CN113881578B

CN113881578B - Trichoderma viride and application thereof as soil conditioner for panax plants

Info

Publication number: CN113881578B
Application number: CN202111347796.4A
Authority: CN
Inventors: 王秋霞; 马莹莹; 金桥; 潘晓曦; 刘政波; 张舒娜
Original assignee: Institute Special Animal and Plant Sciences CAAS
Current assignee: Institute Special Animal and Plant Sciences CAAS
Priority date: 2021-11-15
Filing date: 2021-11-15
Publication date: 2022-12-16
Anticipated expiration: 2041-11-15
Also published as: CN113881578A

Abstract

The invention discloses a soil conditioner for trichoderma viride and panax plants and application thereof, and relates to the field of farmland ginseng planting. The trichoderma viride separated by the method has an antagonistic effect on various ginseng pathogenic bacteria, and can prevent and treat various plant fungal diseases. Is beneficial to reducing the harm of diseases to the ginseng yield and improving the ginseng yield and quality. In addition, the trichoderma viride provided by the invention can ensure the seedling storage rate and has a remarkable growth promotion effect on the growth of roots, stems and leaves of ginseng.

Description

Trichoderma aureoviride and application thereof as soil conditioner for panax plants

Technical Field

The invention relates to the field of farmland ginseng planting, in particular to a soil conditioner for trichoderma viride and panax plants and application thereof.

Background

At present, the ginseng planting mode mainly takes farmland ginseng as a main mode, and the problems of low yield, serious diseases and the like exist in the farmland ginseng planting mode. The soil is improved by methods of chemical soil disinfection, nutrient element increase, organic fertilizer application increase and the like, the improvement effect is limited, and the yield of the ginseng cultivated in farmland cannot be effectively improved. The chemical agent for preventing and treating diseases has the problems of drug residue, environmental pollution and the like. The existing patent CN201610030213.8 utilizes that allicin aqueous emulsion has antibacterial and bactericidal effects, and can control the occurrence of ginseng soil-borne diseases, however, the patent requires the cooperation of fermentation product of straw bean cake and compound of garlic microemulsion and wheat bran, and has the defects of complex ingredients, limited application range, etc.

Trichoderma spp is distributed worldwide, has rich species and is mainly present in wet habitats such as forests, trench slopes, farmlands, grasslands and the like. At present, more than 50 kinds of trichoderma biocontrol agents or bacterial manure products are registered internationally and are commercially produced, so that the trichoderma biocontrol agents or bacterial manure products are widely used for preventing and treating various plant fungal diseases and play an important role in agricultural production.

Trichoderma biocontrol mechanisms include parasitism, antibiotics, and competition. When the trichoderma is heavily parasitic on host fungi, specific lectin on the cell surface of the host fungi determines the transformation relation between the trichoderma and the fungi, and researches show that after parasitic hyphae are removed, dissolving sites and puncture holes exist on pathogenic hyphae. By antibiotic action is meant that trichoderma produces antibiotics and some enzymes and chemicals during metabolism, which can poison phytopathogenic fungi. The competitive action means that trichoderma and pathogenic bacteria compete for growth space and nutrition, and the trichoderma has stronger adaptability relative to other pathogenic bacteria in severe environment.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a soil conditioner for trichoderma viride and panax plants and application thereof to solve the technical problems.

The invention is realized by the following steps:

the invention provides trichoderma viride, which is preserved in a microorganism strain preservation center at the preservation address: the preservation date of the institute of microbiology of the Chinese academy of sciences, no. three of Xilu-I, beijing, chaoyang, beijing, is: 2021, 8/19, with a deposit number: CGMCC No.23212, and the taxonomic name of the strain Trichoderma aureoviride (A) (Trichoderma viridescens）。

In a preferred embodiment of the present invention, the Trichoderma viride is present in one of three forms, conidia, mycelium, conidia-containing and mycelium.

In a preferred embodiment of the present invention, the colony culture of trichoderma viride is characterized by: culturing on PDA culture medium for 5 days, wherein white aerial mycelium is exuberant, and grows in loose shape by radiation, and the aerial mycelium at the edge of colony gradually thickens and becomes villous without diffusion pigment; in the later culture period, the hyphae are extended to form green conidia, the conidia cluster, and the diameters of the conidia are (3.2-3.9) Mumx (4.5-5.1) Mum; chlamydospores are approximately round, (9.5 to 10.8) μmx (10 to 11.5) μm.

The invention also provides application of trichoderma viride in inhibiting ginseng pathogenic bacteria.

In a preferred embodiment of the present invention, the pathogenic bacteria of ginseng are selected from at least one of the following: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogen: (A), (B)Colletotrichum panacicola) Ginseng rust rot fungus (A. Exsiccata)Ilyonectria robusta) And Ginseng root rot (C. Ex Fr.) (Fusarium oxysporum)。

In a preferred embodiment of the present invention, the trichoderma viride is used as a liquid, emulsion or suspension.

In an alternative embodiment, the liquid, emulsion or suspension is used in an amount of 3X 10 ⁹ cfu/strain-9X 10 ⁹ cfu/strain.

In a preferred embodiment of the application of the invention, the trichoderma viride is prepared into powder, granules, wettable powder, water dispersible granules or seed coating agents for use.

In an alternative embodiment, the powder, granules, wettable powder, water dispersible granules or seed coating is used in an amount of 3X 10 ⁹ cfu/strain-9X 10 ⁹ cfu/strain.

The invention also provides a soil conditioner for the plants in the panax, which comprises the trichoderma viride.

In a preferred embodiment of the present invention, the soil conditioner for plants belonging to genus Panax is mainly composed of Trichoderma viride.

In a preferred embodiment of the present invention, the soil conditioner for Panax plants contains Trichoderma viride in an amount of 1 × 10 ⁸ cfu·ml ^-1 ~3×10 ⁸ cfu·ml ^-1 。

The invention has the following beneficial effects:

the trichoderma viride separated by the method has an antagonistic effect on various ginseng pathogenic bacteria and can prevent and treat various plant fungal diseases. Is beneficial to reducing the harm of diseases to the ginseng yield and improving the ginseng yield and quality. In addition, the trichoderma viride provided by the invention can ensure the seedling survival rate and has a remarkable growth promotion effect on the growth of roots, stems and leaves of ginseng.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and those skilled in the art can also obtain other related drawings based on the drawings without inventive efforts.

FIG. 1 is a plate diagram of the cultivation of Tri403 against pathogenic bacteria of ginseng;

FIG. 2 is a Tri403 phylogenetic tree;

FIG. 3 is a phylogenetic classification diagram of Tri403 treated soil bacteria at the phylum level;

FIG. 4 is a phylogenetic classification diagram of Tri 403-treated soil fungi at the phylum level;

FIG. 5 shows the growth of ginseng in control soil and Tri 403-treated soil;

FIG. 6 is the growth of Panax quinquefolium in control soil and Tri403 treated soil.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

The invention screens and separates trichoderma viride, which is preserved in a microorganism strain preservation center at the preservation address: the preservation date of the Xilu Hospital No. three of Beijing Chaoyang district, beijing: no. 8/19 in 2021, with a deposit number: CGMCC No.23212, and the taxonomic name of the strain Trichoderma aureoviride (A) (Trichoderma viridescens) The biomaterial name is Tri403.

The trichoderma viride can be in the form of any one of the following: conidium and mycelium, and simultaneously contains conidium and mycelium.

In a preferred embodiment of the present invention, the colony culture of trichoderma viride is characterized by: culturing on PDA culture medium for 5 days, wherein white aerial mycelium flourishes, the mycelium grows in loose state by radiation, the aerial mycelium at the edge of colony gradually thickens and becomes villous, and no diffusion pigment is seen; at the later stage of culture, hyphae are extended to form green conidia, the conidia are clustered, and the diameters of the conidia are (3.2-3.9) Mumx (4.5-5.1) Mum; conidiophores are in a stem cone shape, lateral branches are close to 90 degrees with a main shaft, and pear-shaped phialides are generated at the tops of conidiophores; chlamydospores are approximately round, (9.5 to 10.8) μmx (10 to 11.5) μm.

The inventors designed primers and performed sequencing analysis on the rDNA-ITS sequences of the isolated strains. As can be seen by sequencing, the rDNA-ITS sequence of the strain has the length of 596bp and the sequence shown as SEQ ID NO. 1.

ACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGTCCGGCGTTGGGGATCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCAT。

The inventors further performed sequence analysis using software such as BLAST and DNAMAN, and compared ITS sequences of the isolated strains by BLAST, and found similar strain sequences having very high homology in GenBank. The strain with the highest similarity to the strain Tri403 is trichoderma viride (t. Virides scienns), and the homology reaches 99%. According to MEGA6.06 software, a phylogenetic tree is constructed by an UPGMA method, and the genetic branch of the same genus of Tri403 and T. viridescens is found to be very close in genetic relationship. Combining the results of morphological classification and molecular biological identification, the strain Tri403 of the invention can be confirmed to be Trichoderma viride.

Experiments prove that the trichoderma viride provided by the invention can inhibit various ginseng pathogenic bacteria and has a good application prospect in disease control of ginseng. Particularly, the trichoderma viride provided by the invention can be applied to the prevention and control of soil pathogenic bacteria of the old ginseng land, especially the prevention and control of pathogenic fungi.

In addition, the prevention and treatment mean that after trichoderma viride is applied, pathogenic bacteria of ginseng show at least one phenomenon that: a decrease in the number of pathogenic bacteria, a decrease in the types of pathogenic bacteria, inhibition or no growth of pathogenic bacteria, and the like.

In a preferred embodiment of the present invention, the ginseng pathogens include, but are not limited to: ginseng, black Spot pathogen: (A), (B)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogenColletotrichum panacicola) Ginseng rust rot fungus (A. Exsiccata)Ilyonectria robusta) And Ginseng root rot (C. Ex Fr.) (Fusarium oxysporum)。

In other embodiments, the pathogenic bacteria may also be rhizoctonia solani, phytophthora ginicola or botrytis cinerea.

In an alternative embodiment, the amount of liquid, emulsion or suspension is 3X 10 ⁹ cfu/strain-9X 10 ⁹ cfu/strain.

In an alternative embodiment, the Trichoderma viride mycelium or conidia thereof is dispersed in a solvent, emulsifier or other dispersion medium for root irrigation, root soaking, seed soaking or spraying.

In a preferred embodiment of the application of the invention, the trichoderma viride is prepared into powder, granules, wettable powder, water dispersible granules or seed coating agents for use. The powder, granules, wettable powder and water dispersible granules can be bacterial powder prepared by vacuum freeze drying or bacterial powder and bacterial granules prepared by spray drying. When in use, the bacterial powder is dissolved.

The invention also provides a soil conditioner for the plants in the panax, which comprises the trichoderma viride. The above genus Panax plants include, but are not limited to: ginseng, american ginseng, pseudo-ginseng, pseudoginseng, panax japonicus, etc.

In a preferred embodiment of the present invention, the soil conditioner for plants of genus Panax is mainly composed of Trichoderma viride.

The inventor finds that the trichoderma viride is applied to soil, so that the population structure of soil microorganisms can be protected, the stability of the soil microorganism population can be maintained, and the biological abundance of beneficial microorganisms in the soil can be improved. Through soil improvement, the seedling survival rate of ginseng can be improved, and the ginseng seedling-cultivating substrate has a remarkable growth-promoting effect on the growth of roots, stems and leaves of ginseng.

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Potato dextrose agar medium (PDA) was purchased from Qingdao Haibo biotechnology limited, product number: HB0233.

The fermentation broth is Potato Dextrose Broth (PDB). The PDB culture medium comprises: 200g/L of potatoes, 10g/L of glucose and 1000ml of distilled water.

The culture temperature is 25 ℃, the culture time is 96h, and the culture condition is 180r/min.

After fermentation, spores are obtained by filtration.

Example 1

This example provides Trichoderma aureoviride (T. Glaucus) ((T. Glaucus))Trichoderma viridescens) A screening, separating and identifying method of Tri403 strain.

The trichoderma viride provided by the invention is separated from the ginseng rhizosphere soil of a ginseng planting base in the town of the left city of Jilin, jilin province.

Collecting Ginseng radix rhizosphere soil from Ginseng radix rhizosphere soil of Ginseng radix planting base of left town of Jilin city, jilin province, diluting and coating with flat plate method, adding 10g Ginseng radix rhizosphere soil into conical flask containing 90mL sterile water, oscillating for 30min on 150r/min shaking table, sucking 1mL uniformly mixed soil suspension from conical flask, diluting with sterile water in gradient, and respectively diluting from 10 ^-3 、10 ^-4 、10 ^-5 And (3) sucking 200 mu L of the three gradients, adding the three gradients into a PDA culture medium plate, uniformly coating the PDA culture medium plate, culturing the plate at 25 ℃ for 3d, and picking out trichoderma single colony hyphae on the plate, transferring the trichoderma single colony hyphae to the PDA culture medium, and purifying. The purified strain was stored at 4 ℃.

On PDA medium, white aerial hyphae flourish and can cover the whole dish in 5 days. The hyphae grow in a loose shape by radiation, and aerial hyphae at the edge of the colony gradually thicken and are villous, and no diffused pigment is seen. Conidiophores are conical, lateral branches are close to 90 degrees with a main shaft, and pear-shaped phialides are generated at the tops of the conidiophores; conidia are green, oval or oval, cluster, and produce a random conidial mass at the edge of the culture dish. The diameter size is (3.2-3.9) mum multiplied by (4.5-5.1) mum; chlamydosporeThe circle is approximately (9.5 to 10.8) μmx (10 to 11.5) μm. According to the culture characteristics and morphological characteristics of the strain Tri403, preliminarily determining that the strain is Trichoderma virideTrichoderma viridescens。

The inventors designed primers and performed sequencing analysis on the rDNA-ITS sequences of the isolated strains. As can be seen by sequencing, the rDNA-ITS sequence of the strain has the length of 596bp and has a sequence shown as SEQ ID NO. 1:

the inventors further performed sequence analysis using software such as BLAST and DNAMAN, and compared ITS sequences of the isolated strains by BLAST, and found similar strain sequences having very high homology in GenBank. The strain with the highest similarity to the Tri403 strain is T. viridescens, and the homology reaches 99%. The fact that the phylogenetic tree (see FIG. 2) was constructed by the UPGMA method according to the MEGA6.06 software revealed that the Tri403 and the Tri403 are presentT. viridescensThe genetic branches belong to the same genus and have close relationship. The result of morphological classification and molecular biological identification is combined, and the strain Tri403 of the invention is confirmed to be Trichoderma viride.

Example 2

In this example, an antagonistic action experiment of Trichoderma viride on pathogenic bacteria of Ginseng radix was performed.

5 pathogenic bacteria of main diseases of ginseng are selected: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogenColletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) Ginseng root rot pathogen (A)Fusarium oxysporum) The five strains are provided by medicinal plant cultivation teams of special local research institute of Chinese academy of agricultural sciences. Respectively transferring the preserved trichoderma Tri403 and pathogenic bacteria strains to a PDA (personal digital assistant) plate, culturing for 7 days at a constant temperature of 25 ℃ under a dark condition, and punching fungus cakes on the edges of colonies by using a 5mm puncher. Adopting two-point opposite plate culture method, respectively placing on two symmetrical sides of PDA plate, spacing of fungus cake is 3cm, inoculating pathogenic bacteria only as Control (CK), repeating each treatment for 3 times, placing in constant temperature incubator at 25 deg.C, culturing for 7d, observing and measuring diameter of bacterial colony.

The inhibition rate calculation formula is as follows: bacteriostatic ratio (%) = (control colony radius-treated colony radius)/control colony radius × 100%.

Referring to fig. 1, the control group and the opposing group are test pictures cultured for 7 days, the growth of the control pathogenic bacteria is fast, trichoderma hyphae in the opposing plate culture quickly occupy the growth space, the antagonistic action on the pathogenic bacteria can be observed after the opposing culture is carried out for 3 days, and the growth of the pathogenic bacteria is obviously limited; after the culture for 7 days, the trichoderma surrounds the pathogenic bacteria and occupies the whole culture dish, so that the pathogenic bacteria hardly grow any more. During the plate confronting culture process, the strain Tri403 is to the ginseng sclerotinia sclerotiorum (S. schinseng) Ginseng anthracnose pathogen: (A), (B)C. panacicola) Ginseng rust rot fungus (A), (B)I. robusta) Ginseng black spot pathogenA. panax) And ginseng root rot (F. oxysporum) The bacteriostasis rates of the antibacterial agent are respectively 87.29%, 88.73%, 90.12%, 83.34% and 88.47%. Therefore, the screened trichoderma viride has a good bacteriostatic effect.

Example 3

In this example, a growth promotion experiment of Trichoderma viride in soil-cultured ginseng in a farmland was performed.

In this example, the growth promoting effect of Trichoderma viride Tri403 strain on Ginseng radix was determined by pot culture test.

The preparation method of the strain culture solution comprises the following steps: activating the slant strain of Trichoderma viride Tri403 in test tube, inoculating 25 mm fungus cakes into 100mL potato glucose liquid culture medium (PDB) in 250mL triangular flask, and culturing at 25 deg.C at 170r/minCulturing for 48h to obtain seed liquid; inoculating the Trichoderma viride Tri403 seed solution into the fermentation culture solution at a volume ratio of 10% for culture, and culturing at 25 ℃ for 96h at 170r/min to obtain a culture solution; filtering the Trichoderma viride Tri403 culture solution with 2 layers of sterile gauze, counting the filtrate with a blood ball counting plate, and dispersing the spore suspension to 6 g.L ^-1 Sodium carboxymethylcellulose (CMC) solution to obtain a spore suspension with the spore content of 1 to 3 multiplied by 10 ⁸ Per ml ^-1 。

A preparation method of a potato dextrose liquid medium (PDB) comprises the following steps: 200g/L of potato, 10g/L of glucose and 1000mL of distilled water, wherein the pH value is 6.8-7.2. Filling 300mL of culture solution into a 1000mL triangular flask, sealing the triangular flask opening with a double-layer sealing film, performing moist heat sterilization at 121 ℃ for 30min, and cooling for later use.

Farmland soil (ordinary corn field soil without ginseng planting, impurities such as straw and stone are screened out by a 20-mesh screen before use) is filled into flowerpots with the diameter of 20cm, and each pot is filled with 2kg of soil. Annual ginseng seedlings with consistent size and good growth are selected for transplanting, 6 plants are planted in each pot, and 4 pots are processed in each pot. The prepared Trichoderma viride Tri403 spore suspension (the bacterial content is about 1 to 3 multiplied by 10) ⁸ cfu·ml ^-1 ) Diluting 10 times of solution with sterile water, dipping the ginseng seedlings into roots with the Tri403 spore suspension, and irrigating roots with 30ml of the Tri403 spore suspension after the cultivation of the soil. The control group was given fresh PDB liquid medium.

And after the ginseng seedlings grow for 90 days, digging out the complete ginseng seedlings of the treatment group and the control group, taking the root soil of each treatment ginseng, extracting the total genome of the soil sample, and detecting the structural change of the soil microbial community. Observing and measuring various growth indexes of the ginseng.

The soil genomes of the Tri 403-treated and control groups were 16S sequenced to yield 1819 and 1683 OTUs, respectively. Wherein the treatment group bacteria comprises 32 phyla, 85 class, 172 order, 294 family and 464 genus, and the control group bacteria comprises 29 phyla, 81 class, 172 order, 278 family and 440 genus; the ITS1 sequencing treatment group fungi covers 10 phyla, 24 class, 59 order, 114 family and 213 genus, and the control group fungi covers 9 phyla, 22 class, 54 order, 108 family and 190 genus. On the phylum level, the same three positions of the dominant bacterial flora of the soil-predominant ginseng bacteria were found in the treatment group and the control group (FIG. 3), in the order Proteobacteria (32.068% -38.206%), acidobacter (24.241% -26.409%) and Chloroflexi (7.098% -7.272%). However, proteobacteria, acidobacter, gemmidomonades, bacteroides, firmicutes, patescibacteria, actinobacilla, of Bacteroides, differ in their position in the soil treated with the addition of Tri403 (FIG. 3). Proteobacteria in bacteria is a key microorganism after Tri403 treatment, and the abundance of the Proteobacteria is remarkably higher than that of a control (P is less than 0.05) after the Tri403 biological agent is added.

On the phylum level, the ginseng soil fungus dominant flora of the treatment group and the control group are Ascomycota Ascomycota, wherein the Basidiomycota and the Mortierella mortierella do not have the same status in two different treatments; the abundance of Basidiomycota and Mortierellomycota of the fungi in the soil added with the Tri403 biological agent is obviously higher than that of a control group (figure 4).

Analysis from microbial diversity results: the fungi Basidiomycota, mortierella and bacterium Proteobacteria are key microorganisms for improving farmland cultivated ginseng by Tri403.

Washing the soil at the root of the whole ginseng plant, and measuring the fresh weight of the whole ginseng plant and the fresh weight index of the root. Then, the plant was dried at 105 ℃ to a constant temperature, and the dry weight of the whole plant and the dry weight of the root were measured, and the statistical results are shown in the following table.

Treatment of	Fresh weight on ground (g)	Fresh weight of root (g)	Ground dry weight (g)	Root dry weight (g)	Rate of stock of seedlings
						Tri403	1.01±0.1 a	1.70±0.12 a	0.24±0.06 a	0.45±0.03 a	72.2%
CK	0.9±0.05 a	1.56±0.12 b	0.15±0.02 b	0.36±0.05 b	50%

As can be seen from the table above, after a growth cycle of ginseng is finished, from the overall growth vigor of ginseng, the fibrous roots are developed, the seedling rate is 72.2%, the contrast group is only 50%, and the seedling rate can be effectively ensured through the root irrigation treatment of trichoderma viride. The fresh mass ratio CK of the ginseng processed by the Tri403 is increased by 44.8%, and the dry mass ratio CK of the ginseng is increased by 26.1%. The application of the Tri403 is beneficial to the accumulation of dry matter of the ginseng and has remarkable growth promotion effect on the ginseng.

Example 4

In this example, an experiment of the prevention and treatment effect of Trichoderma viride on ginseng bacterial blight was performed.

The ginseng withered leaf disease is mainly characterized in that ginseng is planted in soil of a farmland, after leaves expand and flower in a growing period, leaves are withered and curled from leaf tips or edges, gradually spread to main leaf veins and leaf stalks, tend to expand from old leaves to new leaves, and finally the whole plant withers on the ground. Seriously affecting plant photosynthesis, resulting in drastic decrease in ginseng yield and quality.

The experimental procedure was as in example 3.

The results show (fig. 5): the control group shows withered leaf tips and edges, namely ginseng withered leaf disease, and the symptoms of the ginseng withered leaf disease of the treatment group added with the Tri403 are hardly or slightly relieved, which shows that the Tri403 can effectively relieve the occurrence of the farmland soil-planted ginseng withered leaf disease.

Example 5

In this example, an experiment of the control effect of trichoderma viride on american ginseng blight was performed.

The American ginseng leaf blight is similar to the occurrence situation of ginseng leaf blight, and because the American ginseng leaf blight is planted in farmland soil, after the leaves expand and bloom in the growth period, the leaves are withered and curled from the leaf tips or edges, gradually spread to the main leaf vein and the leaf stalks, the trend is expanded from old leaves to new leaves, and finally the whole plant is partially withered on the ground. Seriously affecting the photosynthesis of the plant, resulting in the decrease of the yield of the American ginseng.

Selecting a land block for soil culture of American ginseng in a farmland as a test base, setting the area of a treatment cell to be 1.5m multiplied by 1.5m, and repeating each treatment for 3 times; in late 5 months, a Trichoderma viride Tri403 spore suspension is applied for root irrigation, and the spore suspension (the bacterial content is about 1 to 3 multiplied by 10) ⁸ cfu·ml ^-1 ) After 10-fold dilution, the mixture was applied once at intervals of 10 to 15d for 3 times. And observing the growth condition of the American ginseng.

The results of the survey showed (fig. 6): the control group without any treatment has dry leaf tips and edges, namely American ginseng blight, and the degree of blight of the Tri403 treatment group is obviously lower than that of the control group. The Tri403 can effectively relieve the occurrence of American ginseng leaf blight.

According to the invention, a biocontrol bacterium trichoderma viride is screened out, and the microbial inoculum is applied in the process of soil planting ginseng in a farmland to plant ginseng seedlings, so that the seedling survival rate can be effectively ensured, and the biocontrol bacterium trichoderma viride has a remarkable growth promoting effect on the growth of roots, stems and leaves of ginseng. In addition, trichoderma viride has obvious inhibition effect on pathogenic bacteria of several main diseases of ginseng, which indicates that trichoderma viride is safe to ginseng and has certain prevention and treatment effect on diseases.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> institute of specialty products of Chinese academy of agricultural sciences

<120> soil conditioner for Trichoderma viride and Panax plants and application thereof

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 596

<212> DNA

<213> Artificial sequence

<400> 1

acaaggtctc cgttggtgaa ccagcggagg gatcattacc gagtttacaa ctcccaaacc 60

caatgtgaac cataccaaac tgttgcctcg gcggggtcac gccccgggtg cgtcgcagcc 120

ccggaaccag gcgcccgccg gagggaccaa ccaaactctt tctgtagtcc cctcgcggac 180

gttatttctt acagctctga gcaaaaattc aaaatgaatc aaaactttca acaacggatc 240

tcttggttct ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt gaattgcaga 300

attcagtgaa tcatcgaatc tttgaacgca cattgcgccc gccagtattc tggcgggcat 360

gcctgtccga gcgtcatttc aaccctcgaa cccctccggg ggtccggcgt tggggatcgg 420

gaacccctaa gacgggatcc cggccccgaa atacagtggc ggtctcgccg cagcctctcc 480

tgcgcagtag tttgcacaac tcgcaccggg agcgcggcgc gtccacgtcc gtaaaacacc 540

caacttctga aatgttgacc tcggatcagg taggaatacc cgctgaactt aagcat 596

Claims

1. Trichoderma viride (T. Glaucus)Trichoderma viridescens) The culture medium is characterized by being preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms, and the preservation address is as follows: west road No.1, north west of the morning area, beijing, 3, institute of microbiology, china academy of sciences, preservation time: no. 8/19 at 2021, accession number: CGMCC No.23212, and the taxonomic name of the strain Trichoderma aureoviride: (A)Trichoderma viridescens）。

2. Trichoderma aureoviride according to claim 1, wherein Trichoderma aureoviride is present in one of the three forms conidia, mycelium, conidia-containing and mycelium.

3. Use of trichoderma viride according to any one of claims 1-2 for inhibiting pathogenic bacteria in ginsengThe ginseng pathogenic bacteria are selected from at least one of the following: ginseng black spot pathogen (A)Alternaria panax) Ginseng sclerotinia sclerotiorum (A) and (B)Sclerotinia schinseng) Ginseng anthracnose pathogenColletotrichum panacicola) Ginseng rust rot fungus (A), (B)Ilyonectria robusta) And ginseng root rot (Fusarium oxysporum)。

4. The use according to claim 3, wherein the Trichoderma viride is prepared for use as a liquid formulation.

5. Use according to claim 4, wherein the liquor is used in an amount of 3 x 10 ⁹ cfu/strain-9X 10 ⁹ cfu/strain.

6. The use according to claim 3, wherein the Trichoderma viride is used in the form of a powder, granules or seed coating.

7. Use according to claim 6, wherein the powder, granules or seed coating is applied in an amount of 3 x 10 ⁹ cfu/strain-9X 10 ⁹ cfu/strain.

8. A soil conditioner for plants belonging to the genus Panax, which comprises Trichoderma viride according to any one of claims 1-2.

9. The ginseng plant soil conditioner according to claim 8, wherein the ginseng plant soil conditioner comprises the Trichoderma reesei as a main active ingredient.

10. The soil conditioner for ginseng plants according to claim 9, wherein said trichoderma viride is contained in the soil conditioner for ginseng plants in an amount of 1 x 10 ⁸ cfu·ml ^-1 ~3×10 ⁸ cfu·ml ^-1 。