CN105238723B - A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt - Google Patents
A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt Download PDFInfo
- Publication number
- CN105238723B CN105238723B CN201510736549.1A CN201510736549A CN105238723B CN 105238723 B CN105238723 B CN 105238723B CN 201510736549 A CN201510736549 A CN 201510736549A CN 105238723 B CN105238723 B CN 105238723B
- Authority
- CN
- China
- Prior art keywords
- hmb27684
- bacillus amyloliquefaciens
- verticillium wilt
- eggplant
- cotton
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 230000001580 bacterial effect Effects 0.000 title claims abstract description 57
- 241000082085 Verticillium <Phyllachorales> Species 0.000 title claims abstract description 56
- 241000193744 Bacillus amyloliquefaciens Species 0.000 title claims abstract description 55
- 230000000813 microbial effect Effects 0.000 title claims abstract description 28
- 230000002265 prevention Effects 0.000 title claims abstract description 26
- 244000061458 Solanum melongena Species 0.000 claims abstract description 46
- 235000002597 Solanum melongena Nutrition 0.000 claims abstract description 46
- 229920000742 Cotton Polymers 0.000 claims abstract description 40
- 238000002360 preparation method Methods 0.000 claims abstract description 24
- 244000005700 microbiome Species 0.000 claims abstract description 17
- 241000219146 Gossypium Species 0.000 claims description 37
- 239000007788 liquid Substances 0.000 claims description 18
- 239000000470 constituent Substances 0.000 claims description 8
- FRXSZNDVFUDTIR-UHFFFAOYSA-N 6-methoxy-1,2,3,4-tetrahydroquinoline Chemical compound N1CCCC2=CC(OC)=CC=C21 FRXSZNDVFUDTIR-UHFFFAOYSA-N 0.000 claims description 7
- 238000004519 manufacturing process Methods 0.000 claims description 5
- 235000004341 Gossypium herbaceum Nutrition 0.000 claims description 3
- PEDCQBHIVMGVHV-UHFFFAOYSA-N Glycerine Chemical compound OCC(O)CO PEDCQBHIVMGVHV-UHFFFAOYSA-N 0.000 claims 1
- 241000894006 Bacteria Species 0.000 abstract description 22
- 239000003795 chemical substances by application Substances 0.000 abstract description 20
- 230000003449 preventive effect Effects 0.000 abstract description 11
- 230000000443 biocontrol Effects 0.000 abstract description 8
- 206010059866 Drug resistance Diseases 0.000 abstract description 3
- 238000003912 environmental pollution Methods 0.000 abstract description 3
- 241001465754 Metazoa Species 0.000 abstract description 2
- 230000002045 lasting effect Effects 0.000 abstract description 2
- 241000196324 Embryophyta Species 0.000 description 25
- 241001123668 Verticillium dahliae Species 0.000 description 25
- 244000144987 brood Species 0.000 description 23
- 210000004027 cell Anatomy 0.000 description 23
- 230000000694 effects Effects 0.000 description 22
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 22
- 238000012360 testing method Methods 0.000 description 21
- 201000010099 disease Diseases 0.000 description 20
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 20
- 238000000034 method Methods 0.000 description 19
- 241000193830 Bacillus <bacterium> Species 0.000 description 17
- 239000000843 powder Substances 0.000 description 17
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 description 16
- 238000012408 PCR amplification Methods 0.000 description 13
- 244000063299 Bacillus subtilis Species 0.000 description 12
- 235000014469 Bacillus subtilis Nutrition 0.000 description 12
- 239000002068 microbial inoculum Substances 0.000 description 12
- 239000002609 medium Substances 0.000 description 11
- VTYYLEPIZMXCLO-UHFFFAOYSA-L Calcium carbonate Chemical compound [Ca+2].[O-]C([O-])=O VTYYLEPIZMXCLO-UHFFFAOYSA-L 0.000 description 10
- 244000068988 Glycine max Species 0.000 description 10
- 235000010469 Glycine max Nutrition 0.000 description 10
- 240000008042 Zea mays Species 0.000 description 10
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 10
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 10
- 235000005822 corn Nutrition 0.000 description 10
- 239000003814 drug Substances 0.000 description 10
- 238000002474 experimental method Methods 0.000 description 10
- 235000013312 flour Nutrition 0.000 description 10
- 108020004465 16S ribosomal RNA Proteins 0.000 description 8
- 239000011780 sodium chloride Substances 0.000 description 8
- 239000004563 wettable powder Substances 0.000 description 8
- 230000001717 pathogenic effect Effects 0.000 description 7
- 239000002689 soil Substances 0.000 description 7
- 230000000844 anti-bacterial effect Effects 0.000 description 6
- 101150013736 gyrB gene Proteins 0.000 description 6
- 230000002401 inhibitory effect Effects 0.000 description 6
- 238000012545 processing Methods 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 239000000725 suspension Substances 0.000 description 6
- 238000010998 test method Methods 0.000 description 6
- 244000115658 Dahlia pinnata Species 0.000 description 5
- 235000012040 Dahlia pinnata Nutrition 0.000 description 5
- 241000607479 Yersinia pestis Species 0.000 description 5
- 229910000019 calcium carbonate Inorganic materials 0.000 description 5
- 229940041514 candida albicans extract Drugs 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 5
- 230000003628 erosive effect Effects 0.000 description 5
- 230000005764 inhibitory process Effects 0.000 description 5
- 238000007747 plating Methods 0.000 description 5
- 238000002791 soaking Methods 0.000 description 5
- 238000009331 sowing Methods 0.000 description 5
- 230000001954 sterilising effect Effects 0.000 description 5
- 239000012138 yeast extract Substances 0.000 description 5
- 229920001817 Agar Polymers 0.000 description 4
- 239000008272 agar Substances 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 239000003899 bactericide agent Substances 0.000 description 4
- 230000000877 morphologic effect Effects 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 230000007918 pathogenicity Effects 0.000 description 4
- 230000007170 pathology Effects 0.000 description 4
- 230000008569 process Effects 0.000 description 4
- 241000726221 Gemma Species 0.000 description 3
- 241000241602 Gossypianthus Species 0.000 description 3
- 229920002472 Starch Polymers 0.000 description 3
- 230000004913 activation Effects 0.000 description 3
- 238000010276 construction Methods 0.000 description 3
- 235000013399 edible fruits Nutrition 0.000 description 3
