CN113736758A

CN113736758A - Bergenia oxy methyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxygallic acid

Info

Publication number: CN113736758A
Application number: CN202111040376.1A
Authority: CN
Inventors: 张广辉; 刘祥宇; 陈碧环; 王益娜; 袁慧娟; 向贵生; 张敬丽; 郝冰
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2021-09-06
Filing date: 2021-09-06
Publication date: 2021-12-03
Anticipated expiration: 2041-09-06
Also published as: CN113736758B

Abstract

The invention discloses a bergenia oxy methyltransferase BpOMT1 gene and application thereof in preparing 4-methoxy gallic acid. The sequence of the bergenia purpurascens oxygen methyltransferase BpOMT1 gene is shown as SEQ ID NO: 1 is shown. The method takes gallic acid and S-adenosyl-methionine as raw materials, generates 4-methoxy gallic acid under the catalysis of bergenia oxy methyltransferase BpOMT1, and has important significance for the regulation and control research of bergenin biosynthesis.

Description

Bergenia oxy methyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxygallic acid

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a bergenia oxy methyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxygallic acid.

Background

Rhizoma Seu herba Bergeniae (Bergenia purpurescens) is a plant of Bergenia of Saxifragaceae. The Asia plant has 10 Asia plants, except 3 Asia plants produced in east Asia, north Asia and south Asia, it is mainly distributed in Shaanxi, Xinjiang, Sichuan, Yunnan and Tibet. The whole bergenia plant contains bergenin, especially bergenin extracted from bergenia rhizome is 8.2%. Bergenin has multiple Effects of relieving cough, resisting inflammation, resisting anxiety, resisting oxidation, resisting malaria, resisting cancer, treating diabetes, resisting hepatotoxicity, regulating immunity and protecting nerves (Shihao Xiao, Bergenin Exerts Hepatoprotective Effects by Inhibiting the Release of antibiotics Factors, Apoptosis and Autophagy via the PPAR-gamma pathway. drug Des device. 2020; 14: 129-. The scholars at home and abroad find that the bergenin has selective inhibition effect on cough centers, no inhibition effect on other nerve centers, small toxic and side effect, less adverse reaction, no drug resistance after continuous use and the like, which are different from morphine type antitussive medicines for inhibiting the cough centers (Wangchong, research on pharmacokinetics of the bergenin for human bodies and animals and action on IGABA. Shandong university, 2010.).

Bergenin belongs to the isocoumarins class of compounds, and the bergenin biosynthesis precursor is rearrangement (rearrangement) of 2-glucose-4-methoxygallic acid after intramolecular dehydration or ring closure under the action of unknown dehydratase (Gan B. Bajrachaya. conversion, pharmacology and synthesis of bergenin and its derivatives: steric materials for thermal use. Fitoterpia. 2015; 101: 133-52.); the 2-glucose-4-methoxygallic acid is generated by connecting glucose at the 2-position by using uridine diphosphate glucose (UDP-glucose) as a glycosyl donor under the catalysis of carbon glycosyl transferase (CGT, C-glucosyltransferase) by using 4-methoxygallic acid; 4-methoxy Gallic acid (4-O-methyl Gallic acid, 4-O-ME-GA) comes from Gallic acid (Gallic acid, GA), is catalyzed and generated by Gallic acid oxygen position methyltransferase (OMT, O-methyl transferase) and S-adenosyL-methionine (SAM, S-adenosyL L-methionine) as a methyl donor, so that the biosynthesis of 4-methoxy Gallic acid has important significance for the regulation and control research of bergenin biosynthesis.

In recent years, wild resources of bergenia herbs are decreasing due to disordered mining and digging of human beings. The research on the biosynthesis pathway of bergenin is developed, so that a foundation is provided for artificial cultivation measures of bergenin and improvement of content of active ingredients, and the pressure of wild resources is relieved. Meanwhile, the planting period of the bergenin extraction raw material is long, and the requirements on planting plots and planting technology are high. Therefore, how to obtain the useful secondary metabolites efficiently is always a question for thinking and researching by researchers. For natural products with high added values, homologous or heterologous expression systems established by adopting modern biotechnology for efficiently producing medicinal active ingredients are widely regarded as important technical means for solving the shortage of medicinal resources in the future. However, in order to understand the biosynthetic pathways of these active ingredients, it is necessary to identify key genes related to these pathways, and the discovery of these catalytic enzyme genes has become a key link in the study of biosynthetic pathways of plant metabolites. At present, the synthesis path of gallic acid for catalyzing and forming 4-methoxy gallic acid by methylation reaction at C-4 hydroxyl is not clear, the function of oxygen methyltransferase responsible for methylation is not verified, and the promotion of bergenin biosynthesis work is influenced.

Disclosure of Invention

In order to solve the technical problem of how to obtain a large amount of high-purity 4-methoxygallic acid biosynthesis, the invention provides a bergenia oxy-methyltransferase BpOMT1 gene which can be used as a biosynthesis regulation gene of 4-methoxygallic acid and applied to preparation of the 4-methoxygallic acid.

The invention provides a bergenia oxy methyltransferase BpOMT1 gene, the nucleic acid sequence of which is shown as SEQ ID NO: 1, the total length of the sequence is 1077 bp.

The invention also provides bergenia purpurascens oxygen methyltransferase BpOMT1, which is obtained by encoding bergenia purpurascens oxygen methyltransferase BpOMT1 gene, and encodes 358 amino acid residues, and the amino acid series of the bergenia purpurascens oxygen methyltransferase BpOMT is shown as SEQ ID NO: 2, respectively.

The invention also provides a recombinant plasmid containing the bergenia purpurascens oxygen methyltransferase BpOMT1 gene.

Preferably, the recombinant plasmid is obtained by homologous recombination of the bergenia purpurascens oxygen methyltransferase BpOMT1 gene and a pET28a vector, and is named as pET28a-BpOMT 1.

The invention also provides a transgenic engineering bacterium, which contains the recombinant plasmid, or the exogenous bergenia purpurascens oxygen methyltransferase BpOMT1 gene is integrated in the genome of the transgenic engineering bacterium.

Preferably, the genetically engineered bacterium is escherichia coli BL21(DE3) strain.

The invention also provides application of the bergenia oxy methyltransferase BpOMT1 in preparation of 4-methoxygallic acid.

Preferably, in the application of the bergenia purpurascens oxygen methyltransferase BpOMT1 in preparing 4-methoxy Gallic acid, Gallic acid and methyl donor S-adenosyl-methionine are used as raw materials, and methylation reaction is carried out on hydroxyl on C-4 position of Gallic acid (Gallic acid) under the catalysis of bergenia purpurascens oxygen methyltransferase (amino acid series is shown as SEQ ID NO: 2) encoded by the bergenia purpurascens oxygen methyltransferase BpOMT1 gene to generate 4-methoxy Gallic acid (4-O-Methylgallic acid, 4-O-ME-GA).

The invention also provides a primer for cloning the bergenia purpurascens oxygen methyltransferase BpOMT1 gene, wherein the primer consists of a primer F and a primer R, and the nucleotide sequence of the primer F is shown as SEQ ID NO: 3, the nucleotide sequence of the primer R is shown as SEQ ID NO: 4, respectively.

The invention obtains target protein (bergenia purpurascens oxygen methyltransferase BpOMT1) after in vitro expression through recombinant plasmid, and 4-methoxy gallic acid is directly generated through further catalyzing substrate gallic acid.

The bergenia purpurascens oxygen methyltransferase BpOMT1 gene is identified from the rhizome of bergenia purpurascens through transcriptome sequencing and bioinformatics technology and screening after a large number of experiments; RNA of bergenia crassifolia rhizome is extracted by adopting an RNA reagent, and is obtained by carrying out PCR amplification after the RNA is reversely transcribed into cDNA.

Compared with the prior art, the invention has the beneficial effects that:

(1) with the rapid development of bioinformatics technology, the excavation of key enzyme genes of 4-methoxygallic acid biosynthesis pathway is greatly promoted. The biosynthesis regulatory gene of the 4-methoxygallic acid, namely the gene BpOMT1 of the oxygen methyltransferase, is first identified and successfully verified, and a novel biosynthesis method for producing the 4-methoxygallic acid is developed. The invention obtains the target product by the modes of heterologous expression and in vitro enzyme catalysis, adopts in vitro biosynthesis and carries out oriented production, and has the advantages of less by-products and the like.

(2) The invention provides a recombinant plasmid, a genetic engineering bacterium and a recombinant protein containing bergenia purpurascens oxygen methyltransferase BpOMT1 gene, which lay a foundation for synthesizing a large amount of 4-methoxygallic acid by a biological engineering method and further for researching the biosynthesis regulation and control of bergenin.

(3) 4-methoxygallic acid is biosynthesized in vitro, the controllability is strong, the requirement on raw material planting can be reduced, the product is single, and the separation and purification of the 4-methoxygallic acid at the later stage are facilitated; and the problems of difficult chemical synthesis, complex synthetic route and the like can be reduced. The bergenia purpurascens oxygen methyltransferase BpOMT1 gene is used as a key gene for biosynthesis of 4-methoxygallic acid, and can also be used for breeding research of plants such as bergenia purpurascens.

(4) The bergenia oxy-methyltransferase BpOMT1 gene separated and identified from bergenia can be used as an important marker gene for molecular assisted breeding of bergenia and an important candidate gene for producing 4-methoxygallic acid in yeast chassis cell construction.

SEQ ID NO: 1 shows the nucleotide sequence of bergenia oxy methyltransferase BpOMT1 gene.

SEQ ID NO: 2 is the amino acid series of bergenia oxy methyltransferase BpOMT 1.

SEQ ID NO: 3 shows the nucleotide sequence of primer F.

SEQ ID NO: 4 shows the nucleotide sequence of primer R.

SEQ ID NO: 5 shows the nucleotide sequence of the upstream homology arm primer.

SEQ ID NO: 6 shows the nucleotide sequence of the downstream homology arm primer.

Drawings

FIG. 1 is a schematic diagram of the deduced synthesis route of 4-methoxygallic acid.

FIG. 2 is a schematic diagram of the construction of recombinant expression plasmid pET28a-BpOMT1 (for expressing bergenia purpurascens oxygen methyltransferase BpOMT1 gene).

FIG. 3 shows the result of electrophoresis detection of bergenia oxy methyltransferase BpOMT1 gene recombination. Wherein, M is a nucleic acid Marker, and 1, 2 and 3 are three positive single colony detection results.

FIG. 4 is an SDS-PAGE protein electrophoresis image of bergenia oxy methyltransferase BpOMT 1. Wherein, M: protein molecular mass standard;

lanes

1, 2, 3, 4, 5, 6, and 7 are sequentially for protein under precipitation, flow-through eluent, 20mmol/L imidazole eluent, 30mmol/L imidazole eluent, 50mmol/L imidazole eluent, 100mmol/L imidazole eluent, and 250mmol/L imidazole eluent, respectively.

FIG. 5 shows HPLC detection of methylation of the hydroxyl group at C-4 of Gallic acid (Gallic acid) by oxygen methyltransferase BpOMT 1. FIG. 5A: a methylation-presumed pathway at the hydroxyl group at the C-4 position of Gallic Acid (GA); FIG. 5B: the bergenia purpurascens oxygen methyltransferase BpOMT1 has enzyme activity reaction result, and the abscissa is time in unit of min; the ordinate is the response value in mAU; wherein, CK: the control group (gallic acid + S-adenosyl-methionine + inactivated bergenia purpurascens oxygen methyltransferase BpOMT1) enzyme activity reaction result of enzyme inactivation; and (4) standard product: a gallic acid standard plus a 4-methoxygallic acid standard; BpOMT 1: the result of the enzyme activity reaction of the experimental group (gallic acid + S-adenosyl-methionine + bergenia oxy methyltransferase BpOMT 1).

FIG. 6 is a mass spectrometry (LC/MS/MS) profile of a standard, wherein FIG. 6-A is a total ion flow plot;

FIG. 6-B shows the retention time of the standard gallic acid at 15.96 min; FIG. 6-C shows the retention time of 4-methoxygallic acid as standard 23.26 min.

FIG. 7 is a mass spectrometry (LC/MS/MS) profile of the enzyme activity validation reaction product, wherein FIG. 7-A is a total ion flow graph; FIG. 7-B shows the retention time of the substrate gallic acid at 15.45 min; FIG. 7-C shows the retention time of the reaction product 4-methoxygallic acid at 23.86 min.

FIG. 8 is a fragment ion diagram (theoretical molecular weight 184) (LC/MS/MS) of 4-methoxygallic acid as a standard.

FIG. 9 is a fragment ion diagram (theoretical molecular weight 184) of the reaction product 4-methoxygallic acid (LC/MS/MS).

Detailed Description

Example 1

Based on basic function annotation information of bergenia transcription group Unigene, OMT candidate genes are screened in a sequencing annotation result, meanwhile, Oxygen Methyltransferase (OMT) identified in plants is analyzed through sequence local BLAST, then the screening result is sorted and analyzed, and finally 1 Oxygen Methyltransferase (OMT) gene is found. Then, after a series of work such as preparation of cDNA, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reaction, HPLC (high performance liquid chromatography) and LC/MS/MS (liquid chromatography/mass spectrometry) detection and the like, a target candidate oxygen methyltransferase BpOMT1 gene which can catalyze the methylation reaction on the hydroxyl on the C-4 position of Gallic acid (Gallic acid) to generate 4-methoxygallic acid is finally identified (figure 1). The operation steps of each stage of the synthesis of the 4-methoxygallic acid are as follows (reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

(1) preparation of cDNA template

Taking a fresh sample of bergenia crassifolia rhizome, slicing, quickly freezing by liquid nitrogen, and extracting total RNA. Total RNA extraction adopts a HiPure Plant RNA Mini Kit of magenta (Meyji Biotechnology Co., Ltd., Guangzhou), total RNA is extracted according to the operation steps of the Kit, and after the total RNA is detected to be qualified, the total RNA is reversely transcribed into cDNA by using a TAKARA reverse transcription Kit, and the cDNA is stored at the temperature of minus 20 ℃ for standby.

(2) Gene amplification and recovery

A primer Design software (CE Design) v1.04 is utilized to Design a primer for amplifying bergenia crassifolia oxymethyltransferase BpOMT1 gene, the primer consists of a primer F (SEQ ID NO: 3) and a primer R (SEQ ID NO: 4), the operation is carried out according to the high-fidelity KOD enzyme use instruction, and KOD high-fidelity enzyme is adopted to carry out gene amplification by taking bergenia crassifolia cDNA as a template. The PCR reaction program is: 94 ℃ for 5 min; 94 ℃, 30S, 58 ℃, 50S, 72 ℃, 1min, 35 cycles; 72 deg.C, 7 min. After the PCR is finished, the gel is run, and the target band is recovered after the successful amplification is confirmed. Gene cutting recovery Using EasyPure Quick Gel Extraction Kit from Beijing all-terrain gold Biotechnology Ltd, recovery of the target gene was performed. And (3) after recovery, determining the recovery concentration of the protein on a NanoReady ultramicro ultraviolet-visible spectrophotometer, finally storing the protein in a refrigerator at the temperature of-20 ℃ for later use to obtain a bergenia oxy-methyltransferase BpOMT1 gene fragment, and sequencing the nucleotide sequence of the fragment to be shown as SEQ ID NO: 1 is shown.

In addition, when the bergenia purpurascens oxygen methyltransferase BpOMT1 gene segment with the carrier homologous arm is subjected to homologous recombination with the carrier pET28a (the homologous arm is escherichia coli pET28a), the bergenia purpurascens oxygen methyltransferase BpOMT1 gene needs to be amplified and recovered by using a primer with the homologous wall (namely a homologous arm primer), the homologous arm primer consists of an upstream homologous arm primer (shown as SEQ ID NO: 5 in a sequence table) and a downstream homologous arm primer (shown as SEQ ID NO: 6 in the sequence table), the bergenia purpurascens oxygen methyltransferase BpOMT1 gene is used as a template, the operation is carried out according to a high-fidelity KOD enzyme use instruction, and the PCR amplification is carried out again to obtain the bergenia purpurascens oxygen methyltransferase BpOMT1 gene segment with the carrier homologous arm.

Upstream homology arm primer: atgggtcgcggatcc ATGGCTCCACAAAATGAAGCAG (SEQ ID NO: 5).

Downstream homology arm primers:

acggagctcgaattcggatccCTACTTCAAGAATTCCATGATATAAGAATTGAAAGC (shown in SEQ ID NO: 6).

The upper homologous arm primer (SEQ ID NO: 5) and the lower homologous arm primer (SEQ ID NO: 6) have middle and lower letters representing pET28a homologous arms and upper letters representing the primer sequence of the amplified bergenia purpurascens O-methyltransferase BpOMT1 gene.

(3) Construction and identification of Gene recombination vector

A schematic representation of homologous recombination is shown in detail in FIG. 2. Firstly, the vector pET28a was linearized, and the linearized vector was obtained by a single cleavage with BamH I enzyme. Assembling according to the operation instruction of homologous recombinase during homologous recombination, and then calculating the use amount of each component according to the concentrations of a bergenia purpurascens oxygen methyltransferase BpOMT1 gene fragment with a vector homologous arm and a pET28a vector and the recombination instruction; and finally, adding the components into a PCR reaction tube on ice, and carrying out homologous recombination on the bergenia purpurascens oxygen methyltransferase BpOMT1 gene and a pET28a vector to obtain a recombinant plasmid which is named as pET28a-BpOMT 1. The results were examined after assembly and sent to the company for sequencing, and the results of electrophoresis after assembly are shown in FIG. 3, indicating successful assembly. The recombination operation is carried out according to the following processes:

TABLE 1 candidate Gene recombination reaction System

Wherein X (base number 0.02 × pET28a) ng/linearized pET28a concentration ng/μ L; y (0.02 x pET28a base pairs) ng/bergenia oxy methyltransferase BpOMT1 recovery concentration ng/uL, and the inserted gene fragment is the bergenia oxy methyltransferase BpOMT1 gene fragment with a carrier homologous arm.

(4) SDS-PAGE protein electrophoretic detection

Protein induction conditions of BpOMT1 were determined by protein expression experiments to be: inducing for 12h at 17 ℃ with 0.1mM IPTG and 220 r/min; and then shaking greatly, collecting bacteria, breaking the wall, obtaining protein supernatant after high-speed centrifugation (12000r/min), and performing SDS-PAGE protein electrophoresis and detection. The detection result is shown in figure 4, and figure 4 shows that the BpOMT1 protein can be eluted and purified under 250mmol/L imidazole eluent.

(5) Enzyme activity reaction

The enzyme activity of bergenia oxy methyltransferase BpOMT1 was determined by methylation reaction to synthesize 4-methoxygallic acid in a 1.5mL centrifuge tube. Experimental samples the mixture in the reaction system contained: 2 microliter of 100mM S-adenosyl-methionine, 2 microliter of 100mM gallic acid, and 40. mu.g of purified bergenia oxy methyltransferase BpOMT1, and 50mM Tris-HCl buffer (pH 8.0) was added to the total volume of 100. mu.L, and the total volume of the reaction system was 100. mu.L. After incubation at 31 ℃ for 2 hours, the equivalent volume of 1M HCl was stopped, centrifuged briefly (12000r/min) and the supernatant was removed. And finally, detecting the reaction product by HPLC and LC-MS/MS analysis.

Control (CK) reaction system: 2 microliter of 100mM gallic acid, 2 microliter of 100mM S-adenosyl-methionine, and 40. mu.g of inactivated purified bergenia oxy methyltransferase BpOMT1, and 50mM Tris-HCl buffer (pH 8.0) was added to the total volume of 100. mu.L, and the total volume of the reaction system was 100. mu.L.

And (4) standard product: 50 microlitre of 10mM gallic acid standard and 50 microlitre of 10mM 4-methoxygallic acid standard.

(6) Product detection

The HPLC detection conditions were as follows:

the HPLC detection instrument is an Agilent 1290 ultra-high performance liquid chromatograph. Column for XBridge Shield RP18(4.6mm × 250mm,5 μm), column temperature: 30 ℃; determination of 4-methoxygallic acid mobile phase to 0.01% v/v aqueous formic acid (a) -acetonitrile (B), gradient elution: 0-8 min, 1% -5% of B; 8-13 min, 5% -10% of B; 13-20 min, 10% -20% of B; 20-25 min, 20% -45% of B; 25-35 min, 45% -90% of B; 35-40 min, 90-90% B; elution time: 40 min; sample introduction amount: 10 microliter; flow rate: 0.6 ml/min; the detection wavelength is 230 nm. The detection result is shown in figure 5, which shows that the experimental sample produces 4-methoxygallic acid under the catalysis of bergenia oxy methyltransferase BpOMT 1.

The LC-MS/MS detection conditions were as follows:

to further confirm the reaction products detected by HPLC, detection was performed using an Agilent 1290UPLC/6540Q-TOF liquid chromatography mass spectrometer (LC/MS/MS): mass spectrum conditions: the ion source adopts a negative ion mode, and the voltage: 3500V; fragmentation voltage is 135V; the taper hole voltage is 60V; radio frequency voltage 750V, scanning range: 100-1000m/z, scanning mode: and (6) SRM. Chromatographic conditions are as follows: column for XBridge Shield RP18(4.6mm, × 250mm,5 μm), column temperature: determination of the mobile phase of 4-methoxygallic acid at 30 ℃ in 0.01% v/v aqueous formic acid (A) -acetonitrile (B), gradient elution: 0-8 min, 1% -5% of B; 8-13 min, 5% -10% of B; 13-20 min, 10% -20% of B; 20-25 min, 20% -45% of B; 25-35 min, 45% -90% of B; 35-40 min, 90-90% B; elution time: 40 min; sample introduction amount: 10 microliter; flow rate: 0.6 ml/min; the detection wavelength is 230 nm.

The detection results are shown in FIGS. 6 to 9, and it can be seen from the results that the peak-off time and the characteristic fragment ions of the product are matched with those of the standard 4-methoxygallic acid, and the reaction product is confirmed to be 4-methoxygallic acid. Finally, the obtained oxygen methyltransferase BpOMT1 has the capability of catalyzing the oxygen at the C4 position of the gallic acid to carry out primary methylation to generate the 4-methoxygallic acid.

Sequence listing

<110> Yunnan university of agriculture

<120> bergenia oxy methyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxygallic acid

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1077

<212> DNA

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 1

atggctccac aaaatgaagc agcagcagct gaagaagaag caaacctatt tgccatgcaa 60

ctagcaagtg catcagtctt accaatggta cttaaatcag ccatagaact agaccttcta 120

gaaatcatgg ctaaatctgg cccaggtgca tacatgtcac ccatagatat agcctctcag 180

cttcctacaa acaatccaga tgcacctgtc atgctcgacc gcattttgcg cctgctagca 240

tgctactctg ttctcacttg ctctgtccga aatctccctg atggccgtgt tgagaggctt 300

tatggtctgg cacctgtttg taagtacttg accaagaatg aggaaggtgt ctctattgct 360

gctctttgtc tcatgaatca agacaagatc ctcatggaga gctggtacca cttgaaagat 420

gcagttcttg atggtggcat tccattcaac aaggcttatg gaatgtctgc cttcgagtac 480

cacggcacgg atcctagatt caacaaggtt tttaacaggg gaatgtctga tcactcaaca 540

attaccatga agaaaatcct tgagacatac aaaggatttg agggactcac atctgtcgtc 600

gacgttggtg gtggtactgg agccactctt aacatgatcc tctccaagta tcccaacatt 660

aggggcatta actttgattt gcctcatgtg attgaggatg ccccatctta tcctggtgtg 720

gagcatgttg gaggagacat gtttgttagt gttccaaaag gggatgctat tttcatgaag 780

tggatatgtc atgactggag cgacgaacac tgcttgaaat ttttgaagaa ttgctatgat 840

gcacttccga gcaatgggaa ggtgattctt gctgaatgca ttcttccagt aacgccggac 900

actagccttg caactaaagg agttgtccat atcgatgtga tcatgttagc gcataatcca 960

ggagggaagg aaaggactga gaaggagttt gaggccttgg caaaaggtgc tggatttcaa 1020

ggcttccaag tattctgcaa tgctttcaat tcttatatca tggaattctt gaagtag 1077

<210> 2

<211> 358

<212> PRT

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 2

Met Ala Pro Gln Asn Glu Ala Ala Ala Ala Glu Glu Glu Ala Asn Leu

1 5 10 15

Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu Pro Met Val Leu Lys

20 25 30

Ser Ala Ile Glu Leu Asp Leu Leu Glu Ile Met Ala Lys Ser Gly Pro

35 40 45

Gly Ala Tyr Met Ser Pro Ile Asp Ile Ala Ser Gln Leu Pro Thr Asn

50 55 60

Asn Pro Asp Ala Pro Val Met Leu Asp Arg Ile Leu Arg Leu Leu Ala

65 70 75 80

Cys Tyr Ser Val Leu Thr Cys Ser Val Arg Asn Leu Pro Asp Gly Arg

85 90 95

Val Glu Arg Leu Tyr Gly Leu Ala Pro Val Cys Lys Tyr Leu Thr Lys

100 105 110

Asn Glu Glu Gly Val Ser Ile Ala Ala Leu Cys Leu Met Asn Gln Asp

115 120 125

Lys Ile Leu Met Glu Ser Trp Tyr His Leu Lys Asp Ala Val Leu Asp

130 135 140

Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser Ala Phe Glu Tyr

145 150 155 160

His Gly Thr Asp Pro Arg Phe Asn Lys Val Phe Asn Arg Gly Met Ser

165 170 175

Asp His Ser Thr Ile Thr Met Lys Lys Ile Leu Glu Thr Tyr Lys Gly

180 185 190

Phe Glu Gly Leu Thr Ser Val Val Asp Val Gly Gly Gly Thr Gly Ala

195 200 205

Thr Leu Asn Met Ile Leu Ser Lys Tyr Pro Asn Ile Arg Gly Ile Asn

210 215 220

Phe Asp Leu Pro His Val Ile Glu Asp Ala Pro Ser Tyr Pro Gly Val

225 230 235 240

Glu His Val Gly Gly Asp Met Phe Val Ser Val Pro Lys Gly Asp Ala

245 250 255

Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp Glu His Cys Leu

260 265 270

Lys Phe Leu Lys Asn Cys Tyr Asp Ala Leu Pro Ser Asn Gly Lys Val

275 280 285

Ile Leu Ala Glu Cys Ile Leu Pro Val Thr Pro Asp Thr Ser Leu Ala

290 295 300

Thr Lys Gly Val Val His Ile Asp Val Ile Met Leu Ala His Asn Pro

305 310 315 320

Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu Ala Leu Ala Lys Gly

325 330 335

Ala Gly Phe Gln Gly Phe Gln Val Phe Cys Asn Ala Phe Asn Ser Tyr

340 345 350

Ile Met Glu Phe Leu Lys

355

<210> 3

<211> 22

<212> DNA

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 3

atggctccac aaaatgaagc ag 22

<210> 4

<211> 36

<212> DNA

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 4

ctacttcaag aattccatga tataagaatt gaaagc 36

<210> 5

<211> 37

<212> DNA

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 5

atgggtcgcg gatccatggc tccacaaaat gaagcag 37

<210> 6

<211> 57

<212> DNA

<213> Bergenia purpurascens (Bergenia purprascens)

<400> 6

acggagctcg aattcggatc cctacttcaa gaattccatg atataagaat tgaaagc 57

Claims

1. A bergenia purpurascens oxygen methyltransferase BpOMT1 gene has a nucleic acid sequence shown as SEQ ID NO: 1 is shown.

2. Bergenia oxy methyltransferase BpOMT1, the amino acid series of which is shown in SEQ ID NO: 2, respectively.

3. A recombinant plasmid containing bergenia purpurascens oxygen methyltransferase BpOMT1 gene of claim 1.

4. The recombinant plasmid of claim 3, wherein the recombinant plasmid is obtained by homologous recombination of the bergenia purpurascens oxygen methyltransferase BpOMT1 gene of claim 1 and pET28a vector, and is named pET28a-BpOMT 1.

5. A genetically engineered bacterium comprising the recombinant plasmid of claim 3 or 4, or having the exogenous bergenia purpurascens oxygen methyltransferase BpOMT1 gene integrated into the genome of the genetically engineered bacterium.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is Escherichia coli BL21(DE3) strain.

7. The use of bergenia purpurascens oxygen methyltransferase BpOMT1 in the preparation of 4-methoxygallic acid according to claim 2.

8. The use of claim 7, wherein gallic acid and S-adenosyl-methionine are used as raw materials, and the 4-methoxygallic acid is produced under the catalysis of bergenia purpurascens oxygen methyltransferase BpOMT1 in claim 2.

9. The primer for cloning the bergenia purpurascens oxygen methyltransferase BpOMT1 gene of claim 1, which is characterized in that the primer consists of a primer F and a primer R, wherein the nucleotide sequence of the primer F is shown as SEQ ID NO: 3, the nucleotide sequence of the primer R is shown as SEQ ID NO: 4, respectively.