect on diseases and has a good biocontrol application prospect.
In addition, the trichoderma atroviride has a remarkable growth promoting effect on the growth of roots, stems and leaves of ginseng. After the trichoderma atroviride is applied, the cultivation environment of the existing ginseng is greatly improved, and the yield and the quality of the ginseng are further improved. The trichoderma atroviride can protect the population structure of soil microorganisms.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a culture diagram of the Tri802 and ginseng pathogenic bacteria confronting each other;
fig. 2 is a Tri802 phylogenetic tree;
FIG. 3 is a phylogenetic classification diagram of Tri802 treated soil bacteria at the phylum level;
FIG. 4 is a phylogenetic classification diagram of Tri 802-treated soil fungi at the phylum level;
FIG. 5 shows the growth of ginseng in control soil and Tri802 treated soil;
FIG. 6 is the growth of Panax quinquefolium in control soil and Tri802 treated soil.
Detailed Description
Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.
The invention screens and separates out trichoderma atroviride which is preserved in Chinese microbial strain for preservationGeneral microbiological center of the regulatory commission, deposit address: the preservation time of the microbial research institute of the Chinese academy of sciences, no. three of Xilu-I, beijing, chaoyang, beijing, and the area of the morning sun: 2021, 8/19, with a deposit number: CGMCC No.23214, the taxonomic name of the strain is Trichoderma atrovirideTrichoderma atroviride. The biomaterial name is Tri802. The result of the detection is survival.
In a preferred embodiment of the present invention, the Trichoderma atroviride is present in one of three forms, conidia, mycelium, conidia-containing and mycelium.
The colony culture characteristics of the trichoderma atroviride are as follows: culturing on a PDA flat plate for 3 days, wherein aerial hyphae can grow over the whole culture dish, and the aerial hyphae flourish and grow fast; the bacterial colony has no obvious ring veins, the spore production area is uniformly distributed, and the bacterial colony is thick; conidiophores are single or clustered, green, oval or elliptical; conidiophores are single or opposite, the included angle of the branches is acute angle or approximate right angle, and phialides are directly generated at the tops of the conidiophores; the chlamydospores are spherical or pear-shaped and have base points.
The inventors designed primers for sequencing analysis of the rDNA-ITS sequences of the isolated strains. As can be seen by sequencing, the rDNA-ITS sequence of the strain has the length of 596bp and the sequence shown as SEQ ID NO. 1.
CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTGGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA。
The inventors further performed sequence analysis using software such as BLAST and DNMAN, and compared ITS sequences of the isolated strains by BLAST, they could find out that homology is very high in GenBankThe sequences of the similar strains. The strain with the highest similarity to the Tri802 strain isT. atrovirideHomology reaches 98%. According to MEGA6.06 software, a phylogenetic tree is constructed by an UPGMA method to find Tri802 andT. atroviridethe genetic branches belong to the same genus and have close relationship. The result of morphological classification and molecular biology identification is combined, so that the strain Tri802 screened and separated by the method is determined to be trichoderma atroviride.
The invention also provides a microbial inoculum which comprises the trichoderma atroviride and/or spores generated after the trichoderma atroviride is fermented.
In a preferred embodiment of the present invention, the form of the microbial agent includes, but is not limited to: resuspended spore suspensions, powders, granules and water dispersible granules.
The resuspended spore suspension can be prepared by resuspending Trichoderma atroviride spores with sodium carboxymethylcellulose (CMC) aqueous solution. The concentration of sodium carboxymethylcellulose can be 1-10g/L.
The inventor proves that the trichoderma atroviride or the microbial inoculum can inhibit various ginseng pathogenic bacteria through bacteriostatic experiments of the ginseng pathogenic bacteria, and has good application prospect for disease control of ginseng. Particularly, the trichoderma atroviride provided by the invention can be applied to the prevention and control of soil pathogenic bacteria of the old ginseng land, especially the prevention and control of pathogenic fungi.
The above control means that after trichoderma atroviride or a microbial inoculum is applied, pathogenic bacteria of ginseng show at least one of the following phenomena: a decrease in the number of pathogenic bacteria, a decrease in the number of types of pathogenic bacteria, inhibition or no growth of pathogenic bacteria, and the like.
The above ginseng pathogens include, but are not limited to: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogen: (A), (B)Colletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) And ginseng root rot (Fusarium oxysporum). In other embodiments, the ginseng pathogenic bacteria may also be rhizoctonia solani, phytophthora ginicola or botrytis cinerea.
In the preferred embodiment of the present invention, trichoderma atroviride may be used in the form of a liquid, emulsion or suspension. In an alternative embodiment, the trichoderma atroviride mycelium or its conidia is dispersed in a solvent, emulsifier or other dispersion medium for root irrigation, root soaking, seed soaking or spraying. The emulsifier can be a cationic emulsifier, an anionic emulsifier, or a nonionic emulsifier.
In an alternative embodiment, the trichoderma atroviride is present in the liquid, emulsion or suspension in an amount of 3 x 10 8 cfu/ml-9×10 8 cfu/ml。
In the preferred embodiment of the invention, the trichoderma atroviride is prepared into powder, granules, wettable powder, water dispersible granules or seed coating agent for use. The powder, granules, wettable powder and water dispersible granules can be bacterial powder prepared by vacuum freeze drying or bacterial powder and bacterial granules prepared by spray drying. In application, the bacterial powder is dissolved.
In an alternative embodiment, the Trichoderma atroviride content in the powder, granule, wettable powder, water dispersible granule or seed coating agent is 3X 10 8 cfu/dose-9X 10 8 cfu/dose. Before use, the powder, granules, wettable powder, water dispersible granules or seed coating agent can be diluted to a target application concentration according to needs.
The invention also provides a ginseng soil conditioner which comprises the trichoderma atroviride or the microbial inoculum.
In an alternative embodiment, the ginseng soil conditioner comprises trichoderma atroviride as a main active ingredient.
In an alternative embodiment, the ginseng soil conditioner contains Trichoderma atroviride in an amount of 1X 10 8 cfu·ml -1 ~3×10 8 cfu·ml -1 。
The situation that the soil is at least one of the following situations after the ginseng soil conditioner provided by the invention is applied is within the improvement scope of the invention: improved soil moisture conditions (e.g., improved soil compaction), increased soil organic matter resulting in increased soil fertility, increased soil beneficial microorganism abundance, and increased ginseng yield and/or quality.
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Potato dextrose agar medium (PDA) purchased from Qingdao haibo biotechnology limited, product number: HB0233.
The culture solution for fermentation is Potato Dextrose Broth (PDB). The PDB culture medium comprises: 200g/L of potato, 10g/L of glucose and 1000ml of distilled water.
The temperature of the culture is 25 ℃, the time is 96h, and the condition is 180r/min. And filtering after fermentation to obtain spores.
Example 1
This example provides Trichoderma atroviride (Trichoderma atroviride) Screening, separating and identifying method of Tri802 strain.
The trichoderma atroviride provided by the invention is separated from the ginseng rhizosphere soil of a ginseng planting base in the town of the left city of Jilin, jilin province.
The ginseng rhizosphere soil is obtained by collecting the ginseng rhizosphere soil of a ginseng planting base in the left town of Jilin city, jilin province, and the rhizosphere soil adopts a dilution coating flat plate method. Adding 10g of Ginseng radix rhizosphere soil into a conical flask containing 90mL of sterile water, oscillating for 30min on a 150r/min shaking table, sucking 1mL of uniformly mixed soil suspension from the conical flask, performing gradient dilution with sterile water, and respectively performing gradient dilution from 10g to 10g -3 、10 -4 、10 -5 And (3) sucking 200 mu L of the three gradients, adding the three gradients into a PDA culture medium plate, uniformly coating the PDA culture medium plate, culturing the plate at 25 ℃ for 3d, and picking out trichoderma single colony hyphae on the plate, transferring the trichoderma single colony hyphae to the PDA culture medium, and purifying. The purified strain was stored at 4 ℃.
On PDA culture medium, aerial hypha flourish and growThe culture dish has a fast growth speed, and can grow over the whole culture dish in 3 days. The bacterial colony has no obvious ring veins, the spore production area is evenly distributed, and the bacterial colony is thick. Conidiophores are single or clustered, green, oval or elliptical; conidiophores are single or opposite, the included angle of the branches is acute angle or approximate right angle, and phialides are directly generated at the tops of the conidiophores. Bending the bottle stalk; the chlamydospores are spherical or pear-shaped and have base points. According to the culture characteristics and morphological characteristics of the strain Tri802, the strain is preliminarily judged to be trichoderma atrovirideTrichoderma atroviride。
The inventors performed sequencing analysis of the rDNA-ITS sequence of the isolated strain by the universal primers ITS4/ITS 5. As shown by sequencing, the rDNA-ITS sequence of the strain has the length of 589bp, and the sequence is shown as SEQ ID NO. 1:
CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTGGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATA。
the inventors further performed sequence analysis using software such as BLAST and DNAMAN, and compared ITS sequences of the isolated strains by BLAST, and found similar strain sequences having very high homology in GenBank. The strain with the highest similarity to the Tri802 strain isT. atrovirideHomology reaches 98%. The fact that a phylogenetic tree (see FIG. 2) was constructed by the UPGMA method according to the MEGA6.06 software revealed that Tri802 andT. atroviridethe genetic branches of the same genus have close relationship. The result of morphological classification and molecular biology identification is combined, so that the strain Tri802 screened and separated by the method is determined to be trichoderma atroviride.
Example 2
In this example, an antagonistic action experiment of trichoderma atroviride on pathogenic bacteria of ginseng was performed.
5 pathogenic bacteria of main diseases of ginseng are selected: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A. F.) (B. F.)Sclerotinia schinseng) Ginseng anthracnose pathogen: (A), (B)Colletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) Ginseng root rot pathogen (A)Fusarium oxysporum) The five strains are provided by medicinal plant cultivation teams of special local research institute of Chinese academy of agricultural sciences. Respectively transferring the stored strain Tri802 and the pathogenic bacteria strain to a PDA (personal digital assistant) plate, culturing for 7 days at a constant temperature of 25 ℃ in the dark, and punching a bacterial cake at the edge of a bacterial colony by using a 5mm puncher. Two-point opposite plate culture method is adopted, the two-point opposite plate culture method is respectively placed on two symmetrical sides of a PDA plate, the distance between fungus cakes is 3cm, only pathogenic bacteria are inoculated as a Control (CK), each treatment is repeated for 3 times, after inoculation, the two-point opposite plate culture method is placed in a constant temperature incubator at 25 ℃ for culture for 7d, and the diameter of a bacterial colony is observed and measured.
The inhibition rate calculation formula is as follows: bacteriostatic ratio (%) = (control colony radius-treated colony radius)/control colony radius × 100%.
Referring to fig. 1, the control group and the opposing group are both cultured 7-day test pictures, the growth of the control pathogenic bacteria is fast, the trichoderma hyphae in the opposing culture rapidly occupy the growth space, the antagonistic action on the pathogenic bacteria can be observed after the opposing culture is carried out for 3 days, and the growth of the pathogenic bacteria is obviously limited; after 7 days the pathogenic bacteria were surrounded by the trichoderma and occupied the entire dish, leaving the pathogenic bacteria almost non-growing. During the plate confronting culture process, the strain Tri802 is to the ginseng sclerotinia sclerotiorum (S. schinseng) Ginseng rust rot fungus (A), (B)I. robusta) Ginseng root rot pathogen: (A. Fern)F. oxysporum) Ginseng anthracnose pathogen: (A), (B)C. panacicola) Ginseng black spot pathogenA. panax) The bacteriostasis rates of the antibacterial agent are respectively 84.47%, 88.19%, 89.33%, 91.70% and 83.75%.
Example 3
In this example, a growth promotion experiment of trichoderma atroviride on soil-cultured ginseng in farmland was performed.
In this example, the growth promoting effect of Trichoderma atroviride Tri802 strain on Ginseng radix was determined by pot culture method.
The preparation method of the strain culture solution comprises the following steps:
activating a test tube slant strain of Trichoderma atroviride Tri802, inoculating 25 mm fungus cakes into 100mL potato glucose liquid culture medium (PDB) in a 250mL triangular bottle, and culturing at 25 ℃ for 48h at 170r/min to obtain a seed solution; inoculating the Trichoderma atroviride Tri802 seed solution into a fermentation culture solution at a volume ratio of 10% for culture, and culturing at 25 ℃ for 96h at 170r/min to obtain a culture solution; filtering Trichoderma atroviride Tri802 culture solution with 2 layers of sterile gauze, counting filtrate with a blood ball counting plate, and dispersing spore suspension to 6 g.L -1 Obtaining a spore suspension with the spore content of 1 to 3 multiplied by 10 in a sodium carboxymethylcellulose (CMC) solution 8 Per ml -1 。
A preparation method of a potato dextrose liquid medium (PDB) comprises the following steps: 200g/L of potato, 10g/L of glucose and 1000mL of distilled water, wherein the pH value is 6.8-7.2. Filling 300mL of culture solution into a 1000mL triangular flask, sealing the triangular flask opening with a double-layer sealing film, performing moist heat sterilization at 121 ℃ for 30min, and cooling for later use.
Farmland soil (ordinary corn field soil without ginseng planting, impurities such as straw and stone are screened out by a 20-mesh screen before use) is filled into flowerpots with the diameter of 20cm, and each pot is filled with 2kg of soil. Annual ginseng seedlings with consistent size and good growth are selected for transplanting, 6 plants are planted in each pot, and 4 pots are processed in each pot. The prepared trichoderma atroviride Tri802 spore suspension (the bacterial content is about 1 to 3 multiplied by 10) 8 cfu·ml -1 ) Diluting 10 times of solution with sterile water, dipping the ginseng seedlings into roots with Tri802 spore suspension, planting the ginseng seedlings with culture soil, and then taking 30ml Tri802 spore suspension to irrigate the roots. The control group was given fresh PDB liquid medium.
And after the ginseng seedlings grow for 90 days, digging out the complete ginseng seedlings of the treatment group and the control group respectively, taking the root soil of each treated ginseng, extracting the total genome of the soil sample, and detecting the structural change of the soil microbial community. Observing and measuring various growth indexes of the ginseng.
The soil genomes of the Tri802 treated group and the control group were subjected to 16S sequencing to obtain 1774 and 1683 OTUs, respectively. Wherein the bacteria of the treatment group cover 33 phyla, 85 class, 180 order, 295 family and 466 genus, and the bacteria of the control group cover 33 phyla, 85 class, 183 order, 278 family and 440 genus; the ITS1 sequencing treatment group fungus covers 11 phyla, 26 class, 62 order, 118 family and 205 genus, and the control group fungus covers 9 phyla, 22 class, 54 order, 108 family and 190 genus. On the phylum level, the same three groups of the dominant bacterial flora of the soil-predominant ginseng bacteria were found in the treated group and the control group (FIG. 3), and they were Proteobacteria (32.068% -37.016%), acidobacter (22.657% -26.409%), and Chloroflexi (7.098% -7.872%). However, the bacteria Gemmatimoniadetes, verrucomicrobia, bacteriodes, firmicutes differ in their position in the soil treated with the addition of Tri802 biological agents (FIG. 3). The bacterium Proteobacteria is a key microorganism after Tri802 treatment, and the abundance of the bacterium is obviously higher than that of a control (P is less than 0.05) after the Tri802 biological agent is added.
At the phylum level, the ginseng soil fungus dominant flora of the treatment group and the control group are Ascomycota of Ascomycota, wherein Mortierella mortierella and Chytridiomycta have different positions in the two; the abundance of the fungus chytrid in the soil with the addition of Tri802 biological agents was third, while the fungus Mortierellomycota in the control soil was third (fig. 4).
From the results of the microbial diversity analysis, it was found that: proteobacteria and Chytridiomyces of the phylum bacteroides are key microorganisms for the Tri802 improved farmland ginseng cultivation.
Washing the soil at the root of the whole ginseng plant, and measuring the fresh weight of the whole ginseng plant and the fresh weight index of the root. Then, the whole plant was dried at 105 ℃ to a constant temperature, and the dry weight of the whole plant and the dry weight of the root were measured, and the statistical results are shown in the following table.
| Treatment of | Fresh weight on ground (g) | Root of Chinese scholar treeHeavy (g) | Ground dry weight (g) | Root weight (g) | Rate of stock of seedlings |
| Tri802 | 1.07±0.20 a | 1.50±0.10 a | 0.33±0.03 a | 0.43±0.03 a | 66.7% |
| CK | 0.9±0.05 b | 1.56±0.12 a | 0.15±0.02 b | 0.36±0.05 b | 50% |
As can be seen from the above table, after the growth cycle of ginseng is finished, the ginseng has developed fibrous roots, the seedling rate is 66.7%, and the control group is 50% in terms of the overall growth vigor of the ginseng. The seedling storage rate can be effectively ensured by the root irrigation treatment of trichoderma atroviride. The fresh mass ratio CK of the ginseng processed by the Tri802 is increased by 4.47%, and the dry mass ratio CK of the ginseng is increased by 49.02%. The application of trichoderma atroviride Tri802 is beneficial to the accumulation of dry matters of the ginseng and has obvious growth promotion effect on the ginseng.
The biocontrol bacterium trichoderma atroviride is screened and separated, and the microbial inoculum is applied in the process of soil cultivation of ginseng in a farmland to plant ginseng seedlings, so that the seedling storage rate can be effectively ensured, and the biocontrol bacterium trichoderma atroviride has a remarkable growth promoting effect on the growth of roots, stems and leaves of ginseng. The trichoderma atroviride provided by the invention can prevent and treat main diseases of ginseng and has a certain growth promoting effect on ginseng. The trichoderma atroviride screened by the method lays a good foundation for sustainable development of the ginseng industry.
Example 4
In this example, an experiment of the effect of trichoderma atroviride on controlling ginseng blight was performed.
The ginseng withered leaf disease is mainly characterized in that ginseng is planted in soil of a farmland, after leaves expand and flower in a growing period, leaves are withered and curled from leaf tips or edges, gradually spread to main leaf veins and leaf stalks, tend to expand from old leaves to new leaves, and finally the whole plant withers on the ground. Seriously affecting plant photosynthesis, resulting in drastic decrease in ginseng yield and quality.
The experimental procedure was as in example 3.
The results show (fig. 5): the control group shows dry leaf apex and edge, namely ginseng blight, and the symptoms of the ginseng blight of the treatment group added with the Tri802 are hardly or slightly relieved, which shows that the Tri802 can effectively relieve the occurrence of the farmland soil-planted ginseng blight.
Example 5
In this example, an experiment of the control effect of trichoderma atroviride on american ginseng blight was performed.
The American ginseng leaf blight is similar to the occurrence situation of ginseng leaf blight, and because the American ginseng leaf blight is planted in farmland soil, after the leaves expand and bloom in the growth period, the leaves are withered and curled from the leaf tips or edges, gradually spread to the main leaf vein and the leaf stalks, the trend is expanded from old leaves to new leaves, and finally the whole plant is partially withered on the ground. Seriously affecting the photosynthesis of plants, resulting in the decrease of the yield of American ginseng.
Selecting a land block for soil culture of American ginseng in a farmland as a test base, setting the area of a treatment cell to be 1.5m multiplied by 1.5m, and repeating each treatment for 3 times; the root of the Trichoderma atroviride Tri802 spore suspension is applied in 5 th of the month, and the spore suspension (the bacterial content is about 1 to 3 multiplied by 10) 8 cfu·ml -1 ) After 10-fold dilution, the mixture was applied once at intervals of 10 to 15d for 3 times. And observing the growth condition of the American ginseng.
The results of the survey showed (fig. 6): the control group without any treatment has dry leaf tips and edges, namely American ginseng leaf blight, and the incidence degree of the leaf blight of the Tri802 treatment group is obviously lower than that of the control group. The Tri802 can effectively relieve the occurrence of American ginseng leaf blight.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> institute of specialty products of Chinese academy of agricultural sciences
<120> application of trichoderma atroviride and ginseng pathogenic bacteria inhibition
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 596
<212> DNA
<213> Artificial sequence
<400> 1
caaggtctcc gttggtgaac cagcggaggg atcattaccg agtttacaac tcccaaaccc 60
aatgtgaacc ataccaaact gttgcctcgg cggggtcacg ccccgggtgc gtcgcagccc 120
cggaaccagg cgcccgccgg agggaccaac caaactcttt ctgtggtccc ctcgcggacg 180
ttatttctta cagctctgag caaaaattca aaatgaatca aaactttcaa caacggatct 240
cttggttctg gcatcgatga agaacgcagc gaaatgcgat aagtaatgtg aattgcagaa 300
ttcagtgaat catcgaatct ttgaacgcac attgcgcccg ccagtattct ggcgggcatg 360
cctgtccgag cgtcatttca accctcgaac ccctccgggg ggtcggcgtt ggggatcggg 420
aacccctaag acgggatccc ggccccgaaa tacagtggcg gtctcgccgc agcctctcct 480
gcgcagtagt ttgcacaact cgcaccggga gcgcggcgcg tccacgtccg taaaacaccc 540
aacttctgaa atgttgacct cggatcaggt aggaataccc gctgaactta agcata 596
Claims (13)
1. Trichoderma atroviride (T. Atroviride) ((A. Atroviride))Trichoderma atroviride) Tri802, its specialCharacterized by the fact that the deposit address: the preservation time of the microbial research institute of the Chinese academy of sciences, no. three of Xilu-I-Beijing, chaoyang, beijing, beicheng district, is as follows: 2021, 8/19, with a deposit number of: CGMCC No.23214, the taxonomic name of the strain is Trichoderma atrovirideTrichoderma atroviride。
2. A microbial preparation comprising Trichoderma atroviride according to claim 1 and/or spores produced by fermentation of Trichoderma atroviride according to claim 1.
3. The microbial inoculum according to claim 2, wherein the form of the microbial inoculum is selected from any one of the following forms:
resuspending spore suspension, powder, granule.
4. The microbial inoculum according to claim 2, wherein the form of the microbial inoculum is selected from water dispersible granules.
5. Use of trichoderma atroviride according to claim 1 or a bacterial agent according to any one of claims 2 to 4 for inhibiting a ginseng pathogen selected from at least one of: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogenColletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) And Ginseng root rot (C. Ex Fr.) (Fusarium oxysporum)。
6. The use according to claim 5, wherein the Trichoderma atroviride is prepared for use as a liquid formulation.
7. Use according to claim 6, characterized in that the liquor has a Trichoderma atroviride content of 3 x 10 8 cfu/ml-9×10 8 cfu/ml。
8. The use according to claim 5, wherein the Trichoderma atroviride is used in the form of an emulsion or suspension.
9. The use according to claim 5, wherein the Trichoderma atroviride is used in the form of a powder, granules or seed coating.
10. Use according to claim 9, wherein the trichoderma atroviride is present in the powder, granule or seed coating in an amount of 3 x 10 8 cfu/dose-9X 10 8 cfu/dose.
11. A ginseng soil conditioner, characterized by comprising Trichoderma atroviride according to claim 1 or a microbial agent according to any one of claims 2 to 4.
12. The ginseng soil conditioner according to claim 11, wherein the ginseng soil conditioner comprises the trichoderma atroviride as a main active ingredient.
13. A soil amendment according to claim 12, wherein the soil amendment contains trichoderma atroviride in an amount of 1 x 10 8 cfu/ml~3×10 8 cfu/ml。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111349795.3A CN113913302B (en) | 2021-11-15 | 2021-11-15 | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111349795.3A CN113913302B (en) | 2021-11-15 | 2021-11-15 | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113913302A CN113913302A (en) | 2022-01-11 |
| CN113913302B true CN113913302B (en) | 2022-12-23 |
Family
ID=79246682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111349795.3A Active CN113913302B (en) | 2021-11-15 | 2021-11-15 | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113913302B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114644986B (en) * | 2022-03-29 | 2023-05-12 | 云南农业大学 | Trichoderma atroviride and application thereof in prevention and treatment of pseudo-ginseng diseases |
| CN114806892B (en) * | 2022-04-28 | 2023-05-16 | 云南省农业科学院生物技术与种质资源研究所 | Trichoderma atroviride strain and application thereof in preventing and treating root rot of pseudo-ginseng |
| CN115074254B (en) * | 2022-06-23 | 2023-08-22 | 中国科学院天津工业生物技术研究所 | Trichoderma atroviride for biocontrol and application thereof in agricultural field |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2016056197A (en) * | 2016-01-12 | 2016-04-21 | 住友化学株式会社 | Pest control composition and use thereof |
| CN110564627A (en) * | 2019-09-23 | 2019-12-13 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma strain HB20111 for preventing and treating soil-borne diseases of American ginseng and improving yield and application thereof |
-
2021
- 2021-11-15 CN CN202111349795.3A patent/CN113913302B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2016056197A (en) * | 2016-01-12 | 2016-04-21 | 住友化学株式会社 | Pest control composition and use thereof |
| CN110564627A (en) * | 2019-09-23 | 2019-12-13 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Trichoderma strain HB20111 for preventing and treating soil-borne diseases of American ginseng and improving yield and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 6株木霉菌对人参锈腐病的防治效果;周淑香等;《中国生物防治》;20101115;全文 * |
| 木霉对5种病原菌抑菌活性筛选;郎八一等;《生物灾害科学》;20130630(第02期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113913302A (en) | 2022-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055281B (en) | Bacillus belgii ZF2 and application thereof in plant disease control | |
| CN105886428B (en) | One plant of Streptomycesalbidoflhaving and its application in microbial manure | |
| CN113913302B (en) | Trichoderma atroviride and application thereof in inhibiting ginseng pathogenic bacteria | |
| CN110982725B (en) | Bacillus for antagonizing fusarium wilt and promoting growth and application thereof | |
| CN114196553B (en) | Aureobasidium sp MR-57 and application thereof | |
| CN113913301B (en) | Trichoderma harzianum, microbial inoculum and application thereof | |
| CN113249242A (en) | Paenibacillus polymyxa and application thereof in prevention and treatment of various soil-borne diseases | |
| CN108570432B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN109112069B (en) | Biocontrol endophytic fungus and application thereof | |
| CN105132296B (en) | A kind of hook-shaped trichoderma strain and its application | |
| CN105154339B (en) | A kind of Trichoderma viride bacteria strain and its application | |
| CN114907986A (en) | Trichoderma harzianum and application thereof in preparation for preventing and treating root rot of panax notoginseng | |
| CN114574369B (en) | Acremonium persicinum MR-47 and application thereof | |
| CN112342173A (en) | Bacillus belgii and application thereof | |
| CN117757700B (en) | Bacillus bailii and application thereof | |
| CN116987615B (en) | Lecaniella albopictus YZ-151 and application thereof | |
| CN111808778A (en) | Bacillus wegener for preventing and treating verticillium wilt and culture method thereof, microbial inoculum and preparation method and application thereof | |
| CN114806892B (en) | Trichoderma atroviride strain and application thereof in preventing and treating root rot of pseudo-ginseng | |
| CN114134053B (en) | Aspergillus ascomycete MR-86 and application thereof | |
| CN104593284B (en) | One plant of Endophyte of walnut and its application | |
| CN115873770A (en) | Bacillus belgii and application thereof in prevention and treatment of tomato diseases | |
| CN113881578B (en) | Trichoderma viride and application thereof as soil conditioner for panax plants | |
| CN113913304B (en) | Bacteriostatic agent for pathogenic bacteria of trichoderma brevicompactum and ginseng and application thereof | |
| CN113913303B (en) | Trichoderma pseudokoningii, root soaking solution and application | |
| CN105132295B (en) | A kind of plan T. harzianum strains and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |