CN102586143B - Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew - Google Patents
Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew Download PDFInfo
- Publication number
- CN102586143B CN102586143B CN2012100280982A CN201210028098A CN102586143B CN 102586143 B CN102586143 B CN 102586143B CN 2012100280982 A CN2012100280982 A CN 2012100280982A CN 201210028098 A CN201210028098 A CN 201210028098A CN 102586143 B CN102586143 B CN 102586143B
- Authority
- CN
- China
- Prior art keywords
- hmb20199
- downy mildew
- cucumber downy
- genus bacillus
- bacterium agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a Bacillus mojavensis strain HMB20199 for controlling cucumber downy mildew, wherein the Bacillus mojavensis strain HMB20199 is preserved in China Microbial Culture Collection Management Center on December 20th, 2011, with the preservation number of CGMCC No.5617. The invention also discloses a microorganism bacterium agent produced by using the HMB20199 and a preparation method of the microorganism bacterium agent. Active components of the microorganism bacterium agent are the Bacillus mojavensis HMB20199 thallus and extracellular metabolites thereof. The HMB20199 strain disclosed by the invention is strong in specificity in controlling of the cucumber downy mildew and high in control efficiency, wherein the average control efficiency is over 85 percent; and moreover, the drug resistance is not easily generated by controlling the cucumber downy mildew through the Bacillus mojavensis strain HMB20199. In addition, the microorganism bacterium agent has no harm to people or livestock and does not pollute the environment. The preparation method of the microorganism bacterium agent is simple, low in cost and convenient in use.
Description
Technical field
The invention belongs to agriculture microorganism field, be specifically related to a kind of mocha husband genus bacillus and the microbiobacterial agent that contains this mocha husband genus bacillus for the control cucumber downy mildew, and their purposes on the control cucumber downy mildew.
Background technology
Cucumber downy mildew is the infectivity air infection diseases that is caused by Cuba artificial downy mildew (Pseudoperonospora cubensis Rostow), produces to cucumber and brings grave danger.The method of control cucumber downy mildew mainly contains breeding for disease resistance, chemical prevention and bionomic control (as the vexed canopy of high temperature etc.) etc.Because cucumber downy mildew is the quantitative character heredity of controlled by multiple genes, breeding for disease resistance is difficult to carry out and resistance is lost easily; Chemical prevention exists and to be easy to generate resistance and to people, environmental pollution problems; And the vexed canopy of the high temperature of bionomic control needs cucumber seedling age, growing way and weather condition all just can carry out under the appropriate condition, uses to be subjected to condition restriction.In recent years, biological control method does not pollute environment owing to have people, animal safety, and to strong points, effective, the low cost and other advantages of controlling object, has become the important channel of control cucumber downy mildew.
The method of biological control cucumber downy mildew comprises that the disease resistance of utilizing plant milk extract, plant induces and biocontrol microorganisms control etc.Kind surplus the plant milk extract of having reported nearly 10 that is used for the control cucumber downy mildew, but the leaching process of plant milk extract is loaded down with trivial details, production cost is high, and the synthetic one matter uses the back pathogenic bacteria to be easy to generate the resistance shortcoming, makes this method be difficult to use.Utilize biocontrol microorganisms control cucumber downy mildew reported subtilis ZH-8 liquid preparation (Zhang Shumei etc. biotechnology .2004 (4)) and non-virulent sickle-like bacteria FO47 and FO47B10 (Yang Meng etc. Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology's journal (natural science edition); 05 phase in 2005).
Characteristics such as genus bacillus (Bacillus) has wide, the easily separated cultivation that distributes, can produce the stronger gemma of resistance, storage period is long and easy to use, it is a kind of desirable biological and ecological methods to prevent plant disease, pests, and erosion microorganism, compare the biological and ecological methods to prevent plant disease, pests, and erosion factor of other types, more be conducive to the production of microbial inoculum, formulation processing is survived in environment, is grown and breeding surely.Therefore, screening is one of most effectual way of the relevant Plant diseases of control to the inhibited genus bacillus of pathogenic bacteria.
Summary of the invention
The object of the invention is to provide a kind of mocha husband's Bacillus strain for the control cucumber downy mildew, advantages such as this bacterial strain has efficiently, broad-spectrum sterilization activity.
The present invention's second purpose is to provide a kind of microbiobacterial agent.
The present invention's the 3rd purpose is to provide the preparation method of mentioned microorganism microbial inoculum.
The present invention's the 4th purpose is to provide the purposes of above-mentioned mocha husband's Bacillus strain on the control cucumber downy mildew.
The present invention's the 5th purpose is to provide the purposes of mentioned microorganism microbial inoculum on the control cucumber downy mildew.
The present invention is achieved through the following technical solutions:
A kind of mocha husband genus bacillus (Bacillus mojavensis) bacterial strain HMB20199 is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 20th, 2011, and deposit number is CGMCC No.5617.
The microbiobacterial agent that utilizes above-mentioned mocha husband genus bacillus HMB20199 to produce, its activeconstituents are mocha husband genus bacillus HMB20199 thalline and its born of the same parents' extra-metabolite.
The mentioned microorganism microbial inoculum can be liquid preparation.
The preparation method of mentioned microorganism microbial inoculum comprises the steps: actication of culture, seed liquor preparation and fermentation culture.
The preparation method of mentioned microorganism microbial inoculum specifically comprises the steps:
(1) actication of culture: the HMB20199 bacterial strain of cryopreservation is activated at the LB plate culture medium, picking list bacterium colony on the LB slant medium 30 ℃ cultivated 24～36 hours, get the bacterial strain of activation;
(2) seed liquor preparation: scrape with aseptic transfering loop and to get inoculation that a ring step (1) activates in the 100mLLB liquid nutrient medium, 26～34 ℃,, shaking speed is to cultivate 22～25 hours under the condition of 170～210rpm, gets seed liquor;
(3) fermentation culture: being 0.5%～3.0% ratio according to volume ratio is linked into the seed liquor of step (2) in the sucrose soybean cake powder substratum (the pH value is 5.8～6.2), be that 28～34 ℃, shaking speed are that the condition bottom fermentation of 170～210rpm is cultivated 36～54h in temperature, get fermented liquid; Described sucrose soybean cake powder substratum, its moiety and weight percent thereof are: sucrose 2.0～3.0%, soybean cake powder 1.6～2.4%, NaCl 0.1～0.2%, CaCO
30.1～0.3%, KH
2PO
40.01～0.03% and MgSO
47H
2O 0.01～0.03%, and all the other are water;
(4) detect thalline and gemma quantity in the fermented liquid, treat that grown spore in the fermented liquid accounts for gemma and thalline sum 90% o'clock, stops fermentation culture; Gained is the liquid preparation of HMB20199 bacterial strain.
Temperature described in above-mentioned preparation method's step (2) and (3) is preferably 30～32 ℃; Described shaking speed is preferably 210rpm; Described incubation time is preferably 48h.
Described LB plate culture medium, LB slant medium and LB liquid nutrient medium all prepare according to ordinary method.
The preparation method of described sucrose soya-bean cake substratum, according to weight percent with sucrose, soybean cake powder, NaCl, CaCO
3, KH
2PO
4And MgSO
47H
2O mixes, and adds water to volume requiredly again, and stirring gets final product.
The mentioned microorganism microbial inoculum, the viable count of its mocha husband genus bacillus HMB20199 is greater than 1.03 * 10
9Cfu/mL.
The application of described mocha husband genus bacillus HMB20199 on the control cucumber downy mildew.
The application of mentioned microorganism microbial inoculum on the control cucumber downy mildew.
The using method of microbiobacterial agent of the present invention: it is 10 that above-mentioned gained microbiobacterial agent is diluted with water to viable count
7Cfu/mL carries out foliar spray in the cucumber downy mildew premorbid, can reach the purpose of control cucumber downy mildew.
The screening and separating process of HMB20199 bacterial strain
Bacterial strain is that Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie separates from the lettuce field soil of Baoding, Hebei province green house of vegetables and obtains.Soil was gathered from 5 of Baoding, Hebei province green house of vegetables lettuce Tanakas by Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie in 2009; taking by weighing 5g behind the mixing is put in the sterilization triangular flask of 250mL; add the 100mL sterilized water; be put on the shaking table; the 170r/min 30min that vibrates; leave standstill 2h, get supernatant liquor 1mL and add sterilized water 9mL, 10mL10
-2Times soil microorganisms suspension is diluted to 10 with soil supension then
-3, 10
-4, 10
-5, 10
-6Times diluent, each concentration is got 200 μ L microorganism suspensions and is applied on LB and the KB culture medium flat plate, and each concentration repeats for 3 times, at 28 ℃ of constant temperature culture 1d-3d, carries out separation and the purifying of bacterium.And be target with the cucumber downy mildew, utilize Ye Panfa to carry out the screening of biocontrol microorganisms.The result therefrom filters out a bacterial strain that the target disease is had obvious prevention effect, names to be HMB20199.
The classification of HMB20199 bacterial strain is identified:
(1) morphological specificity is identified
It is shaft-like cultivating thalline at the LB substratum, produces gemma behind the cultivation 10h, give birth in the gemma, and ellipse, sporangiocyst does not expand, the acid-fast stain feminine gender, no parasporal crystal can move flagellum Zhousheng.On nutrient agar plate, cultivate initial stage bacterium colony light oyster white, the purulence shape, circle, neat in edge, the bacterium colony protuberance is steamed bun shape, surface wettability; The late stage of culture bacterium colony is faint yellow, and the edge is irregular, and surface drying has fold; Streak culture on the nutrient agar medium inclined-plane, shape linearly; Static cultivation in the liquid medium within, the surface forms white mycoderm.With the bacillus morphological specificity basically identical of describing in " common bacteria system identification handbook " (eastern elegant pearl etc. are write, Science Press, calendar year 2001), judge that tentatively bacterial strain HMB20199 belongs to genus bacillus (Bacillus).
(2) utilize the classification of 16S rDNA Sequence Identification
Genomic dna with HMB20199 is template, is that primer carries out pcr amplification to 16S rDNA with F27 and R1492, and described primer sequence is:
F27： 5’AGAGTTTGATCATGGCTCAG3’；(SEQ ID No：2)，
R1492：5’GGCTACCTTGTTACGACTT3’；(SEQ ID No：3)；
The amplification reaction system of 16S rDNA is 50 μ L:10 * PCR Buffer (Mg
2+) 5 μ L; DNTPMixture (2.5mM) 5 μ L; Taq (5U/ μ L) 1 μ L, F27 (10 μ mol/L) 1 μ L, R1492 (10 μ mol/L) 1 μ L; The genomic dna 50ng of HMB20199; DdH
2O complements to 50 μ L.The reaction conditions of PCR is 95 ℃ of 5min; 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5min, 30 circulations; 72 ℃ of 10min.The gained pcr amplification product is carried out gel electrophoresis, the gained amplified fragments is delivered Shanghai give birth to the order-checking of worker's biotechnology company limited, obtain the 16S rDNA sequence (seeing SEQ ID No:1) of HMB20199.The 16S rDNA sequence of gained HMB20199 is carried out homology relatively in Genbank, the 16S rDNA homology of results strain HMB20199 and bacillus reaches 99% (see figure 2); Constructing system is grown the tree (see figure 1), and HMB20199 is aggregated to mocha husband genus bacillus, illustrates that HMB20199 belongs to mocha husband genus bacillus (B.mojavensis), and is a new bacterial strain.
(3) utilize the gyrB gene order to identify classification
Be template with the HMB20199 genomic dna, utilize genus bacillus gyrB gene degenerate primer gyrB-F and gyrB-R for primer carries out pcr amplification, get pcr amplification product; The sequence of wherein said gyrB-F and gyrB-R primer is:
gyrB-F：5’TTGRCGGHRGYGGHTATAAAGT3’，(SEQ ID No：5)
gyrB-R：5’TCCDCCSTCAGARTCWCCCTC3’；(SEQ ID No：6)
The pcr amplification reaction system of gyrB is 50 μ L:10 * PCR Buffer (Mg
2+) 5 μ L; DNTP Mixture (2.5mM) 5 μ L; Taq (5U/ μ L) 1 μ L; GyrB-F (10 μ mol/L) 1 μ L, gyrB-R (10 μ mol/L) 1 μ L; HMB20199 genomic dna 50ng; DdH
2O complements to 50 μ L.The reaction conditions of PCR is 95 ℃ of 5min; 95 ℃ of 30s, 55 ℃ of 45s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min.Amplified production is delivered Shanghai give birth to the order-checking of worker's biotechnology company limited, get the gyrB gene order (seeing SEQ IDNo:4) of HMB20199 bacterial strain.The gyrB gene order of the HMB20199 bacterial strain that obtains is carried out homology relatively in Genbank, utilize MEGA software (Molecular Evolutionary Genetics Analysis, molecular evolution genetic analysis) constructing system to grow tree simultaneously.Found that the highest (see figure 4) of gyrB gene order homology of HMB20199 and mocha husband genus bacillus, reach 99%; Constructing system is grown the tree (see figure 3), and the HMB20199 bacterial strain is aggregated to mocha husband genus bacillus, illustrates that HMB20199 is mocha husband genus bacillus (B.mojavensis), and is a new bacterial strain.
(4) utilize physiological and biochemical property to identify classification
Thereby utilize Biolog microorganism automatic identifying system test strain further to determine its kind feature to the situation of utilizing of 95 kinds of carbon sources, thereby classify.Pure culture bacterium colony with bacterial strain to be measured inserts in the sterilized water earlier, and cell suspension is made in the vibrator concussion, is inoculated on the 96 hole GNIII identification plates with the multiple tracks liquid-transfering gun then and cultivates, and uses Biolog Microstation software reading of data again, determines the utilization of carbon source situation.By comparing the classification of bacterial strain to be measured as can be known with BIOLOG system database MicroLog software (Release Version 4.20.04).The HMB20199 bacterial strain is delivered China Agricultural University, utilize Biolog microorganism automatic identifying system to identify classification, results strain HMB20199 belongs to mocha husband genus bacillus (B.mojavensis).
Comprehensive above morphological specificity, 16S rDNA and the comparative analysis of gyr B gene order homology, and the result of physiological and biochemical property evaluation, the HMB20199 bacterial strain belongs to mocha husband genus bacillus (Bacillus mojavensis) as can be known, and different with existing Bacillus strain, be a new bacterial strain.
The advantage that the present invention has and beneficial effect: (1) HMB20199 bacterial strain of the present invention is to control cucumber downy mildew high specificity, and the preventive effect height, and average preventive effect is more than 85%, for the control cucumber downy mildew provides a kind of effective biological control approach; (2) utilizing the present invention to prevent and treat cucumber downy mildew is difficult for developing immunity to drugs; (3) microbiobacterial agent of the present invention does not have problem of environmental pollution to people, animal safety; (4) microbiobacterial agent preparation method of the present invention is simple, cost is low, easy to use.
Description of drawings
Fig. 1. be the phylogeny tree graph of HMB20199 bacterial strain according to the acquisition of 16S rDNA sequence.
Fig. 2. be the 16S rDNA gene order homology comparison collection of illustrative plates of HMB20199 bacterial strain of the present invention and mocha husband genus bacillus RO-C-2 bacterial strain (B.mojavensisRO-C-2); Wherein "-" expression is identical with the base in the corresponding site of HMB20199 in the mocha husband genus bacillus RO-C-2 bacterial strain sequence, and " g, a, c, t " represents in the mocha husband genus bacillus RO-C-2 bacterial strain sequence with the base in the corresponding site of HMB20199 is g, a, c, t.
Fig. 3. be the phylogeny tree graph of HMB20199 bacterial strain according to the acquisition of gyrB gene order.
Fig. 4. be the gyrB gene order homology contrast collection of illustrative plates of mocha husband genus bacillus HMB20199 bacterial strain and mocha husband genus bacillus RO-C-2 bacterial strain (B.mojavensis RO-C-2); Wherein "-" expression is identical with the base in the corresponding site of HMB20199 in the mocha husband genus bacillus RO-C-2 sequence, and " g, a, c, t " represents in the mocha husband genus bacillus RO-C-2 sequence with the base in the corresponding site of HMB20199 to be g, a, c, t.
Embodiment
Come further clearly to explain the present invention with specific embodiment below, but be construed as limiting the invention never in any form.Experimental technique among the following embodiment if no special instructions, is ordinary method; Percentage composition among the following embodiment if no special instructions, is weight percentage.
Embodiment 1
The preparation of HMB20199 microbiobacterial agent, carry out according to following steps:
(1) actication of culture: (mocha husband genus bacillus (Bacillus mojavensis) bacterial strain HMB20199 was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 20th, 2011 will to be stored in-40 ℃ bacterial strain HMB20199, deposit number is CGMCC No.5617) (its moiety and weight ratio thereof are: Tryptones 1g at the LB plate culture medium, yeast extract 0.5g, sodium-chlor 1g, agar powder 15g, water 1000mL) upward activates at 30 ℃, (its moiety and weight ratio thereof are picking list bacterium colony: Tryptones 1g at the LB slant medium, yeast extract 0.5g, sodium-chlor 1g, agar powder 15g, water 1000mL) upward cultivated 24～36 hours down at 30 ℃, get the bacterial strain of activation;
(2) preparation of seed liquor: (its moiety and weight ratio thereof are: Tryptones 1g to make the LB liquid nutrient medium according to a conventional method, yeast extract 0.5g, sodium-chlor 1g, water 1000mL), LB nutrient solution 100mL packs in the 250mL triangular flask, the high pressure moist heat sterilization, treat that temperature drops to room temperature after, insert the good bacterial strain of the above-mentioned activation of a transfering loop in the step (1) in every bottle, carry out shaking culture at shaking table, rotating speed 190rpm, and under 30 ℃, cultivated 24h hour, seed liquor got;
(3) preparation of sucrose soya-bean cake substratum: according to weight ratio with sucrose 30g, soybean cake powder 20g, NaCl 1g, CaCO
33g, KH
2PO
40.2g and MgSO
47H
2O 0.3g adds water among the 1000mL, mixes, and namely gets sucrose soya-bean cake substratum; Be sub-packed in the 500mL triangular flask every bottle of 200mL; At 121 ℃ sucrose soya-bean cake substratum was sterilized 30 minutes, cool to again 30 ℃ standby;
(4) fermentation culture: inoculation step (2) gained seed liquor 2mL in every bottle of sucrose soya-bean cake of step (3) gained substratum 200mL; Under 30 ℃, shaking speed 190rpm condition, carry out fermentation culture 36h, later on every 30 minutes from triangular flask sampling carry out microscopy, the gemma in the visual field and total thalline number are counted, and are calculated the gemma rate; The gemma rate reaches at 90% o'clock, stops fermentation culture; Be total to the about 45～50h of fermentation culture, the liquid preparation of De Mojiafu genus bacillus HMB20199.
The calculation formula of gemma rate is:
Gemma rate (%)=grown spore number/(grown spore number+thalline number) * 100
The simultaneous test of the cucumber downy mildew preventive effect of embodiment 2 mocha husband genus bacillus HMB20199
(1) test medicine:
The HMB20199 liquid preparation of (1) microbiobacterial agent: embodiment 1 preparation, 50 times of dilute with waters.
(2) chemical agent: Azoxystrobin suspension agent (250 grams per liter) (Britain Syngenta Co., Ltd); 1000 times of dilute with waters.
(3) blank: clear water.
(2) test method: this test was carried out in the laboratory of Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie winter in 2010.The used bacterium of downy mildew of cucumber of this test is mixed with sporocyst (1 * 10 from Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie agricultural chemicals utilisation technology laboratory
5-1.5 * 10
5Individual/mL) suspension, be used for this test and inoculate.
Get anosis complete cucumber leaves, respectively it is immersed in: in the 50 times of diluents of HMB20199 liquid preparation that prepare among (1) embodiment 1; (2) in 1000 times of water diluents of chemical agent Azoxystrobin suspension agent (250 grams per liter); (2) in the blank clear water; Take out cucumber leaves behind the 1h and put into culture dish, grew surely one day in 30 ℃ of illumination boxs, play the directly leaf dish of 15mm of cut-off with punch tool, be placed in the culture dish, 10 leaf dishes of every ware are as once repeating every processing repetition four times.Drip bacterium of downy mildew of cucumber sporangia suspension 10ul at each leaf dish middle part; In 18 ℃ of illumination boxs, cultivated 7 days the sick level of investigation and calculating disease index and preventive effect.The cucumber downy mildew rank criteria for classifying and preventive effect method of calculation are with reference to " State Standard of the People's Republic of China's pesticide field efficacy medicine test criterion " (one): bactericidal agent for preventing and treating cucumber downy mildew GB/T 17980.26-2000 (as follows).
(3) the cucumber downy mildew disease referred to that the disease that (11.28) significantly are lower than after the blank clear water is handled refers to that the disease after (94.17) and chemical agent are handled refers to (78.33) after result's (seeing Table 1) mocha husband genus bacillus HMB20199 liquid preparation was handled, prevention effect reaches 88.02%, illustrates that mocha husband genus bacillus HMB20199 of the present invention and microbiobacterial agent thereof have good prevention effect to cucumber downy mildew.
The preventive effect comparative test result of the cucumber downy mildew of table 1 mocha husband genus bacillus HMB20199
| Handle | Disease index | Preventive effect (%) |
| The HMB20199 liquid preparation | 11.28c | 88.02 |
| Chemical agent | 78.33b | 16.99 |
| Blank | 94.17a | 0.00 |
The simultaneous test of the cucumber downy mildew preventive effect of embodiment 3 mocha husband genus bacillus HMB20199
(1), test medicine:
The HMB20199 liquid preparation of (1) microbiobacterial agent: embodiment 1 preparation, 50 times of dilute with waters;
(2) chemical agent: Yin Fali suspension agent (687.5 grams per liter) (Bayer crop science company), 800 times of dilute with waters;
(3) blank: clear water.
(2), test period and place: carry out in that Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's artificial climate is indoor in December, 2010.
(3) test method: screen full cucumber seeds, vernalization is seeded in the plastic flowerpot that bore is 20cm when showing money or valuables one carries unintentionally, and each handles 15 basins (every basin 2 strains), repeats 3 times.Adopt the random packet aligning method to place.Get the cucumber seedling that grows to 3-4 sheet true leaf, growth potential unanimity, divide at the pros and cons for examination plant true leaf and evenly spray for 3 times: 50 times of diluents of (1) mocha husband genus bacillus HMB20199 liquid preparation; (2) 800 times of diluents of chemical agent Yin Fali suspension agent (687.5 grams per liter); (3) blank clear water.After 24 hours, spray inoculation bacterium of downy mildew of cucumber (bacterium of downy mildew of cucumber among the embodiment 2 is inoculated on the fresh blade of cucumber breeding and get), inoculum density is 5000-10000 sporocyst/milliliter; Preserving moisture in 20 ℃ of-22 ℃ of culturing room and cultivated 4-6 days in the inoculation back, treats to investigate incidence when blank is fully fallen ill, and calculate disease index and preventive effect.
(4) the cucumber downy mildew disease referred to that the disease that (13.33) significantly are lower than after blank is handled refers to (87.78) after result's (seeing Table 2) mocha husband genus bacillus HMB20199 liquid preparation was handled, and the disease after handling with chemical agent refers to that (5.56) difference is not remarkable, the prevention effect of the cucumber downy mildew of mocha husband genus bacillus HMB20199 reaches 84.81%, illustrates that mocha husband genus bacillus HMB20199 and microbiobacterial agent thereof are good to the cucumber downy mildew prevention effect.
The comparative test result of the cucumber downy mildew preventive effect of table 2 mocha husband genus bacillus HMB20199
| Handle | Disease index | Preventive effect (%) |
| The HMB20199 liquid preparation | 13.33b | 84.81 |
| Chemical agent | 5.56bc | 93.67 |
| Blank | 87.78a | 0.00 |
The preventive effect simultaneous test of the cucumber downy mildew of embodiment 4 mocha husband genus bacillus HMB20199
(1), test medicine:
The HMB20199 liquid preparation of (1) microbiobacterial agent: embodiment 1 preparation, 50 times of dilute with waters;
(2) chemical agent: Yin Fali suspension agent (687.5 grams per liter) (Bayer crop science company), 800 times of dilute with waters;
(3) blank: clear water.
(2), test period and place: carry out in that Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's artificial climate is indoor in February, 2011.
(3) test method: screen full cucumber seeds, vernalization is seeded in the plastic flowerpot that bore is 20cm when showing money or valuables one carries unintentionally, and each handles 15 basins (every basin 2 strains), repeats 3 times.Adopt the random packet aligning method to place.Get the cucumber seedling that grows to 3-4 sheet true leaf, growth potential unanimity, divide at the pros and cons for examination plant true leaf and evenly spray for 3 times: 50 times of diluents of HMB20199 liquid preparation of (1) embodiment 1 preparation; (2) 800 times of diluents of chemical agent contrast Yin Fali suspension agent; (3) the blank clear water is handled.After 24 hours, spray inoculation bacterium of downy mildew of cucumber (bacterium of downy mildew of cucumber among the embodiment 2 is inoculated on the fresh blade of cucumber breeding and get), inoculum density is 5000-10000 sporocyst/milliliter; Preserving moisture in 20 ℃ of-22 ℃ of culturing room and cultivated 4-6 days in the inoculation back, treats to investigate incidence when blank is fully fallen ill, and calculate disease index and preventive effect.
(4) the cucumber downy mildew disease referred to that (4.44) significantly are lower than the blank disease and refer to (76.59) after result's (seeing Table 3) mocha husband genus bacillus HMB20199 liquid preparation was handled, refer to that with the disease after the chemical agent processing (0.00) difference is not remarkable, the prevention effect of the cucumber downy mildew of HMB20199 reaches 94.20%, illustrates that mocha husband genus bacillus HMB20199 and microbiobacterial agent thereof have good prevention effect to cucumber downy mildew.
The comparative test result of the cucumber downy mildew preventive effect of table 3 mocha husband genus bacillus HMB20199
| Handle | Disease index | Preventive effect (%) |
| The HMB20199 liquid preparation | 4.44b | 94.20 |
| Chemical agent | 0.00b | 100.00 |
| Blank | 76.59a | 0.00 |
The preventive effect simultaneous test of the cucumber downy mildew of embodiment 5 mocha husband genus bacillus HMB20199
(1), test medicine:
The HMB20199 liquid preparation of (1) microbiobacterial agent: embodiment 1 preparation, 50 times of dilute with waters;
(2) chemical agent: Yin Fali suspension agent (687.5 grams per liter) (Bayer crop science company), 800 times of dilute with waters;
(3) blank: clear water.
(2), test period and place: carry out this test in April, 2011 in Inst. of Plant Protection, Hebei-Prov. Academy of Agricultural and Forestry Scie's booth.
(3) test method: screen full cucumber seeds, it is during the paper of 10cm is broadcast, to be transplanted in the booth when being cultured to 2 true leaves that vernalization is seeded in diameter when showing money or valuables one carries unintentionally.Normal cultivation management, pros and cons at cucumber leaves when cucumber grows to 10 true leaves evenly sprays with the back-pack electric atomizer: 50 times of diluents of HMB20199 liquid preparation of preparation among (1) embodiment 1, (2) 800 times of diluents of chemical agent Yin Fali suspension agent (687.5 grams per liter), (3) blank clear water is handled.10 cucumber of every processing are repeated random alignment 4 times.After 24 hours, spray inoculation bacterium of downy mildew of cucumber (bacterium of downy mildew of cucumber among the embodiment 2 is inoculated on the fresh blade of cucumber breeding and get), inoculum density is 5000-10000 sporocyst/milliliter; Greenhouse temperature is controlled at 20 ℃-22 ℃ in the inoculation back, humidity 80%-90%; Treat to investigate incidence when blank is fully fallen ill, and calculate disease index and preventive effect.
(4) the cucumber downy mildew disease referred to that (9.78) significantly are lower than the blank disease and refer to (92.78) after booth test-results (seeing Table 4) mocha husband genus bacillus HMB20199 liquid preparation was handled, refer to that with the disease after the chemical agent processing (0.00) difference is not remarkable, the HMB20199 liquid preparation reaches 89.46% to the prevention effect of cucumber downy mildew, illustrates that mocha husband genus bacillus HMB20199 of the present invention and microbiobacterial agent thereof have the better prevention effect to cucumber downy mildew.
The comparative test result of the cucumber downy mildew preventive effect of table 4 mocha husband genus bacillus HMB20199
| Handle | Disease index | Preventive effect (%) |
| HMB20199 | 9.78b | 89.46 |
| Chemical agent | 0.00b | 100.00 |
| Blank | 92.78a | 0.00 |
Claims (2)
1. a mocha husband genus bacillus (Baci11us mojavensis) bacterial strain HMB20199, oneself is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on December 20th, 2011, and deposit number is CGMCC No. 5617.
2. the application of the described mocha husband genus bacillus of claim 1 HMB20199 on the control cucumber downy mildew.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100280982A CN102586143B (en) | 2012-02-09 | 2012-02-09 | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100280982A CN102586143B (en) | 2012-02-09 | 2012-02-09 | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102586143A CN102586143A (en) | 2012-07-18 |
| CN102586143B true CN102586143B (en) | 2013-07-10 |
Family
ID=46475382
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100280982A Active CN102586143B (en) | 2012-02-09 | 2012-02-09 | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102586143B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740607B (en) * | 2013-11-28 | 2015-10-14 | 中国农业科学院农业资源与农业区划研究所 | A kind of mocha husband bacillus and microbiobacterial agent and their application |
| CN103931659B (en) * | 2014-04-30 | 2016-08-24 | 武汉虹睿生物科技开发有限公司 | Mo Hawei bacillus KJS-3 is as the application of biological pesticide |
| CN104152385A (en) * | 2014-08-11 | 2014-11-19 | 甘肃农业大学 | Bacillus mojavensis QLY002 strain, microbial inoculum, preparation method of microbial inoculum and use of Bacillus mojavensis QLY002 strain and microbial inoculum |
| CN110628661B (en) * | 2019-07-05 | 2022-02-11 | 哈尔滨师范大学 | Bacillus mojavensis CJX-61 and application thereof |
| CN115287214B (en) * | 2022-05-25 | 2023-04-14 | 甘肃省农业科学院植物保护研究所 | Compound microorganism, compound microbial agent and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321559A (en) * | 2011-09-26 | 2012-01-18 | 南京农业大学 | Bio-control strain CS23 used for controlling downy mildew of greenhouse cucumbers, and application thereof |
| CN102329758A (en) * | 2011-10-12 | 2012-01-25 | 淮阴师范学院 | Biological prevention bacterial strain BS1 (bacillus cereus) for preventing and controlling greenhouse cucumber downy mildew and application thereof |
-
2012
- 2012-02-09 CN CN2012100280982A patent/CN102586143B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321559A (en) * | 2011-09-26 | 2012-01-18 | 南京农业大学 | Bio-control strain CS23 used for controlling downy mildew of greenhouse cucumbers, and application thereof |
| CN102329758A (en) * | 2011-10-12 | 2012-01-25 | 淮阴师范学院 | Biological prevention bacterial strain BS1 (bacillus cereus) for preventing and controlling greenhouse cucumber downy mildew and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 李星 等.芽孢杆菌对黄瓜霜霉病的防治效果研究.《植物保护》.2003,第29卷(第4期),25-27. |
| 芽孢杆菌对黄瓜霜霉病的防治效果研究;李星 等;《植物保护》;20030831;第29卷(第4期);25-27 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102586143A (en) | 2012-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102586142B (en) | Bacillus subtilis for preventing and curing cucumber downy mildew and microbial inoculants thereof | |
| CN102965314B (en) | Bacillus subtilis and preparation and application of microbial inoculum thereof | |
| CN111100820B (en) | Bacillus belgii HMB28023 and application thereof | |
| CN105441366B (en) | Methylotrophic bacillus ZBL-1 is applied in preventing cotton verticillium wilt | |
| CN104164394A (en) | Antagonistic phytopathogen strain and application thereof | |
| CN105199996B (en) | A kind of bacillus amyloliquefaciens and its application for preventing graw mold of tomato | |
| CN106244504B (en) | Bacillus subtilis and its microbial inoculum with degrading organic phosphor and bacteriostasis | |
| CN105176894B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention graw mold of tomato | |
| CN104877926B (en) | The bacterial strain of one plant of antagonism smoke tree wilt and its application | |
| CN102586143B (en) | Bacillus mojavensis and microorganism bacterium agent thereof for controlling cucumber downy mildew | |
| CN105199997A (en) | Bacillus subtilis for controlling cotton rhizoctonia and application of bacillus subtilis | |
| CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
| CN110358710A (en) | One plant of bacillus laterosporus and preparing the application in disease-resistant saline-alkali tolerant functional microorganism preparation | |
| CN108192838A (en) | A kind of bacillus amyloliquefaciens with degradation Phos and diseases prevention double action | |
| CN101215543A (en) | Strain for preventing and curing muskmelon bacteroidal spot disease and application thereof in field disease prevention | |
| CN107502565B (en) | One plant of fritillary bulb rhizosphere Paenibacillus polymyxa and its application | |
| CN112342173A (en) | Bacillus belgii and application thereof | |
| CN102747005B (en) | Bacillus atrophaeus for prevention and control of cotton boll blight, and microbial agent thereof | |
| CN105176893B (en) | A kind of bacillus amyloliquefaciens and its application for preventing crop damping-off | |
| CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
| CN108048360B (en) | Bacillus subtilis with dual functions of degrading organic phosphorus and preventing diseases | |
| CN107043719B (en) | bacillus amyloliquefaciens HMB28353 and application thereof | |
| CN107043720B (en) | Bacillus amyloliquefaciens HMB28388 and application thereof | |
| CN108913625A (en) | Salt tolerant streptomycete, its microbial inoculum and its microbial inoculum are promoting the application in plant growth | |
| CN105349457B (en) | A kind of bacillus amyloliquefaciens and its application in leaf blight of corn biological and ecological methods to prevent plant disease, pests, and erosion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |