CN112852697B

CN112852697B - Recombinant strain and method for preparing gastrodin

Info

Publication number: CN112852697B
Application number: CN202110087348.9A
Authority: CN
Inventors: 徐德宏; 谭朝阳; 崔培梧; 罗月芳; 江灵敏; 罗怀浩
Original assignee: Hunan University of Chinese Medicine
Current assignee: Hunan University of Chinese Medicine
Priority date: 2021-01-22
Filing date: 2021-01-22
Publication date: 2023-02-10
Anticipated expiration: 2041-01-22
Also published as: CN112852697A

Abstract

The invention relates to a genetic engineering technology, and discloses a recombinant strain and a method for preparing gastrodin by using the recombinant strain. The recombinant strain provided by the invention is recombinant escherichia coli containing a tyrosine lyase gene and a 4-hydroxytoluene methyl hydroxylase gene. The present invention also provides a method for preparing a recombinant strain, comprising the steps of: and sequentially introducing the tyrosine lyase gene and the 4-hydroxytoluene methyl hydroxylase gene into the escherichia coli strain. The invention also provides a method for preparing the gastrodin, which comprises the following steps: after the recombinant strain or the recombinant strain prepared by the method is subjected to induction culture, the recombinant strain is inoculated into a culture medium containing tyrosine for transformation culture so as to transform the tyrosine into gastrodin. The recombinant strain provided by the invention can effectively catalyze tyrosine to be converted into gastrodin, has good growth and reproduction performance, and has the advantages of few byproducts, mild reaction conditions, simple process and the like.

Description

Recombinant strain and method for preparing gastrodin

Technical Field

The invention relates to a genetic engineering technology, in particular to a recombinant strain and a method for preparing gastrodin by using the recombinant strain.

Background

Gastrodin is an important precursor substance for forming gastrodin, and has chemical name of 4-hydroxybenzyl alcohol or p-hydroxybenzyl alcohol, molecular weight of 124, and molecular formula C ₇ H ₈ O ₂ The extract is colorless needle-like crystal substance with melting point of 124-126 deg.C, is easily soluble in methanol, ethanol and acetone, and is soluble in chloroform and diethyl ether. Modern pharmacological research finds that 4-hydroxybenzyl alcohol as gastrodin not only has some similarities with gastrodin in some pharmacological properties, but also has some unique pharmacological properties such as anti-inflammation, anti-tumor and cerebral ischemia protection, so that 4-hydroxybenzyl alcohol is more and more favored by drug researchers.

The traditional method for obtaining the gastrodin mainly comprises natural extraction and chemical synthesis, but the traditional method has some defects which limit the long-term application of the gastrodin. For natural extraction, the defects mainly come from two aspects, on one hand, the content of gastrodin in the plant is generally not high, and the resource of the plant is limited, which becomes a bottleneck problem inherent in the natural extraction method; on the other hand, it is not easy to purify the single gastrodin from the extracted mixture. For chemical synthesis, although the problem of raw material sources can be avoided, in the actual preparation process, some inherent disadvantages of the chemical synthesis method can not be overcome, such as toxic reaction reagents, more reaction steps, long reaction time, harsh reaction conditions, more reaction byproducts, difficult treatment of three wastes in the reaction and the like. Therefore, how to artificially prepare high-yield and high-purity gastrodin has become an urgent problem to be solved by pharmaceutical research workers.

Disclosure of Invention

The invention aims to overcome the problems in the prior art, and provides a recombinant strain and a method for preparing gastrodin by using the recombinant strain, which can optimize the biosynthesis pathway of the gastrodin.

In order to achieve the above objects, the present invention provides, in a first aspect, a recombinant strain of Escherichia coli comprising a tyrosine lyase gene and a 4-hydroxytoluene methyl hydroxylase gene.

Preferably, the nucleotide sequence of the tyrosine lyase gene is shown as SEQ ID NO. 1.

Preferably, the 4-hydroxytoluene methyl hydroxylase gene comprises a pchF gene and a pchC gene, wherein the nucleotide sequence of the pchF gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the pchC gene is shown as SEQ ID NO. 3.

Preferably, the starting strain of the recombinant strain is escherichia coli BL21.

Preferably, the recombinant strain contains an expression vector, and the expression vector is pcdfDUET-1.

In a second aspect, the present invention provides a method for producing a recombinant strain, comprising the steps of: and sequentially introducing the tyrosine lyase gene and the 4-hydroxytoluene methyl hydroxylase gene into an escherichia coli starting strain.

Preferably, the nucleotide sequence of the tyrosine lyase gene is shown as SEQ ID NO. 1; the 4-hydroxytoluene methyl hydroxylase gene comprises a pchF gene and a pchC gene, wherein the nucleotide sequence of the pchF gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the pchC gene is shown as SEQ ID NO. 3;

preferably, the escherichia coli starting strain is escherichia coli BL21;

The third aspect of the invention provides the recombinant strain and application of the recombinant strain prepared by the method in preparation of gastrodin.

The fourth aspect of the present invention provides a method for preparing gastrodin, comprising: and (3) performing induction culture on the recombinant strain or the recombinant strain prepared by the method, and then inoculating the recombinant strain into a culture medium containing tyrosine for transformation culture so as to transform the tyrosine into gastrodin.

Preferably, the inducer for inducing culture contains isopropyl-beta-D-thiogalactoside, the content of tyrosine in the medium containing tyrosine is 0.01-0.05wt%, and the transformation culture at least meets the following conditions: the inoculation amount is 10-30g/L, the transformation temperature is 25-40 ℃, the transformation speed is 200-300rpm, and the transformation time is 3-12h. Through the technical scheme, the invention has the beneficial effects that:

the invention takes escherichia coli BL21 (DE 3) as a host, takes a tyrosine lyase gene (ThiH gene) and a 4-hydroxytoluene methyl hydroxylase gene (pchF gene and pchC gene) as target genes, and takes pcdfDUET-1 as a vector, thereby successfully constructing a recombinant strain for synthesizing gastrodin by efficiently catalyzing tyrosine; the recombinant strain provided by the invention can effectively catalyze tyrosine to be converted into gastrodin, has good growth and reproduction performance, has the advantages of few byproducts, mild reaction conditions, simple process and the like, optimizes the biosynthesis route of the gastrodin, and has certain promotion effect on the industrialization of the biosynthesis of the gastrodin.

Drawings

FIG. 1 shows the results of cloning and prokaryotic expression of the ThiH gene, wherein FIG. 1A is an electrophoretogram of E.coli genomic DNA (lane 1: lambda DNA/Hind III marker; lane 2: E.coli BL21 genomic total DNA), FIG. 1B is an electrophoretogram of the PCR product of the ThiH gene (1100 bp), FIG. 1C is an electrophoretogram of the restriction test of pcdfDUET-1-ThiH recombinant plasmid (lane 1;

FIG. 2 is the construction and prokaryotic expression results of recombinant plasmid pCDFDuet-1-ThiH-pchF, wherein FIG. 2A is the synthesis detection electropherogram of pchF gene (lane 1;

FIG. 3 shows the construction and prokaryotic expression of recombinant plasmid pcdfDUET-1-ThiH-pchF-pchC, in which FIG. 3A shows the detection of the synthesis of the pchC gene (lane M: DNA Marker; lane 1: vector containing pchF gene; lane 2: double cleavage of vector with Bgl II and XhoI; pchC gene length: 342 bp), FIG. 3B is a colony PCR assay after joining pchC gene to pcdfDUET-1-ThiH-pchF vector (Lane 1;

fig. 4 is a chromatogram result of synthesizing gastrodin from L-tyrosine by the recombinant strain obtained in example 2, wherein fig. 4A is a chromatogram of a 1mM gastrodin standard, the retention time of the gastrodin standard is 11.3min, fig. 4B is a chromatogram for detecting gastrodin in culture solution D obtained in example 3, and fig. 4C is a chromatogram for detecting gastrodin in culture solution E obtained in a control example;

FIG. 5 is a schematic diagram showing the synthesis of gastrodin from the recombinant strain obtained in example 2 using L-tyrosine.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

In a first aspect, the present invention provides a recombinant strain of recombinant E.coli comprising a tyrosine lyase gene and a 4-hydroxytoluene methyl hydroxylase gene.

The recombinant strain of the present invention can be obtained by a conventional genetic engineering technique, for example, by obtaining a tyrosine lyase gene and a 4-hydroxytoluene methylhydroxylase gene, constructing an expression vector containing a base sequence such as the tyrosine lyase gene and the 4-hydroxytoluene methylhydroxylase gene, and transferring the expression vector into Escherichia coli.

According to the invention, the nucleotide sequence of the tyrosine lyase gene (ThiH gene) is shown as SEQ ID NO:1, and the tyrosine lyase gene (ThiH gene) can be cloned from an Escherichia coli genome by using a primer. Illustratively, the ThiH gene can be PCR-cloned using an upstream primer F (SEQ ID NO: 4) and a downstream primer R (SEQ ID NO: 5) using E.coli genomic DNA as a template, and the amplified fragment obtained by the PCR cloning can be recovered using a Gel Extraction Kit to obtain the (ThiH gene); the conditions for PCR cloning may specifically be: 50 μ L of PCR amplification reaction system, wherein 1 μ L of template, 5 μ L of 10 XPCR Buffer, 1 μ L of 10mM dNTP Mix, 2 μ L of each of 10mM upstream primer F and 10mM downstream primer R, 0.5 μ L of pfu TaqDNA polymerase and 38.5 μ L of sterilized deionized water are adopted, and the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min,35 cycles (94 ℃, 30s,55 ℃, 30s,72 ℃, 1.5 min), extension at 72 ℃ for 10min.

An upstream primer F: CGC (China Global positioning System)GGATCCGATGAAAA CCTTCAGCGATCGCTG, the BamH I cleavage site is underlined (SEQ ID NO: 4);

a downstream primer R: CCCAA GCTTTCATAGTCTTTGCGAGGCGCGTC, the Hind III cleavage site is underlined (SEQ ID NO: 5).

According to the invention, the 4-hydroxytoluene methyl hydroxylase gene comprises a pchF gene and a pchC gene, wherein the nucleotide sequence of the pchF gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the pchC gene is shown as SEQ ID NO. 3. The pchF gene and pchC gene may be artificially synthesized or cloned from Pseudomonas putida (Pseudomonas putida). The pchF gene has two enzyme cutting sites of Nde I and Bgl II in the upstream and downstream, and the pchC gene has two enzyme cutting sites of Bgl II and Xho I in the upstream and downstream, and during synthesizing pchC gene, it is preferable to add T7 promoter sequence in the upstream of its initiation codon.

According to the present invention, the recombinant strain may be any conventional escherichia coli used for constructing genetically engineered bacteria, preferably, the starting strain of the recombinant strain is escherichia coli BL21, and exemplarily, the starting strain of the recombinant strain is BL21 (DE 3), which is commercially available.

According to the invention, the recombinant strain contains an expression vector, and the expression vector is pcdfDUET-1.

In a second aspect, the present invention provides a method of producing a recombinant strain comprising the steps of: and sequentially introducing the tyrosine lyase gene and the 4-hydroxytoluene methyl hydroxylase gene into an escherichia coli starting strain.

According to the invention, the nucleotide sequence of the tyrosine lyase gene is shown as SEQ ID NO 1; the 4-hydroxytoluene methyl hydroxylase gene comprises a pchF gene and a pchC gene, wherein the nucleotide sequence of the pchF gene is shown as SEQ ID NO. 2, and the nucleotide sequence of the pchC gene is shown as SEQ ID NO. 3;

according to the invention, the starting strain of the recombinant strain is Escherichia coli BL21;

Illustratively, the method for preparing a recombinant strain provided by the present invention may comprise the steps of:

(1) Digesting the ThiH gene with corresponding restriction enzyme and connecting to pcdfDUET-1 expression vector to obtain recombinant plasmid pcdfDUET-1-ThiH;

(2) Digesting the pchF gene by corresponding restriction enzyme and then connecting the digested pchF gene to the recombinant plasmid pcdfDUET-1-ThiH obtained in the step (1) to obtain a recombinant plasmid pcdfDUET-1-ThiH-pchF;

(3) And (3) digesting the pchC gene by using a corresponding restriction enzyme, connecting the digested pchC gene to the recombinant plasmid pcdfDUET-1-ThiH-pchF obtained in the step (2) to obtain a recombinant plasmid pcdfDUET-1-ThiH-pchF-pchC, and transforming the recombinant plasmid pcdfDUET-1-ThiH-pchF-pchC into escherichia coli BL21 (DE 3) to obtain a recombinant strain containing pcdfDUET-1-ThiH-pchF-pc.

In a third aspect, the invention provides the recombinant strain and application of the recombinant strain prepared by the method in preparation of gastrodin.

In a fourth aspect, the present invention provides a method for preparing gastrodin, comprising: and (3) performing induction culture on the recombinant strain or the recombinant strain prepared by the method, and then inoculating the recombinant strain into a culture medium containing tyrosine for transformation culture so as to transform the tyrosine into gastrodin.

According to the present invention, the manner of induction culture of the recombinant strain is not particularly limited. Preferably, the inducer for inducing culture contains isopropyl-beta-D-thiogalactoside (IPTG), and further preferably, the content of the inducer in the culture solution is 0.1-1mmol/L. Illustratively, the recombinant strain prepared by the method provided by the invention can be subjected to primary culture in LB liquid culture medium containing streptomycin (Sm), then transferred to LB liquid culture medium, and subjected to secondary amplification culture at the rotation speed of 200-300rpm and the temperature of 35-40 ℃ to obtain OD ₆₀₀ Adding isopropyl-beta-D-thiogalactoside (IPTG) into the culture solution of 0.6-1.0, inducing, performing shake culture at 15-40 deg.C and 200-300rpm for 3-10 hr, and centrifuging to obtain recombinant strain thallus; the recombinant strain thallus is inoculated into a culture medium containing tyrosine for transformation culture.

According to the invention, there is no particular requirement for the tyrosine content of the tyrosine-containing medium. Preferably, the tyrosine content in the tyrosine-containing medium is 0.01-0.05wt%. Illustratively, the tyrosine-containing medium is prepared by adding tyrosine to M9 medium.

According to the invention, in order to better promote the conversion of tyrosine into gastrodin and increase the reaction rate, the conversion culture at least meets the following conditions: the inoculation amount is 10-30g/L, the transformation temperature is 25-40 ℃, the transformation speed is 200-300rpm, and the transformation time is 3-12h. Wherein, the inoculation amount refers to the wet weight of the thallus after induction culture of the inoculated recombinant strain relative to 1L of a culture medium containing tyrosine.

The present invention will be described in detail below by way of examples.

In the following examples, the gastrodin content was measured by High Performance Liquid Chromatography (HPLC) using a ZORBAX SB-C18 column (4.6X 250mm,5 μm); the mobile phase is acetonitrile: ultrapure water =3 (V/V); the flow rate is 1mL/min; the detection wavelength is 220nm;

restriction enzyme, T4 DNA ligase, was purchased from Thermo scientific; DNA standard Marker, pfu Taq enzyme, bacterial genome DNA extraction kit, plasmid extraction kit and protein molecular weight standard are purchased from Tiangen Biochemical technology (Beijing) Co., ltd; SDS-PAGE kits were purchased from Biyuntian; the DNA fragment purification and recovery kit was purchased from QIAGEN; streptomycin, IPTG and primers were purchased from bio-engineering (shanghai) corporation; LB broth and LB agar were purchased from hebo bio; the expression vector pcdfDUET-1 and the Escherichia coli BL21 (DE 3) are stored by a biological engineering laboratory of Hunan Chinese medicine university; the two genes pchF and pchC are synthesized in Wuhan Jin Kairui bioengineering GmbH; other chemicals were commercially available chromatographically pure grades.

In the following examples, the formulation of the medium is as follows, unless otherwise specified:

LB culture medium: 10g/L of tryptone and 5g/L, naCl g/L of yeast extract;

the preparation process of the M9 culture medium comprises the following steps:

(1) Preparation of 5 XM 9 salt solution

Adding 100mL of tyrosine solution for dissolving, filling the solution in a wide-mouth bottle, and sterilizing the solution by high-pressure steam;

(2) Preparing M9 culture medium

Adding tyrosine solution to make volume to 200mL, filtering and sterilizing at 0.22 μm.

Example 1

Construction of the tyrosine lyase Gene (ThiH Gene): extracting Escherichia coli genome DNA from Escherichia coli BL21 (DE 3), performing PCR cloning on the ThiH gene by using the Escherichia coli genome DNA as a template and an upstream primer F (SEQ ID NO: 4) and a downstream primer R (SEQ ID NO: 5), and recovering an amplified fragment obtained by the PCR cloning by using a Gel Extraction Kit to obtain the ThiH gene; wherein, the PCR cloning conditions are as follows: 50 μ L of PCR amplification reaction system, wherein 1 μ L of template, 5 μ L of 10 XPCR Buffer, 1 μ L of 10mM dNTP Mix, 2 μ L of each of 10mM upstream primer F and 10mM downstream primer R, 0.5 μ L of pfu TaqDNA polymerase and 38.5 μ L of sterilized deionized water are adopted, and the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min,35 cycles (94 ℃, 30s,55 ℃, 30s,72 ℃, 1.5 min), extension at 72 ℃ for 10min;

an upstream primer F: CGCGGATCCGATGAAAA CCTTCAGCGATCGCTG, the BamH I cleavage site is underlined (SEQ ID NO: 4);

Construction of the pchF gene and pchC gene: the sequences of the pchF gene and the pchC gene are subjected to codon optimization to obtain the pchF gene coded by SEQ ID NO. 2 and the pchC gene coded by SEQ ID NO. 3, wherein the upstream and the downstream of the pchF gene are respectively provided with two enzyme cutting sites of Nde I and Bgl II, the upstream and the downstream of the pchC gene are respectively provided with two enzyme cutting sites of Bgl II and Xho I, and a T7 promoter sequence is added to the upstream of an initiation codon of the pchC gene during optimization.

Example 2

(1-1) digesting the ThiH gene obtained in the example 1 by using corresponding restriction enzymes, and then connecting the digested ThiH gene to a pcdfDUET-1 expression vector to obtain a recombinant plasmid pcdfDUET-1-ThiH;

(1-2) the pchF gene obtained in example 1 was digested with the corresponding restriction enzymes and ligated to the recombinant plasmid pcdfDUET-1-ThiH obtained in step (1-1) to obtain recombinant plasmid pcdfDUET-1-ThiH-pchF;

(1-3) the pchC gene obtained in example 1 was digested with a corresponding restriction enzyme and ligated to the recombinant plasmid pcdfDUET-1-ThiH-pchF obtained in step (1-2) to obtain a recombinant plasmid pcdDUET-1-ThiH-pchF-pchC, which was transformed into E.coli BL21 (DE 3) to obtain a recombinant strain containing pcdfDUET-1-ThiH-pchF-pchC.

Example 3

(2-1) inoculating the recombinant strain prepared in example 2 into 5mL of LB liquid medium containing 100. Mu.g/mL streptomycin (Sm), shake-culturing at 37 ℃ and 225rpm for 16 hours to obtain a culture solution A, adding 1mL of the culture solution A into 50mL of LB liquid medium, shake-culturing at 37 ℃ and 225rpm to OD 0.75 to obtain a culture solution B, adding IPTG solution with a concentration of 100mmol/L into the culture solution B to make the final concentration 0.5mmol/L, and shake-culturing at 40 ℃ and 225rpm for 5 hours to obtain a culture solution C;

(2-2) centrifuging the culture solution C obtained in the step (2-1) for 10min at 5000rpm, pouring off the supernatant, sucking the residual solution on the precipitate with sterile filter paper to obtain recombinant strain thallus, inoculating the recombinant strain thallus into 50mL of M9 culture medium containing L-tyrosine (the content of L-tyrosine is 0.02 wt%) with an inoculation amount of 20g/L, suspending, and culturing at the temperature of 40 ℃ and the rotation speed of 225rpm for 10h to obtain a culture solution D.

Example 4

(2-1) inoculating the recombinant strain prepared in example 2 into 5mL of LB liquid medium containing 100. Mu.g/mL streptomycin (Sm), shake-culturing at 37 ℃ and 225rpm for 16 hours to obtain a culture solution A, adding 1mL of the culture solution A into 50mL of LB liquid medium, shake-culturing at 37 ℃ and 225rpm to OD 0.75 to obtain a culture solution B, adding IPTG solution with a concentration of 100mmol/L into the culture solution B to make the final concentration 0.5mmol/L, and shake-culturing at 25 ℃ and 225rpm for 5 hours to obtain a culture solution C;

Example 5

(2-1) inoculating the recombinant strain prepared in example 2 into 5mL of LB liquid medium containing 100. Mu.g/mL streptomycin (Sm), shake-culturing at 37 ℃ and 225rpm for 16 hours to obtain a culture solution A, adding 1mL of the culture solution A into 50mL of LB liquid medium, shake-culturing at 37 ℃ and 225rpm to OD 0.75 to obtain a culture solution B, adding IPTG solution with a concentration of 100mmol/L into the culture solution B to make the final concentration 0.5mmol/L, and shake-culturing at 15 ℃ and 225rpm for 5 hours to obtain a culture solution C;

Example 6

(2-1) inoculating the recombinant strain prepared in example 2 into 5mL of LB liquid medium containing 100. Mu.g/mL streptomycin (Sm), shake-culturing at 37 ℃ and 225rpm for 16 hours to obtain a culture solution A, adding 1mL of the culture solution A into 50mL of LB liquid medium, shake-culturing at 37 ℃ and 225rpm to OD 0.75 to obtain a culture solution B, adding IPTG solution with a concentration of 100mmol/L into the culture solution B to make the final concentration 0.1mmol/L, and shake-culturing at 15 ℃ and 225rpm for 5 hours to obtain a culture solution C;

Example 7

(2-1) inoculating the recombinant strain prepared in example 2 into 5mL of LB liquid medium containing 100. Mu.g/mL streptomycin (Sm), shake-culturing at 37 ℃ and 225rpm for 16 hours to obtain a culture solution A, adding 1mL of the culture solution A into 50mL of LB liquid medium, shake-culturing at 37 ℃ and 225rpm to OD 0.75 to obtain a culture solution B, adding IPTG solution with a concentration of 100mmol/L into the culture solution B to obtain a final concentration of 1.0mmol/L, and shake-culturing at 15 ℃ and 225rpm for 5 hours to obtain a culture solution C;

Example 8

(2-2) centrifuging the culture solution C obtained in the step (2-1) for 10min at 5000rpm, pouring off the supernatant, sucking the residual solution on the precipitate with sterile filter paper to obtain recombinant strain thallus, inoculating the recombinant strain thallus into 50mL of M9 culture medium containing L-tyrosine (the content of L-tyrosine is 0.02 wt%) with the inoculation amount of 20g/L, suspending, and culturing at the temperature of 30 ℃ and the rotation speed of 225rpm for 10h to obtain a culture solution D.

Example 9

(2-2) centrifuging the culture solution C obtained in the step (2-1) for 10min at 5000rpm, pouring off the supernatant, sucking the residual solution on the precipitate with sterile filter paper to obtain recombinant strain thallus, inoculating the recombinant strain thallus into 50mL of M9 culture medium containing L-tyrosine (the content of L-tyrosine is 0.02 wt%) with an inoculation amount of 20g/L, suspending, and culturing at 25 ℃ and 225rpm for 10h to obtain a culture solution D.

Test example 1

The recombinant plasmid pcdfDUET-1-ThiH obtained in the step (1-1) of the example 2 and the recombinant plasmid pcdfDUET-1-ThiH-pchF obtained in the step (1-2) are respectively transformed into Escherichia coli BL21 (DE 3) to obtain a strain A containing pcdfDUET-1-ThiH and a strain B containing pcdfDUET-1-ThiH-pchF;

respectively inoculating the strain A, the strain B and the recombinant strain C obtained in the step (1-3) into LB liquid culture medium containing 100 mu g/mL streptomycin (Sm) to carry out shake cultivation for 16h under the conditions that the temperature is 37 ℃ and the rotating speed is 225rpm, thus obtaining a bacterial liquid A-1,B-1,CMixing the bacterial liquid A-1,B-1,C-1 and the LB liquid culture medium according to the volume ratio of 1 to 50, and performing shake culture at 37 ℃ and 225rpm until OD ₆₀₀ Obtaining bacterial liquid A-2,B-2,C-2 for 0.6, adding an inducer IPTG into the bacterial liquid A-2,B-2,C-2 to enable the final concentration to reach 0.5mmol/L, then carrying out induced expression for 5h, sampling bacterial liquid A-2 every 1h in the induction process, and identifying the expression condition of the ThiH gene in the expression bacteria (shown in figure 1D) and the expression condition of the ThiH gene and the pchF gene in the bacterial strain B (shown in figure 2C) and the expression condition of the ThiH gene, the pchF gene and the pchC gene in the recombinant bacterial strain C (shown in figure 3C) through SDS-PAGE electrophoresis.

In example 1, SDS-PAGE of genomic DNA extracted from E.coli BL21 (DE 3) is shown in FIG. 1A, and SDS-PAGE of the DNA from which a ThiH gene of 1100bp in length was cloned by designing a specific primer using the DNA as a template is shown in FIG. 1B; in example 2, the cloned ThiH gene was ligated to an expression vector pcdfDUET-1, and whether recombinant plasmid construction was successful was identified by double digestion with BamH I and Hind III, and SDS-PAGE is shown in FIG. 1C.

In example 1, the SDS-PAGE of pchF gene encoded by SEQ ID NO. 2 is shown in FIG. 2A, and the SDS-PAGE of recombinant plasmid pCDFDuet-1-ThiH-pchF constructed by cleaving it from cloning plasmid with Nde I and Bgl II and ligating it with plasmid pCDFDuet-1-ThiH is shown in FIG. 2B;

in example 1, the pchC gene encoded by SEQ ID NO:3 was electrophoresed on SDS-PAGE as shown in FIG. 3A, excised from the cloning plasmid using Bgl II and Xho I, and then ligated with plasmid pCDF Duet-1-ThiH-pchF to construct recombinant plasmid pCDFduet-1-ThiH-pchF-pchC, which was electrophoresed on SDS-PAGE as shown in FIG. 3B.

Test example 2

Adding sterile water with the same volume as that of IPTG solution into the culture solution B obtained in the example 3, performing shake culture for 5 hours under the conditions of the temperature of 15 ℃ and the rotation speed of 225rpm as a comparison example, centrifuging for 10 minutes under the condition of 5000rpm, pouring out supernatant, sucking residual liquid on precipitates by using sterile filter paper to obtain recombinant strain thallus, suspending the recombinant strain thallus with the wet weight of 1g by using 50mL of M9 culture medium containing L-tyrosine (the content of the L-tyrosine is 0.02 wt%), and then culturing for 10 hours under the conditions of the temperature of 37 ℃ and the rotation speed of 225rpm to obtain a culture solution E;

5mL of the culture solution D obtained in example 3 to example 9 was taken as a sample, 5mL of the culture solution E was taken as a control sample, the sample was centrifuged at 5000rpm for 15min, the bacterial pellet was collected, 5mL of methanol was used to suspend the bacterial pellet, the bacterial pellet was shaken on a vortex shaker for 30min, and then centrifuged at 5000rpm for 15min to discard the pellet and take the supernatant, the supernatant was freeze-dried to obtain a freeze-dried product, the freeze-dried product was redissolved with 1mL of methanol and filtered through a 0.45 μm filter head, and then 20 μ L of the sample was taken for HPLC analysis. A chromatogram for detecting tianaglucone in the culture solution D obtained in example 3 is shown in FIG. 4, and the content of tianaglucone and the conversion rate of L-tyrosine in the culture solutions D obtained in examples 3 to 9 are shown in Table 1.

TABLE 1

Numbering	The content (mg/L) of tianmaogenin in the culture solution D	Conversion of L-tyrosine
			Example 3	50mg/L	25％
Example 4	58mg/L	29％
			Example 5	63mg/L	31.5％
Example 6	53mg/L	26.5％
			Example 7	69mg/L	34.5％
Example 8	60mg/L	30％
			Example 9	56mg/L	28％

The culture solution E of the comparative example did not produce gastrodin, which also indicates that the recombinant strain obtained in example 2 can synthesize gastrodin by tyrosine through the reaction route shown in fig. 5 after induction with IPTG.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

SEQUENCE LISTING

<110> Hunan university of traditional Chinese medicine

<120> recombinant strain and method for preparing gastrodin

<130> 2020.12.9

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 1134

<212> DNA

<213> Artificial sequence

<400> 1

atgaaaacct tcagcgatcg ctggcgacaa ctggactggg atgacatccg cctgcgtatc 60

aacggcaaaa cggctgttga cgtagagcgg gcgctaaatg cctcgcaatt cacccgcgac 120

gatatgatgg cgctgttatc gccagccgcc agtggctatc tggaacaact ggcccaacgg 180

gcgcagcgtc tgacccgtca gcgatttggc aacacagtta gtttctacgt cccgctttat 240

ctttccaatc tttgcgctaa cgactgcacg tactgcggat tttccatgag taatcgcatc 300

aagcgcaaaa cgctggatga agcggatatt gccagggaaa gcgccgctat acgggagatg 360

ggctttgaac atctgctatt agtcactggt gaacatcagg cgaaagtggg gatggattac 420

tttcgtcgtc atctccccgc cctgcgtgaa cagttctctt cactacaaat ggaagtgcaa 480

ccgctggcgg agacggaata cgccgagtta aagcagcttg gtctggatgg cgtgatggtt 540

tatcaggaga catatcacga ggcgacttat gcccgccatc atctgaaagg caaaaaacag 600

gacttcttct ggcggctgga aacgccggat cggctggggc gtgcggggat tgataagata 660

ggcctcggcg cgctaattgg cctttccgac aactggcgcg ttgactgcta tatggttgcc 720

gaacatttgc tatggctgca acagcattac tggcaaagcc gttactctgt ctcctttccg 780

cgcctgcgcc cgtgtactgg cggcattgag cctgcgtcga ttatggatga acgccagtta 840

gtgcaaacca tctgcgcctt ccgactgctt gcaccggaga ttgaactgtc actctccacg 900

cgggaatcac cgtggtttcg cgatcgcgtt attccgctgg cgatcaataa cgtcagcgcc 960

ttctcgaaaa cgcagccagg tggctatgcc gataatcacc ccgagttgga acagttctca 1020

ccgcacgacg atcgcagacc ggaagcggtt gctgccgcgt taaccgctca gggtttgcag 1080

ccggtatgga aagactggga cagctatctg ggacggccct cgcaaagact atga 1134

<210> 2

<211> 1566

<212> DNA

<213> Artificial sequence

<400> 2

atgtccgagc aaaacaatgc tgtgttgccc aaaggggtaa cgcagggcga gttcaacaag 60

gcggtgcaga aattccgcgc cttgctgggt gacgataatg tattggtcga atccgaccag 120

ttggtgcctt acaacaagat catgatgccg gtcgagaatg cggctcatgc cccctcggcc 180

gccgtcaccg cgaccaccgt cgagcaggtg cagggtgtag tcaagatctg taacgaacac 240

aaaattccga tctggaccat ctccactggg cgcaacttcg gttacggctc cgccgccccg 300

gtgcagcgcg gtcaggtaat ccttgacctg aagaagatga acaagatcat caagatcgac 360

ccggaaatgt gctacgcgct ggtcgagccg ggggttacct tcggtcagat gtatgactac 420

atccaggaaa acaacctgcc ggtgatgctg tcgttctcgg cgccctcggc gattgccggc 480

ccggtcggca ataccatgga ccgaggcgtg ggctacaccc cctacggcga acacttcatg 540

atgcagtgcg gcatggaagt ggtgctggcc aacggtgacg tttaccgcac cggcatgggt 600

ggcgtgcctg gcagcaacac ctggcagatt ttcaaatggg gctatggtcc gaccctggat 660

ggcatgttca ctcaggccaa ctatggcatc tgcaccaaga tgggcttctg gctgatgccc 720

aagccacccg tgttcaagcc gttcgaagtg atcttcgagg acgaggcgga catcgtcgag 780

atcgtcgatg cgctgcgccc gctgcgcatg agcaacacca tccccaactc ggtggtaatc 840

gccagcacct tgtgggaagc cggcagtgcg cacctgaccc gcgcccagta caccaccgag 900

ccgggccaca cgccggatag cgtgatcaag cagatgcaga aagacaccgg catgggtgcc 960

tggaacctct acgctgcgct gtacggtacc caggaacagg tcgacgtaaa ctggaagatc 1020

gtcactgacg tcttcaagaa actcggcaag ggccgtatcg tcacccagga agaggcgggt 1080

gacacccagc cgttcaaata ccgtgcccag ctgatgtccg gcgtgcccaa cctgcaggaa 1140

ttcggcctgt acaactggcg tgggggcggt ggctccatgt ggttcgcgcc ggtcagcgag 1200

gcgcgtggca gcgagtgcaa gaagcaggcg gccatggcca agcgcgttct gcacaagtac 1260

ggcctggatt atgtggccga gttcatcgtg gcgccgcgcg acatgcacca cgtcatcgac 1320

gtgctctacg accgcaccaa tcctgaggaa accaagcgcg ccgacgcctg cttcaatgag 1380

ctgctggatg agttcgagaa ggaaggctat gcggtgtatc gggtgaacac ccgcttccag 1440

gatcgcgtgg cgcagagcta tggcccggtc aagcgcaagc tggagcatgc catcaagcgt 1500

gcggtggacc cgaacaacat cctcgctccg ggccgctcgg gcatcgacct caataacgat 1560

ttctga 1566

<210> 3

<211> 342

<212> DNA

<213> Artificial sequence

<400> 3

atgacatttc cctttagcgg cgcagctgtg aaacggatgc tcgtgactgg agttgtgctt 60

ccctttggtc tgctggtcgc agcgggacag gcgcaggccg acagccagtg gggcagtggc 120

aagaacctgt atgacaaggt ttgtggccat tgccacaagc ccgaagtcgg ggtagggccg 180

gttcttgagg gtcgcggcct gccggaagcc tacatcaagg acattgtgcg caacggcttc 240

cgtgccatgc cggcattccc ggcgtcttat gttgatgacg aatcccttac tcaggtggct 300

gaatacctgt cgagcctgcc ggccccagcg gctcagcctt ga 342

<210> 4

<211> 33

<212> DNA

<213> Artificial sequence

<400> 4

cgcggatccg atgaaaacct tcagcgatcg ctg 33

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<400> 5

cccaagcttt catagtcttt gcgaggcgcg tc 32

Claims

1. A method for preparing gastrodin, which is characterized by comprising the following steps: sequentially introducing a tyrosine lyase gene and a 4-hydroxytoluene methyl hydroxylase gene into an escherichia coli starting strain to obtain a recombinant strain, performing induction culture on the recombinant strain, and inoculating the recombinant strain into a culture medium containing tyrosine for transformation culture so as to transform the tyrosine into gastrodin;

wherein, the nucleotide sequence of the tyrosine lyase gene is shown in SEQ ID NO. 1, the 4-hydroxytoluene methyl hydroxylase gene contains pchF gene and pchC gene, the nucleotide sequence of the pchF gene is shown in SEQ ID NO. 2, and the nucleotide sequence of the pchC gene is shown in SEQ ID NO. 3; the content of tyrosine in the culture medium containing tyrosine is 0.01-0.05wt%, and the transformation culture at least meets the following conditions: the inoculation amount is 10-30g/L, the transformation temperature is 25-40 ℃, the transformation speed is 200-300rpm, and the transformation time is 3-12h.

2. The method according to claim 1, wherein the starting strain of the recombinant strain is Escherichia coli BL21 (DE 3).

3. The method according to claim 1 or 2, wherein the recombinant strain contains an expression vector which is pcdfDUET-1.

4. The method of claim 1, wherein the inducer for inducing culture comprises isopropyl- β -D-thiogalactoside.