- 239000012530 fluid Substances 0.000 description 3
- 239000001963 growth medium Substances 0.000 description 3
- 238000011081 inoculation Methods 0.000 description 3
- SQQMAOCOWKFBNP-UHFFFAOYSA-L manganese(II) sulfate Chemical compound [Mn+2].[O-]S([O-])(=O)=O SQQMAOCOWKFBNP-UHFFFAOYSA-L 0.000 description 3
- 229910000357 manganese(II) sulfate Inorganic materials 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 230000000474 nursing effect Effects 0.000 description 3
- 244000052769 pathogen Species 0.000 description 3
- 230000004763 spore germination Effects 0.000 description 3
- 239000008107 starch Substances 0.000 description 3
- 235000019698 starch Nutrition 0.000 description 3
- 238000004659 sterilization and disinfection Methods 0.000 description 3
- 239000012137 tryptone Substances 0.000 description 3
- 238000010629 Molecular evolutionary genetics analysis Methods 0.000 description 2
- 240000007594 Oryza sativa Species 0.000 description 2
- 235000007164 Oryza sativa Nutrition 0.000 description 2
- 239000001888 Peptone Substances 0.000 description 2
- 108010080698 Peptones Proteins 0.000 description 2
- 208000035199 Tetraploidy Diseases 0.000 description 2
- 230000008485 antagonism Effects 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 238000007796 conventional method Methods 0.000 description 2
- 239000003085 diluting agent Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 239000012154 double-distilled water Substances 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 238000011534 incubation Methods 0.000 description 2
- 239000006916 nutrient agar Substances 0.000 description 2
- 235000019319 peptone Nutrition 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 235000009566 rice Nutrition 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 244000000000 soil microbiome Species 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 230000009897 systematic effect Effects 0.000 description 2
- WFJIVOKAWHGMBH-UHFFFAOYSA-N 4-hexylbenzene-1,3-diol Chemical compound CCCCCCC1=CC=C(O)C=C1O WFJIVOKAWHGMBH-UHFFFAOYSA-N 0.000 description 1
- 101150076489 B gene Proteins 0.000 description 1
- 241000194108 Bacillus licheniformis Species 0.000 description 1
- 241000194103 Bacillus pumilus Species 0.000 description 1
- 244000025254 Cannabis sativa Species 0.000 description 1
- 206010011732 Cyst Diseases 0.000 description 1
- 108010054814 DNA Gyrase Proteins 0.000 description 1
- 241000194105 Paenibacillus polymyxa Species 0.000 description 1
- 206010061926 Purulence Diseases 0.000 description 1
- 235000001667 Vitex agnus castus Nutrition 0.000 description 1
- 244000063464 Vitex agnus-castus Species 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 210000000481 breast Anatomy 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000000052 comparative effect Effects 0.000 description 1
- 238000003967 crop rotation Methods 0.000 description 1
- 239000013078 crystal Substances 0.000 description 1
- 208000031513 cyst Diseases 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 230000000857 drug effect Effects 0.000 description 1
- 238000000855 fermentation Methods 0.000 description 1
- 230000004151 fermentation Effects 0.000 description 1
- 210000004700 fetal blood Anatomy 0.000 description 1
- 210000003495 flagella Anatomy 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 238000012252 genetic analysis Methods 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 238000002386 leaching Methods 0.000 description 1
- 238000009630 liquid culture Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000011159 matrix material Substances 0.000 description 1
- 238000000386 microscopy Methods 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 210000000496 pancreas Anatomy 0.000 description 1
- 101150012629 parE gene Proteins 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 238000004080 punching Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 238000003892 spreading Methods 0.000 description 1
- 230000007480 spreading Effects 0.000 description 1
- 230000003068 static effect Effects 0.000 description 1
- 239000008223 sterile water Substances 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
- 239000003643 water by type Substances 0.000 description 1
- 238000005303 weighing Methods 0.000 description 1
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention belongs to Strategies of Agricultural Bio-control fields, specifically disclose a kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27684 of prevention crop verticillium wilt, deposit number is CGMCC No.11456.The invention also discloses using the bacterium prepare microbial bacterial agent and they prevention crop verticillium wilt on application.The present invention provides an efficient microorganism for prevention cotton, the crops verticillium wilt such as eggplant, is averaged preventive effect 70.0% or more to cotton, eggplant verticillium wilt, and with strong points；Secondly, for microbial bacterial agent of the present invention to people, animal safety, environmental pollution is small；In addition, it is long using present invention prevention cotton, eggplant verticillium wilt lasting period, it is not likely to produce drug resistance；Preparation method of the present invention is simple, it is at low cost, using simple.
Description
Technical field
The invention belongs to Strategies of Agricultural Bio-control fields, and in particular to a kind of solution starch gemma bar of prevention crop verticillium wilt
Bacterium, and the microbial bacterial agent containing the bacillus amyloliquefaciens further relate to their applications in prevention crop verticillium wilt.
Background technology
The crops verticillium wilt such as cotton, eggplant is one caused by dahlia Verticillium dahliae (Verticillium dahaliae)
Kind harm is serious and is difficult to the soil-borne disease prevented.The disease is on the rise in Cotton in China, the harm of eggplant main producing region at present.Cotton
Flower verticillium wilt is in China's population outbreak regularly, and the sown areas of cotton being affected by it every year are at 40,000,000 mu or more, throughout the year
The cotton underproduction 10%~20% or so, disease is caused serious plot to occur, the underproduction is caused to be up to 60%~70%.Verticillium wilt is often drawn
The whole strain withered death of eggplant is played, almost total crop failure total crop failure.
Control method in relation to the crops verticillium wilt such as cotton, eggplant is stablized effective resisting verticillium gene due to lacking, is resisted
Sick breeding it is ineffective；Then there is not good enough preventive effect, pollution environment, destroy the shortcomings of agricultural ecological balance in chemical prevention；Agricultural
More effectively crop rotation for many years in control measure, but under the conditions of previous specific agricultural environment, have a large population and a few land and substitute cotton
Flower, the high price crop species of eggplant are deficient, it is difficult to promote and apply.Biological control due to it is small with environmental pollution, to safety of human and livestock,
Specialization is strong, be not likely to produce drug resistance, the effect lasting period is long, can effective protection natural enemy, production cost be low etc. that advantages are increasingly subject to
The favor of people.
Bacillus (Bacillius sp) is a kind of biocontrol bacteria received significant attention.It is wide, easily separated with its distribution
Culture can generate the stronger brood cell of resistance, the features such as storage period is long and easy to use, become a kind of micro- life of ideal biological and ecological methods to prevent plant disease, pests, and erosion
Object.Because bacillus can generate in sprout born of the same parents, have extremely strong anti-adversity ability, compare other kinds of bio-control factors, be more advantageous to
The production of microbial inoculum is survived in formulation environment, colonizes and is bred.Therefore, the bud inhibited to pathogen is screened
Spore bacillus is most effectual way one of of the prevention in relation to plant disease.
The bacillus for being presently used for prevention crop verticillium wilt mainly has bacillus subtilis, bacillus licheniformis, A Sa
Er Jiya bacillus, bacillus pumilus, bacillus amyloliquefaciens, bacillus polymyxa etc. achieve significant prevention effect
Fruit.But due to the diversity of pathogen and synchronous evolution, it is still necessary to find new bacterial strain and be applied to prevention crop verticillium wilt.
Through retrieval, the report in relation to Bacillus amyloliquefaciens strain HMB27684 of the present invention is not found.
Invention content
Present invention aims at provide a kind of Bacillus amyloliquefaciens strain for preventing crop verticillium wilt, bacterial strain tool
There is efficient, wide sterilization spectrum.
Another object of the present invention is to provide the microbial bacterial agent using the production of above-mentioned bacillus amyloliquefaciens.
Third of the present invention is designed to provide the preparation method of mentioned microorganism microbial inoculum.
The present invention the 4th is designed to provide purposes of the above-mentioned Bacillus amyloliquefaciens strain in prevention crop verticillium wilt.
The present invention the 5th is designed to provide purposes of the mentioned microorganism microbial inoculum in prevention crop verticillium wilt.
The present invention the 6th is designed to provide the identification method of above-mentioned Bacillus amyloliquefaciens strain.
The present invention the 7th is designed to provide the identification method of mentioned microorganism microbial inoculum.
The invention is realized by the following technical scheme：
A kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27684, oneself was in 2015
September is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on the 29th, and (preservation address is：Beijing's southern exposure
No. 3 Institute of Microorganism, Academia Sinica of institute of area North Star West Road 1), deposit number is CGMCC No.11456.
The microbial bacterial agent produced using above-mentioned bacillus amyloliquefaciens HMB27684, active constituent are solution starch gemma
Bacillus HMB27684 thalline.
The viable count of mentioned microorganism microbial inoculum, HMB27684 is more than 17.0 × 108cfu/mL。
Mentioned microorganism microbial inoculum can be liquid preparation or pulvis.
The preparation method of mentioned microorganism microbial inoculum, includes the following steps：
(1) actication of culture：The HMB27684 bacterial strains of Cord blood are activated on LB plating mediums, picking single bacterium colony exists
On LB slant mediums, is cultivated 10~16 hours at 25~35 DEG C, obtain the bacterial strain of activation；
(2) prepared by seed liquor：The inoculation of a ring step (1) activation is scraped to 100mL LB liquid with sterile oese
In body culture medium, in 25~35 DEG C, shaking speed to be cultivated 10~16 hours under conditions of 150~220rpm, seed liquor is obtained；
(3) fermented and cultured：The seed liquor of step (2) is linked into corn flour soya bean by the ratio for being 1~3% according to volume ratio
In powder culture medium (pH value 7.0), under the conditions of temperature is 25~35 DEG C, rotating speed is 150~220rpm fermented and cultured 40~
50h obtains zymotic fluid；
(4) thalline and brood cell's quantity in zymotic fluid are detected, waits in zymotic fluid that ripe brood cell accounts for brood cell and thalline sum
Stop fermented and cultured when 90%；Gained is the liquid preparation of HMB27684 bacterial strains.
LB plating mediums, LB slant mediums and the LB liquid medium is conventionally prepared.
LB plating mediums described in above-mentioned preparation method step (1) or LB slant mediums, constituent and its
Weight ratio is：8~12g of tryptone, 4~6g of yeast extract, 4~6g of sodium chloride, 12~18g of agar powder, water 1000mL.
LB liquid medium described in above-mentioned preparation method step (2), constituent and its weight ratio are：Tryptose
8~12g of peptone, 4~6g of yeast extract, 4~6g of sodium chloride, water 1000mL.
The corn flour soybean powder medium described in above-mentioned preparation method step (3), constituent and its again
Measuring percentage is：Corn flour 1.0~3.0%, analysis for soybean powder 1.0~3.0%, NaCl 0.1~1.0%, MnSO4·H2O 0.5~
1.0%, remaining is water.
The preparation method of the corn flour soybean powder medium, according to weight percent by corn flour, analysis for soybean powder, NaCl
And MnSO4·H2O is mixed, and is added water, and is adjusted pH and is stirred evenly.
Applications of the bacillus amyloliquefaciens HMB27684 in prevention crop verticillium wilt.
Application of the mentioned microorganism microbial inoculum in prevention crop verticillium wilt.
Crop described in above application refers to cotton or eggplant.
The application method of mentioned microorganism microbial inoculum：Above-mentioned gained microbial bacterial agent, which is diluted with water to viable bacteria body number, is
108Cfu/mL, by seed-soaking half an hour before cotton, eggplant sowing；Or above-mentioned gained microbial bacterial agent is inhaled with calcium carbonate
It is attached, it is fabricated to bacillus amyloliquefaciens HMB27684 pulvis, according to pesticide-seeds ratio 1 before cotton, eggplant sowing：10 seed dressings,
Achieve the purpose that prevent cotton, eggplant verticillium wilt generation.
The screening separation process of HMB27684 bacterial strains
HMB27684 bacterial strains are isolated from the Cotton Soil of Jingzhou City of Hubei Province.In April, 2013 is from Hubei Province chaste tree
Soil sample is acquired in state city cotton field at 5 points, and weighing 1g after mixing is put into the sterilizing triangular flask of 250mL, and 100mL sterile waters are added, put
Onto shaking table, 170r/min vibrates 30min, stands 2h, takes supernatant 10mL to be added in 50mL sterile centrifugation tubes, in 80 DEG C of constant temperature
Water-bath 30 minutes, then takes 1mL to add sterile water 9mL, 10mL10-3Times edaphon suspension is then dilute by soil supension
It is interpreted into 10-4、10-5、10-6Times dilution, takes each 200 μ L of concentration microorganism suspension to be applied on LB culture medium flat plates, each concentration weight
It is 3 times multiple, in 30 DEG C of constant temperature incubation 1d-3d, carry out the separation and purifying of bacterium.And using cotton, eggplant verticillium wilt as target, pass through
Double-layer agar technique, pot experiment method carry out the screening of biocontrol microorganisms.As a result therefrom filtering out one has cotton, eggplant verticillium wilt
The bacterial strain of apparent control effect, is named as HMB27684.
The taxonomic identification of HMB27684 bacterial strains：
(1) identification by morphological characters
It is rod-shaped that thalline is cultivated on LB culture mediums, and brood cell is generated after cultivating 10h, raw in brood cell, ellipse, and cyst is not swollen
Greatly, acid-fast stain is negative, and no parasporal crystal can move, flagellum Zhousheng.On nutrient agar panel, the light breast of Initial stage of culture bacterium colony
White, purulence shape is round, neat in edge, and bacterium colony protuberance is in steamed bun shape, surface wettability；Late stage of culture bacterium colony is faint yellow, and edge is not whole
Together, dry tack free has fold；It crosses and cultivates on nutrient agar slopes, it is linear；Static gas wave refrigerator in liquid medium, table
Face forms white mycoderm.These morphological features with《Common bacteria system identification handbook》(east show pearl etc. writes Science Presses
.2001 year) described in bacillus morphological feature it is almost the same, tentatively judge that bacterial strain HMB27684 belongs to bacillus
(Bacillus)。
(2) 16S rDNA Sequence Identifications are utilized to classify
Using the genomic DNA of HMB27684 as template, PCR amplification is carried out by primer pair 16S rDNA of F27 and R1492,
The primer sequence is：
F27：5’AGAGTTTGATCATGGCTCAG3’；(SEQ ID No:1)
R1492：5’GGCTACCTTGTTACGACTT3’；(SEQ ID No:2)
The amplification reaction system of 16S rDNA is 50 μ L:10×PCR Buffer(Mg2+)5μL；dNTP Mixture
(2.5mM)5μL；Taq (5U/ μ L) 1 μ L, F27 (10 μm of ol/L) 1 μ L, R1492 (10 μm of ol/L) 1 μ L；The genome of HMB27684
DNA 50ng；ddH2O complements to 50 μ L.The reaction condition of PCR is 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1.5min,
30 cycles；72℃10min.Gained pcr amplification product is subjected to gel electrophoresis, delivers Shanghai Sheng Gong bioengineering Co., Ltd
Sequencing, obtains the 16S rDNA sequences of HMB27684 (see SEQ ID No:3).The 16S rDNA sequences of gained HMB27684 are existed
Carry out tetraploid rice in Genbank, the 16S rDNA homologys of results strain HMB27684 and bacillus reach 99%；
Phylogenetic tree construction (see Fig. 1), HMB27684 are aggregated to together with bacillus, illustrate that HMB27684 belongs to bacillus
Belong to (Bacillus).
(3) the identification classification of gyrB gene orders is utilized
Using HMB27684 genomic DNAs template, bacillus gyrB gene degenerate primers gyrB-F and gyrB-R are utilized
PCR amplification is carried out for primer, obtains pcr amplification product；The sequence of the wherein described gyrB-F and gyrB-R primers is：
gyrB-F：5’TTGRCGGHRGYGGHTATAAAGT3’；(SEQ ID No:4)
gyrB-R：5’TCCDCCSTCAGARTCWCCCTC3’；(SEQ ID No:5)
The pcr amplification reaction system of gyrB is 50 μ L:10×PCR Buffer(Mg2+)5μL；dNTP Mixture
(2.5mM)5μL；Taq(5U/μL)1μL；GyrB-F (10 μm of ol/L) 1 μ L, gyrB-R (10 μm of ol/L) 1 μ L；HMB27684 genes
Group DNA 50ng；ddH2O complements to 50 μ L.The reaction condition of PCR is 95 DEG C of 5min；95 DEG C of 30s, 55 DEG C of 45s, 72 DEG C of 1min,
30 cycles；72℃10min.Amplified production is delivered into the sequencing of Shanghai Sheng Gong bioengineering Co., Ltd, obtains HMB27684 bacterial strains
GyrB gene orders (see SEQ ID No:6).By the gyrB gene orders of the HMB27684 bacterial strains of acquisition in Genbank into
Row tetraploid rice, at the same using MEGA softwares (Molecular Evolutionary Genetics Analysis, molecule into
Change genetic analysis) phylogenetic tree construction.As a result, it has been found that the gyrB gene orders of HMB27684 and bacillus amyloliquefaciens are homologous
Property highest；Phylogenetic tree construction (see Fig. 2), HMB27684 bacterial strains are aggregated to together with bacillus amyloliquefaciens, explanation
HMB27684 is bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and is a new strains.
In summary morphological feature, 16S rDNA and gyr 1 B gene sequence homology comparative analyses as a result, understanding
HMB27684 belongs to bacillus amyloliquefaciens (Bacillus amyloliquefaciens), and with existing solution starch gemma
Bacillus strain is different, is a new strains.
The identification method of above-mentioned Bacillus amyloliquefaciens strain HMB27684 includes being with the genomic DNA of strain to be tested
Template carries out PCR amplification by primer pair of F27 and R1492, if gained pcr amplification product is SEQ ID No:Core shown in 3
Nucleotide sequence, as HMB27684 bacterial strains.
The identification method of above-mentioned Bacillus amyloliquefaciens strain HMB27684 includes being with the genomic DNA of strain to be tested
Template carries out PCR amplification by primer of gyrB-F and gyrB-R, if gained pcr amplification product is SEQ ID No:Shown in 6
Nucleotide sequence, as HMB27684 bacterial strains
The identification method of mentioned microorganism microbial inoculum includes the genomic DNA to be extracted in microbial inoculum to be measured as template, with F27
It is that primer pair carries out PCR amplification with R1492, if gained pcr amplification product is SEQ ID No:Nucleotide sequence shown in 3,
As HMB27684 microbial bacterial agents.Or the genomic DNA to be extracted in microbial inoculum to be measured is with gyrB-F and gyrB-R as template
Primer carries out PCR amplification, if gained pcr amplification product is SEQ ID No:Nucleotide sequence shown in 6, as HMB27684
Microbial bacterial agent.
The present invention has the advantage that and advantageous effect：(1) present invention provides for crops verticillium wilt such as prevention cotton, eggplants
One efficient microorganism opens an effective controlling way；(2) bacillus amyloliquefaciens HMB27684 of the present invention is to cotton
Flower, the drug effect of eggplant verticillium wilt are high, and average preventive effect is and with strong points 70.0% or more；(3) microbial bacterial agent pair of the present invention
People, animal safety, without environmental pollution；(4) it is not likely to produce drug resistance using the method for the present invention prevention cotton, eggplant verticillium wilt；(5)
Preparation method of the present invention is simple, it is at low cost, using simple.
Description of the drawings
Fig. 1 is the systematic growth tree graph of the HMB27684 bacterial strains obtained according to 16S rDNA sequences.
Fig. 2 is the systematic growth tree graph of the HMB27684 bacterial strains obtained according to gyrB gene orders.
Specific implementation mode
The present invention is further clearly explained with specific embodiment below, but is not constituted in any way to the present invention
Limitation.Experimental method in following embodiments is unless otherwise instructed conventional method；Percentage in following embodiments contains
Amount, is weight percentage unless otherwise instructed.
The preparation of embodiment 1HMB27684 microbial bacterial agents
It carries out in accordance with the following steps：
(1) actication of culture：By be stored in -80 DEG C Bacillus amyloliquefaciens strain HMB27684 (bacterial strain oneself in 2015
On September is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCC for 29
No.11456) in LB plating mediums, in LB plating mediums, (its constituent and its weight ratio are：Tryptone 10g, yeast
Extract 5g, sodium chloride 5g, agar powder 15g, water 1000mL) on activated at 30 DEG C, picking single bacterium colony the inclined-planes LB train
Supporting base, (its constituent and its weight ratio are：Tryptone 10g, yeast extract 5g, sodium chloride 5g, agar powder 15g, water
It is cultivated 12 hours at 30 DEG C on 1000mL), obtains the bacterial strain of activation；
(2) preparation of seed liquor：Making LB liquid medium according to a conventional method, (its constituent and its weight ratio are：Pancreas
Peptone 10g, yeast extract 5g, sodium chloride 5g, water 1000mL), LB culture solution 100mL are packed into 250mL triangular flasks, it is high
Moist heat sterilization is pressed, the bacterial strain activated in an oese step (1) is accessed after temperature drops to room temperature, in every bottle, in 30 DEG C, shaking table
Shaken cultivation is carried out under conditions of rotating speed 190rpm 12 hours, obtain seed liquor；
(3) preparation of corn flour soybean powder medium：According to weight percent by corn flour 1.5%, analysis for soybean powder 2.0%,
NaCl 0.5%, MnSO4·H2O 0.6% is added to the water, and is uniformly mixed to get corn flour soybean powder medium；It is sub-packed in
In 500mL triangular flasks, every bottle of 200mL；Sterilizing 30 minutes is carried out to corn flour soybean powder medium at 121 DEG C, then cools to 30
It is DEG C spare；
(4) fermented and cultured：Into every bottle of corn flour soybean powder medium 200mL obtained by step (3) obtained by inoculation step (2)
Seed liquor 2mL；Fermented and cultured 36h is carried out under the conditions of 30 DEG C, shaking speed 180rpm, later every 30 minutes from triangular flask
Sampling carries out microscopy, in the visual field brood cell and total thalline number count, and calculate brood cell and lead that (brood cell leads (%)=ripe bud
Born of the same parents' number/(ripe brood cell's number+thalline number) × 100)；Brood cell, which leads, stops fermented and cultured when reaching 90%；Common fermentation culture 48h, obtains
The liquid preparation of bacillus amyloliquefaciens HMB27684.
Inhibiting effect of the 2 bacillus amyloliquefaciens HMB27684 of embodiment to Verticillium Dahliae spore germination
(1) test period and place：In June, 2013 carries out in biological and ecological methods to prevent plant disease, pests, and erosion laboratory.
(2) test method：
(1) for examination Verticillium Dahliae source：Verticillium Dahliae WX-1 bacterial strains pick up from Xingtai City Wei County, Hebei province cotton yellow and wither
Diseased plant isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, Plant Protection College, Hebei Agricultural Univ. plant
Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) tablet measures experiment：
Verticillium Dahliae WX-1 is activated on PDA plate first, in colony edge region picking 4-5 blocks after cultivating 7 days
Mycelia block (irregular shape, about 15mm2), it accesses in PDB culture solutions, at constant-temperature table culture 4 days (25 DEG C, 170 revs/min).It will
Liquid culture uses double-layer sterile filtered through gauze in aseptic operating platform, obtains Verticillium Dahliae spore suspension (108A spore/
Milliliter).2mL Verticillium Dahliae spore suspensions are added in 100mL PDA culture mediums (45-50 DEG C), PDA is made after mixing
Tablet.Bacillus HMB27684 is surveyed in point reception on PDA plate, observation inhibition zone transparency after culture 3 days (+++ it indicates
It is fully transparent；++ it indicates translucent；+ indicate opaque) and measure inhibition zone size.
As a result the bacillus amyloliquefaciens HMB276384 of the present invention that (is shown in Table 1) has Verticillium Dahliae spore germination strong
Inhibiting effect generates bright inhibition zone, antibacterial circle diameter 1.8mm.Illustrate bacillus amyloliquefaciens HMB27684 to cotton yellow
The bacterium that withers has significant inhibiting effect, has the Biocontrol Potential of prevention cotton verticillium wilt.
Inhibiting effect test result of the 1 HMB27684 bacterial strains of table to Verticillium Dahliae spore germination
| Strain name | Transparent circle brightness | Transparent loop diameter (mm) |
| HMB27684 | +++ | 1.8 |
3 bacillus amyloliquefaciens HMB27684 of embodiment tests the inhibiting effect that Verticillium Dahliae mycelia grows
(1) test period and place：In July, 2013 carries out in biological control laboratory.
(2) test method：
(1) for examination Verticillium Dahliae source：Verticillium Dahliae WX-1 bacterial strains pick up from Xingtai City Wei County, Hebei province cotton yellow and wither
Diseased plant isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, Plant Protection College, Hebei Agricultural Univ. plant
Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) tablet measures experiment：
Verticillium Dahliae WX-1 is activated on PDA plate first, in colony edge region after culture 7 days, with card punch () bacterium piece is made in punching, by the switching of Verticillium Dahliae bacterium piece in another PDA plate center, then by 1 step of embodiment
(1) the bacillus amyloliquefaciens HMB27684 points activated are connected on away from 2.0 centimeters of indicator bacteria bacterium piece, if blank control (is not put and connect
The Verticillium Dahliae growing state of HMB27684 bacterial strains).25 DEG C of constant temperature incubations wait for that blank control will cover with entire culture dish
When, measure control increment (colony radius) and (the inhibition growth after inoculation HMB27684 of processing increment of Verticillium Dahliae
Radius), antagonism is indicated with bacteriostasis rate.Calculation formula：
Bacteriostasis rate (%)=(control increment-processing increment)/control increment × 100.
As a result the bacillus amyloliquefaciens HMB27684 of the present invention that (is shown in Table 2) is to the inhibiting rate of Verticillium Dahliae up to 85.00%；
11.0 millimeters of transparent antibacterial bandwidth；Illustrate that bacillus amyloliquefaciens HMB27684 there is apparent inhibition to make Verticillium Dahliae
With the Biocontrol Potential with prevention cotton verticillium wilt.
Antagonism test result of the 2 HMB27684 bacterial strains of table to Verticillium Dahliae
| Strain name | Compare increment (mm) | Handle increment (mm) | Bacteriostasis rate (%) |
| HMB27684 | 30.0 | 4.5 | 85.00 |
4 bacillus amyloliquefaciens HMB27684 of embodiment tests the control effect of cotton verticillium wilt
(1) test process：
(1) microbial bacterial agent：HMB27684 liquid preparations prepared by embodiment 1；It is diluted with water 100 times.
(2) medicament compares：1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd)；It is diluted with water 100 times.
(3) blank control：Clear water
(2) test method：This experiment in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's disease flocking biocontrol laboratory into
Row.Cotton variety selects Jifeng 106,100 times of water diluent leachings of HMB27684 liquid preparations that before sowing prepared by Application Example 1
Kind half an hour；Using " 1,000,000,000 work brood cell/gram bacillus subtilis wettable powder " 100 times of seed soaking half an hour of dilution as medicament pair
According to；Using Seed soaking half an hour as blank control.After planting normal culture.When cotton seedling grows to two panels true leaf, piece-root grafting is cut
The spore suspension (107 spore/milliliters) of kind Verticillium Dahliae WX-1 bacterial strains.Continue culture when fully falling ill to blank control
Disease index is investigated, control effect is calculated.
3 bacillus amyloliquefaciens HMB27684 of table is to cotton verticillium wilt efficiency test result
| Processing | Disease index | Preventive effect (%) |
| HMB27684 | 21.39b | 74.30 |
| 1000000000 work brood cell/gram bacillus subtilis wettable powders | 23.69b | 71.54 |
| Blank control | 83.23a | -- |
As a result the bacillus amyloliquefaciens HMB27684 of the present invention that (is shown in Table 3) there is prevention well to imitate cotton verticillium wilt
Fruit, for preventive effect up to 74.30%, the effect (71.54%) that cotton verticillium wilt is prevented with the microbial bactericide of formal registration is suitable.
Illustrate that bacillus amyloliquefaciens HMB27684 and its microbial bacterial agent of the present invention have good control effect to cotton verticillium wilt.
5 bacillus amyloliquefaciens HMB27684 of embodiment tests the control effect of cotton verticillium wilt
(1) test process：
(1) microbial bacterial agent：HMB27684 liquid preparations prepared by embodiment 1；According to 1：1 Billy adds calcium carbonate, system
Standby HMB27684 pulvis.
(2) medicament compares：1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd).
(3) blank control：Clear water
(2) test method：This experiment carries out in biological and ecological methods to prevent plant disease, pests, and erosion laboratory.HMB27634 liquid preparations prepared by embodiment 1
According to 1：1 Billy adds calcium carbonate, prepares HMB27634 pulvis.Cotton variety selects Jifeng 106, application preparation before sowing
HMB27634 pulvis is according to pesticide-seeds ratio 1：10 seed dressings；With " 1,000,000,000 work brood cell/gram bacillus subtilis wettable powder " according to medicine
Kind ratio 1：10 seed dressings are compareed as medicament；Not handle seed as blank control.After planting normal culture.Wait for that cotton seedling is grown to
When two leaves, one new film true leaf, the spore suspension (10 of piece-root grafting kind Verticillium Dahliae WX-1 bacterial strains is cut7A spore/milliliter).Continue
Disease index is investigated in culture when fully falling ill to blank control, calculate control effect.
As a result the bacillus amyloliquefaciens HMB27684 of the present invention that (is shown in Table 4) there is prevention well to imitate cotton verticillium wilt
Fruit, for preventive effect up to 68.30%, the effect (69.67%) that cotton verticillium wilt is prevented with the microbial bactericide of formal registration is suitable.
Illustrate that bacillus amyloliquefaciens HMB27684 and its microbial bacterial agent of the present invention have good control effect to cotton verticillium wilt.
4 bacillus amyloliquefaciens HMB27684 of table is to cotton verticillium wilt efficiency test result
| Processing | Disease index | Preventive effect (%) |
| HMB27684 | 20.13b | 68.30 |
| 1000000000 work brood cell/gram bacillus subtilis wettable powders | 19.26b | 69.67 |
| Blank control | 63.51a | -- |
6 bacillus amyloliquefaciens HMB27684 of embodiment tests the control effect of eggplant verticillium wilt
(1) test process：
(1) microbial bacterial agent：HMB27684 liquid preparations prepared by embodiment 1；It is diluted with water 100 times.
(2) medicament compares：1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd)；It is diluted with water 100 times.
(3) blank control：Clear water
(2) test method：
(1) it withers bacterium source for examination eggplant Huang：Eggplant Huang withers, and to pick up from Hebei province Hengshui City Raoyang County eggplant yellow for bacterium RY-1 bacterial strains
Disease of withering diseased plant, isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, and Plant Protection College, Hebei Agricultural Univ. plants
Object Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) pot experiment：This experiment carries out in biological and ecological methods to prevent plant disease, pests, and erosion laboratory.Eggplant Varieties select the black long eggplants of Han Yu, are answered before sowing
The 100 times of water diluents of HMB27684 liquid preparations prepared with embodiment 1 are soaked seed half an hour；With " 1,000,000,000 work brood cell/gram withered grass buds
Spore bacillus wettable powder " dilutes 100 times of seed soaking half an hour as medicament control；Using Seed soaking half an hour as blank pair
According to.After planting normal culture.When cotton seedling grows the 5th true leaf, cut piece-root grafting kind eggplant Huang wither bacterium RY-1 bacterial strains spore it is outstanding
Supernatant liquid (107A spore/milliliter).Continue to investigate disease index when culture is fully fallen ill to blank control, calculates control effect.
As a result the bacillus amyloliquefaciens HMB27684 that (is shown in Table 5) has good control effect, preventive effect to eggplant verticillium wilt
Up to 72.23%, better than the effect (68.08%) of the microbial bactericide prevention eggplant verticillium wilt of formal registration.Illustrate this hair
Bright bacillus amyloliquefaciens HMB27684 and its microbial bacterial agent have good control effect to eggplant verticillium wilt.
5 bacillus amyloliquefaciens HMB27684 of table is to eggplant verticillium wilt efficiency test result
| Processing | Disease index | Preventive effect (%) |
| HMB27684 | 16.88b | 72.23 |
| 1000000000 work brood cell/gram bacillus subtilis wettable powders | 19.38b | 68.08 |
| Blank control | 60.83a | -- |
7 bacillus amyloliquefaciens HMB27684 of embodiment tests the control effect of eggplant verticillium wilt
(1) test process：
(1) microbial bacterial agent：HMB27684 liquid preparations prepared by embodiment 1；According to 1：1 Billy adds calcium carbonate, system
Standby HMB27684 pulvis.
(2) medicament compares：1000000000 work brood cell/gram bacillus subtilis wettable powder (green rich biochemical technologies of Baoding section
Co., Ltd).
(3) blank control：It is untreated
(2) test method：
(1) it withers bacterium source for examination eggplant Huang：Eggplant Huang withers, and to pick up from Hebei province Hengshui City Raoyang County eggplant yellow for bacterium RY-1 bacterial strains
Disease of withering diseased plant, isolates and purifies through Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie, and Plant Protection College, Hebei Agricultural Univ. plants
Object Department of Pathology is accredited as dahlia Verticillium dahliae (Verticillium dahaliae), and Pathogenic Tests show as High pathogenicity.
(2) pot experiment：This experiment carries out in biological and ecological methods to prevent plant disease, pests, and erosion laboratory.HMB27634 liquid preparations prepared by embodiment 1
According to 1：1 Billy adds calcium carbonate, prepares HMB27634 pulvis.Eggplant Varieties select the black long eggplants of Han Yu.Rich foster matrix is selected to educate
Seedling soil, high pressure steam sterilization 2 hours, the seedlings nursing plate to be paved with nursery soil are used as chassis, 1 plant of eggplant seedling of often cave field planting in seedlings nursing plate,
It is spare when culture is to 3-4 piece true leaves.Eggplant Huang is withered into bacterium inoculated by hypha block in PDB culture solutions, at 28 DEG C, 170 revs/min are cultivated
4 days, filtering mycelia obtained conidium, accesses in sterile seedling medium, mixing so that Huang withers bacterium conidium content in soil
Reach 106A/gram soil.The flowerpot of 15 centimetres of diameter will be packed into soil bacteria, the position that eggplant seedling is colonized in flowerpot applies system
1.5 grams of standby HMB27634 pulvis is often colonized one plant of eggplant seedling in basin.When transplanting hold up taper seedlings nursing plate make the eggplant seedling root tip break with
Conducive to pathogen infection.Then covering band soil bacteria.With 1,000,000,000 brood cells that spread manuer in holes/1.5 grams of gram bacillus subtilis wettable powder
It is compareed for medicament, eggplant seedling is directly transplanted as blank control using medicament of not spreading manuer in holes.It is normally cultivated after transplanting, until blank control is abundant
Disease index is investigated when morbidity, calculates control effect.
As a result the bacillus amyloliquefaciens HMB27684 that (is shown in Table 6) has good control effect, preventive effect to eggplant verticillium wilt
Up to 75.02%, the effect (78.33%) that eggplant verticillium wilt is prevented with the microbial bactericide of formal registration is suitable.Illustrate this
Invention bacillus amyloliquefaciens HMB27684 and its microbial bacterial agent have good control effect to eggplant verticillium wilt.
6 bacillus amyloliquefaciens HMB27684 of table is to eggplant verticillium wilt efficiency test result
| Processing | Disease index | Preventive effect (%) |
| HMB27684 | 18.3b | 75.02 |
| 1000000000 work brood cell/gram bacillus subtilis wettable powders | 15.8b | 78.33 |
| Blank control | 73.3a | --- |
Claims (5)
1. a kind of bacillus amyloliquefaciens (Bacillus amyloliquefaciens) bacterial strain HMB27684, oneself was in 2015 9
The moon is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number CGMCC on the 29th
No.11456。
2. utilizing the microbial bacterial agent of bacillus amyloliquefaciens HMB27684 productions described in claim 1, it is characterised in that its
Active constituent is bacillus amyloliquefaciens HMB27684 thalline.
3. microbial bacterial agent according to claim 2, it is characterised in that be liquid preparation or pulvis.
4. applications of the bacillus amyloliquefaciens HMB27684 described in claim 1 in prevention crop verticillium wilt；The work
Object refers to cotton or eggplant.
5. application of the microbial bacterial agent in prevention crop verticillium wilt described in claim 2；The crop refer to cotton or
Eggplant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510736549.1A CN105238723B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510736549.1A CN105238723B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105238723A CN105238723A (en) | 2016-01-13 |
| CN105238723B true CN105238723B (en) | 2018-09-21 |
Family
ID=55036543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510736549.1A Active CN105238723B (en) | 2015-11-03 | 2015-11-03 | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105238723B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106305224A (en) * | 2016-07-03 | 2017-01-11 | 安建慧 | Method for preventing or treating tomato verticillium wilt |
| CN108048360B (en) * | 2017-12-28 | 2021-01-01 | 齐永新 | Bacillus subtilis with dual functions of degrading organic phosphorus and preventing diseases |
| CN108192838B (en) * | 2017-12-28 | 2021-04-30 | 齐永新 | Bacillus amyloliquefaciens with dual functions of inorganic phosphorus degradation and disease prevention |
| CN109497050B (en) * | 2018-11-28 | 2020-08-18 | 浙江大学 | Paenibacillus polymyxa fermentation product and preparation method and application thereof |
| CN115960788A (en) * | 2022-12-31 | 2023-04-14 | 石河子大学 | Special microbial inoculum for preventing and treating cotton verticillium wilt |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586142A (en) * | 2012-02-09 | 2012-07-18 | 河北省农林科学院植物保护研究所 | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof |
| WO2012171914A1 (en) * | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
| CN104531559A (en) * | 2014-12-08 | 2015-04-22 | 山西省农业科学院生物技术研究中心 | Bacillusamyloliquefaciens subsp Lh-1 and application thereof |
-
2015
- 2015-11-03 CN CN201510736549.1A patent/CN105238723B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012171914A1 (en) * | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
| CN102586142A (en) * | 2012-02-09 | 2012-07-18 | 河北省农林科学院植物保护研究所 | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof |
| CN104531559A (en) * | 2014-12-08 | 2015-04-22 | 山西省农业科学院生物技术研究中心 | Bacillusamyloliquefaciens subsp Lh-1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105238723A (en) | 2016-01-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111172080B (en) | Bacillus belgii and application thereof | |
| CN105557756B (en) | Plant bacteriostasis method adopting bacillus methylotrophicus strain NKG-1 | |
| CN111100820B (en) | Bacillus belgii HMB28023 and application thereof | |
| CN102586142B (en) | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof | |
| CN105176894B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention graw mold of tomato | |
| CN105199996B (en) | A kind of bacillus amyloliquefaciens and its application for preventing graw mold of tomato | |
| CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
| CN106399177B (en) | Bacillus amyloliquefaciens and its microbial inoculum with degradation Phos and bacteriostasis | |
| CN106399178B (en) | Bacillus amyloliquefaciens and its application with degradation Phos and bacteriostasis | |
| CN106939290A (en) | Bacillus subtilis HMB26553 and its application | |
| CN106244504B (en) | Bacillus subtilis and its microbial inoculum with degrading organic phosphor and bacteriostasis | |
| CN109468243A (en) | Bacillus siamensis and application thereof | |
| CN108192838B (en) | Bacillus amyloliquefaciens with dual functions of inorganic phosphorus degradation and disease prevention | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN105199997A (en) | Bacillus subtilis for controlling cotton rhizoctonia and application of bacillus subtilis | |
| CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
| CN105176893B (en) | A kind of bacillus amyloliquefaciens and its application for preventing crop damping-off | |
| CN109971656B (en) | Ginger endogenetic trichoderma viride and application thereof | |
| CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
| CN102586143B (en) | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew | |
| CN102747005B (en) | Bacillus atrophaeus for prevention and control of cotton boll blight, and microbial agent thereof | |
| CN108048360B (en) | Bacillus subtilis with dual functions of degrading organic phosphorus and preventing diseases | |
| CN105462882B (en) | A kind of pseudomonas aeruginosa and its application for preventing crop verticillium wilt | |
| KR20130016917A (en) | Serratia nematodiphila wcu338 strain, composition for control plant disease and control method of plant disease with same | |
| CN105349457B (en) | A kind of bacillus amyloliquefaciens and its application in leaf blight of corn biological and ecological methods to prevent plant disease, pests, and erosion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200416 Address after: No. 302, unit 2, building 2, No. 40, Xianfeng street, Xinshi District, Baoding City, Hebei Province 071000 Patentee after: Qi Yongxin Address before: 071000 No. 118 Fuxing West Road, Hebei, Baoding Patentee before: BAODING WEIKONG BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |