CN112063610B

CN112063610B - Tyrosine phenol lyase mutant, engineering bacterium and application

Info

Publication number: CN112063610B
Application number: CN202011007207.3A
Authority: CN
Inventors: 郑仁朝; 王江平; 汤晓玲; 索慧; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2020-09-23
Filing date: 2020-09-23
Publication date: 2022-02-11
Anticipated expiration: 2040-09-23
Also published as: CN112063610A; CN114250237B; CN114250237A

Abstract

The invention discloses a mutant of a tyrosine phenol lyase and application thereof, wherein the mutant is prepared by carrying out the following steps of: 2, the amino acid sequence is obtained by carrying out error-prone PCR single mutation at the 402 th site or the 409 th site; compared with the wild type, the mutant of the tyrosine phenol lyase provided by the invention has better catalytic performance. The accumulation concentration of the synthesized levodopa by the TPL mutant is up to above 146g/L, which is increased by 25-45% compared with the wild type, and the optical purity is more than 99.5%; the conversion rate of the substrate catechol reaches over 99.8 percent, and is improved by 15 to 20 percent compared with the wild type.

Description

Tyrosine phenol lyase mutant, engineering bacterium and application

(I) technical field

The invention relates to a tyrosine phenol lyase mutant, engineering bacteria and application.

(II) background of the invention

With the global aging, the increasing number of senile diseases is an unavoidable reality, and the parkinson disease is an senile disease which gradually draws close attention of the public in recent years, and is a common chronic disease of the central nervous system.

Dopamine is a main substance for treating the Parkinson's disease, but the dopamine can not reach the central nervous system through a blood brain barrier to play a role, and levodopa (beta-3, 4-dihydroxyphenyl-alpha-alanine, 3,4-dihydroxyphenyl-L-alanine and L-DOPA) can reach the central nervous system through a plurality of blood brain barriers, is converted into dopamine under the action of decarboxylase and further plays a role in treating the Parkinson's disease, so the levodopa is used as a first choice medicine for treating the Parkinson's disease. As the number of parkinson patients increases, the demand for levodopa also increases.

Tyrosine Phenol Lyase (TPL) has become a main biocatalytic method for synthesizing levodopa due to the advantages of mild reaction conditions, high process efficiency, high stereoselectivity and the like. TPL is widely present in various microorganisms such as pseudomonas, fungi, streptomyces, etc., and TPL sources reported for levodopa include nucleic acid bacillus (Fusobacterium nucleatum), Erwinia herbicola (Erwinia herbicoloa), Citrobacter freundii (Citrobacter freundii), and thermophilic bacteria (symbolobacter sp.), etc.

It has been reported that a tyrosol lyase (Fn-TPL) derived from a nucleic acid-producing bacterium produces the highest amount of levodopa synthesized by a C-C bond formation reaction using catechol, sodium pyruvate and ammonia as substrates. However, because the catechol serving as a substrate is not a natural substrate of the enzyme, the catalytic efficiency of the enzyme needs to be improved, and on the other hand, the catechol with high concentration can generate toxic action on the enzyme and cells, even lead the enzyme to be irreversibly inactivated, and finally inhibit the synthesis of the levodopa.

Directed evolution (Directed evolution) is a new technology developed in recent years, and is the extension and application of the theory of darwinia evolution on the molecular level of nucleic acid, peptide or protein. It does not need to understand the structure function relationship of protein deeply, simulates the natural evolution process of biological macromolecule artificially under the condition of laboratory, carries out random mutagenesis to gene in vitro, makes gene generate a large amount of variation, and selects mutant with required property in an oriented way, thus realizing the evolution process which can be completed in millions of years in nature in a short time.

Error-prone PCR (error prone PCR) is a simple and rapid method for randomly making mutations in DNA sequences, and introduces multiple point mutations by changing the concentrations of certain components in the conventional PCR reaction system to make bases randomly mismatched to some extent. The core idea is to randomly change the gene sequence of the encoded protein to obtain a library, and then obtain the forward-evolving target gene from the library through a large number of screens. In general, suitable mutation frequency is each sequence of 2 ~ 3 base or 1 amino acid residue mutation. The invention introduces error-prone PCR mutation and obtains the levodopa high-yield strain by using a high-throughput screening method.

Disclosure of the invention

The invention aims to modify tyrosine phenol lyase derived from nucleic acid bacillus by means of directed evolution, and provides a tyrosine phenol lyase mutant, engineering bacteria and application thereof, wherein pyrocatechol, sodium pyruvate and ammonia are used as substrates, levodopa is efficiently synthesized by catalysis, the enzyme activity is improved by 1.9-3.2 times, the final yield of the levodopa reaches 146g/L to the maximum, and the conversion rate of the pyrocatechol reaches 99.8%.

The technical scheme adopted by the invention is as follows:

the invention provides a mutant of a tyrosine phenol lyase, which is prepared by carrying out the following steps of: 2 at position 402 or 409 of the amino acid sequence shown in the sequence table 2.

Further, preferably, the mutant is a mutant represented by SEQ ID NO: 2 (K402T, 4 amino acid sequence and 3 nucleotide sequence) or 409 threonine to alanine (T409A, 6 amino acid sequence and 5 nucleotide sequence). Any amino acid sequence shown in SEQ ID NO.4 and SEQ ID NO.6 with one or more amino acids deleted, inserted or substituted and having TPL activity still belongs to the protection scope of the present invention.

The SEQ ID NO: 2 is derived from fusobacterium nucleatum (F.nucleolus subsp.CGMCC 1.2526), and the coding gene sequence is SEQ ID NO: 1 is shown. The gene (Fn-TPL) for coding TPL is successfully cloned by taking a genome extracted from the bacillus nuclease CGMCC1.2526 as a template, and the gene is expressed after being transformed into Escherichia coli; and extracting Fn-TPL plasmid from the escherichia coli, randomly mutating TPL gene by using an error-prone PCR method, connecting the TPL gene to an expression vector, expressing the TPL gene in the escherichia coli, and obtaining the mutant with improved activity by a high-throughput screening method. The invention mutates TPL coded by SEQ ID NO.1, and can adopt a conventional molecular modification means. Preferentially, Mn in the PCR system is changed by error-prone PCR amplification²⁺Concentration to obtain mutant DNA sequences SEQ ID NO.3 and SEQ ID NO.5, the amino acid sequences thereofThe sequences are SEQ ID NO.4 and SEQ ID NO. 6.

Furthermore, the invention also relates to a coding gene of the mutant of the tyrosine phenol lyase, a recombinant vector (preferably a plasmid pET-28b (+)) constructed by the coding gene and a genetic engineering bacterium obtained by transforming the recombinant vector, wherein the genetic engineering bacterium is constructed by taking Escherichia coli E.coli BL21(DE3) as a host. The present invention can be constructed by ligating the nucleotide sequence of the TPL mutant of the present invention to various vectors by a method conventional in the art. The recombinant vector of the present invention is not limited as long as it can maintain its replication or autonomous replication in various host cells of prokaryotic and/or eukaryotic cells, and it may be various vectors conventional in the art, such as various plasmids, phage or viral vectors, etc., preferably pET-28b (+). Preferably, the recombinant expression vector of the present invention can be obtained by: the obtained wild-type TPL and mutant gene products are connected with a vector pET-28b (+), and TPL mutant gene recombinant expression plasmids pET-28b (+) -Fn-TPL, pET-28b (+) -Fn-TPL-K402T and pET-28b (+) -Fn-TPL-T409A are constructed. The host cell into which the DNA encoding the TPL mutant of the present invention is introduced is not limited as long as a recombinant expression system has been established therefor so that the recombinant expression vector can stably self-replicate and the carried TPL mutant gene of the present invention can be efficiently expressed. Such as Escherichia coli, Bacillus subtilis, yeast, actinomycetes, Aspergillus, and animal cells and higher plant cells. Coli BL21(DE3) is preferred in the present invention. The recombinant plasmids pET-28b (+) -Fn-TPL, pET-28b (+) -Fn-TPL-K402T and pET-28b (+) -Fn-TPL-T409A are transformed into E.coli BL21(DE3), and the engineering bacteria E.coli BL21(DE3)/pET-28b (+) -Fn-TPL, E.coli BL21(DE3)/pET28b (+) -Fn-TPL-K402T and E.coli BL21(DE3)/pET28b (+) -Fn-TPL-T409A are obtained.

The preparation of the TPL mutant comprises culturing the recombinant expression transformant and obtaining the TPL mutant protein by induction. Among them, the medium used for culturing the recombinant expression transformant may be a medium which allows the transformant to grow and produce the TPL of the present invention in the art, and preferably LB medium: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, distilled water as a solvent and pH 7.2. Culture methodAnd culture conditions are not particularly limited as long as the transformant can grow and produce TPL. The following methods are preferred: the recombinant E.coli BL21(DE3)/pET28b (+) -Fn-TPL-K402T or E.coli BL21(DE3)/pET28b (+) -Fn-TPL-T409A related to the invention is inoculated into LB culture medium containing 50 ug/ml kanamycin and cultured at 37 ℃ to optical density OD₆₀₀When the concentration reaches 0.5-0.7, the TPL mutant protein can be efficiently expressed under the induction of isopropyl-beta-D-thiogalactopyranoside (IPTG) with the final concentration of 0.1-1.0 mM.

Further, the invention also relates to an application of the mutant of the tyrosol lyase in the synthesis of levodopa, and the application method comprises the following steps: the wet thallus obtained by fermentation culture of engineering bacteria containing tyrosine phenol lyase mutant coding gene is used as catalyst, catechol, sodium pyruvate and ammonium acetate are used as substrate, sodium sulfite and EDTA & Na are used as substrate₂And (3) as an auxiliary agent, forming a conversion system by using Pyridoxal phosphate (PLP) as a coenzyme and a buffer solution with pH of 6.0-10.5 (preferably pH of 8.5) as a reaction medium, carrying out conversion reaction at the temperature of 5-30 ℃ (preferably 15 ℃) and the rotation speed of 100-200 rpm (preferably 150rpm), and after the reaction is finished, separating and purifying the reaction solution to obtain the levodopa.

Further, in the conversion system, catechol is added to the conversion system to achieve a final concentration of 5-50 g/L (preferably 5g/L), sodium pyruvate is added to the conversion system to achieve a final concentration of 5-50 g/L (preferably 7g/L), ammonium acetate is added to the conversion system to achieve a final concentration of 0.1-1.4M (preferably 0.4M), sodium sulfite is added to the conversion system to achieve a final concentration of 0.5-10 g/L (preferably 1g/L), EDTA & Na₂The final concentration is 0.5-10 g/L (preferably 2g/L), the final concentration is 0.05-5 mM (preferably 1mM), and the wet bacterial cell dosage is 2-50 g/L (preferably 20 g/L).

Furthermore, in the conversion reaction process, pyrocatechol, sodium pyruvate and ammonium acetate are fed once every 0.5-4 h, wherein the pyrocatechol is fed by 0.1-10 g/L (preferably 5g/L) each time, the sodium pyruvate is fed by 0.1-10 g/L (preferably 5g/L) each time, and the ammonium acetate is fed by 1-20 g/L (preferably 3.5g/L) each time.

The TPL mutant provided by the invention can catalyze and synthesize levodopa in the forms of free enzyme, immobilized enzyme and recombinant free cells.

Further, the catalyst is prepared by the following method:

(1) slant culture: inoculating engineering bacteria containing coding genes of the tyrosol lyase mutant to a slant culture medium containing 50 mu g/ml kanamycin, and culturing at 37 ℃ for 8-16 h to obtain slant thalli; the final concentration of the slant culture medium is as follows: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride, 2% agar and distilled water as a solvent, wherein the pH value is 7.0;

(2) seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride, 50 mu g/ml of kanamycin and distilled water as a solvent, wherein the pH value is 7.0;

(3) fermentation culture: inoculating the seed solution into a sterile 5L mechanical stirring ventilation universal fermentation tank filled with 3L fermentation medium in an inoculation amount with the volume concentration of 2%, directly adding sterilized lactose into the fermentation tank in an amount with the final concentration of 15g/L, performing induction culture at 28 ℃ for 6-8 h, and then putting the fermentation tank to collect wet thalli; the final concentration of the fermentation medium is as follows: 25g/L of peptone, 6.55g/L of yeast powder, 10g/L of NaCl, 9.1g/L of sucrose, 0.05mM of pyridoxal phosphate (PLP), MgSO₄ 5mM，KH₂PO₄10mM, the solvent is distilled water, and the pH is natural.

Compared with the prior art, the invention has the following beneficial effects: compared with the wild type, the mutant of the tyrosine phenol lyase provided by the invention has better catalytic performance. The accumulation concentration of the synthesized levodopa by the TPL mutant is up to above 146g/L, which is increased by 25-45% compared with the wild type, and the optical purity is more than 99.5%; the conversion rate of the substrate catechol reaches over 99.8 percent, and is improved by 15 to 20 percent compared with the wild type.

(IV) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1 obtaining of TPL Gene

The whole genome DNA of Fusobacterium nucleatum (F.nuclear subsp.CGMCC 1.2526, available from China center for Industrial culture Collection of microorganisms) was extracted using a DNA extraction kit (available from Thermo Fisher Scientific Co., Ltd.), and PCR amplification reaction was carried out using the DNA as a template and the upstream primer (5 'TGTTAGCAGCCGGATCTCAGT 3') and the downstream primer (5 'GGAGATATACCATGCGCTTTGA 3') as primers. The adding amount of each component of the PCR reaction system (the total volume is 50 mu L): 5 XPrimeSTARTM HS DNA polymerase Buffer 10. mu.L, 10mM dNTP mix (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4. mu.L, 50. mu.M concentration of upstream primer, downstream primer each 1. mu.L, genomic DNA 1. mu.L, PrimeSTARTM HS DNA polymerase 0.5. mu.L, no nucleic acid 32.5. mu.L. The PCR reaction conditions are as follows: pre-denaturation at 95 deg.C for 5min, temperature cycling at 95 deg.C for 1min, 55 deg.C for 1min, and 72 deg.C for 90s for 30 cycles, final extension at 72 deg.C for 10min, and final termination at 4 deg.C. The sequencing analysis result shows that the gene (Fn-TPL) for coding TPL is obtained by the amplification of the process, the length of the nucleotide sequence is 1383bp (the nucleotide sequence is shown as SEQ ID NO: 1), the sequence codes a complete open reading frame, and the coded amino acid sequence is shown as SEQ ID NO: 2, respectively.

Example 2 construction of a TPL mutation library by error-prone PCR

The mutant sequence was obtained by error-prone PCR amplification using the TPL gene obtained in example 1 as a template. The amplification primers are as follows:

(5 'TGTTAGCAGCCGGATCTCAGT 3') and (5 'GGAGATATACCATGCGCTTTGA 3').

The amplification system is as follows: 50 μ l reaction:

10×Taq polymerase buffer：5μL；Mg²⁺(25mM)：2-16μL；Mn²⁺2-20 μ L (5 mM); 10mM dNTP mix (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4. mu.l; 1. mu.L each of the forward primer and the reverse primer at a concentration of 50. mu.M, DNA template: 1 mu L of the solution; taq DNA polymerase: 0.5 mu L; the system is complemented with double distilled water.

The PCR reaction conditions are as follows: pre-denaturation at 95 deg.C for 5min, temperature cycling at 95 deg.C for 1min, 55 deg.C for 1min, and 72 deg.C for 90s for 30 cycles, final extension at 72 deg.C for 10min, and final termination at 4 deg.C. The PCR product was analyzed by 1% agarose gel electrophoresis and recovered by cutting gel, digested by BamHI/XhoI, ligated with pET28b (+) which had been digested in the same manner, transformed into E.coli BL21(DE3) competent cells, plated on LB plate containing kanamycin (50. mu.g/ml), incubated overnight at 37 ℃, and the supernatant was used for screening of TPL mutation library.

Example 3 screening of TPL mutant libraries

The TPL mutation library constructed in example 2 is screened by salicylaldehyde spectrophotometry, and the color development principle is as follows: under the alkaline condition, sodium pyruvate and salicylaldehyde can generate a Claisen-Schmidt (Claisen-Schmidt) reaction to generate a yellow compound, the color shade of the yellow compound is in direct proportion to the content of the sodium pyruvate, and then a spectrophotometer is used for measuring the light absorption value of reaction liquid under a specific wavelength.

The color reaction comprises the following specific reaction steps: adding 100 mu L of 250g/L NaOH aqueous solution, 40 mu L of supernatant, 560 mu L of ultrapure water and 20 mu L of salicylaldehyde color developing solution into a 1mL standard reaction system in sequence, fully shaking the mixture, adding 200 mu L of 250g/L NaOH aqueous solution and 80 mu L of ultrapure water, standing the mixture at room temperature for 2 hours, taking 200 mu L of color developing reaction solution to a 96-hole standard plate, measuring a light absorption value at a wavelength of 465nm by using an enzyme-linked immunosorbent assay, and comparing the change of the mutant enzyme activity according to the change of the light absorption value. Positive clones with improved activities shown in Table 1 were obtained by primary screening from 4000 mutants by color reaction using the enzyme before mutation as a reference, and further determined by liquid chromatography. The detection conditions were as follows: the liquid chromatograph is EClasiocal 3100, and the chromatographic column is: c18 column (Welch,5 μm. times.250X 4.6 mm); column temperature: 34 ℃; flow rate: 1 mL/min; sample introduction amount: 10 mu L of the solution; detection wavelength: UV 280 nm; mobile phase: 20mM KH₂PO₄(pH adjusted to 2.6 with HCl): methanol 9: 1. Under the chromatographic conditions, the peak-off time of L-DOPA and catechol were 4.073min and 17.00min, respectively.

Through liquid chromatography detection, mutants 67-3-D9 and 35-1-C1 with the highest activity shown in Table 1 are obtained, and sequencing shows that the amino acid sequence of the mutant 67-3-D9(K402T) is shown as SEQ ID No.4, and the nucleotide sequence is shown as SEQ ID No. 3; the amino acid sequence of the mutant 35-1-C1(T409A) is shown as SEQ ID No.6, and the nucleotide sequence is shown as SEQ ID No. 5.

TABLE 1 Primary screening data in TPL mutant libraries

^aIn the primary screening of salicylaldehyde spectrophotometry, when the absorbance of Fn-TPL is 100%, the absorbance is 0.9841.

EXAMPLE 4 inducible expression of wild-type and mutant TPL engineering bacteria

1. Construction of engineering bacteria:

wild-type TPL (SEQ ID No.1) and mutant genes (SEQ ID No.3 and SEQ ID No.5) are respectively connected with a vector pET-28b (+), and recombinant expression plasmids pET-28b (+) -Fn-TPL, pET-28b (+) -Fn-TPL-K402T and pET-28b (+) -Fn-TPL-T409A are constructed.

The recombinant plasmids pET-28b (+) -Fn-TPL, pET-28b (+) -Fn-TPL-K402T and pET-28b (+) -Fn-TPL-T409A are respectively transformed into E.coli BL21(DE3), and the engineering bacteria E.coli BL21(DE3)/pET-28b (+) -Fn-TPL, E.coli BL21(DE3)/pET28b (+) -Fn-TPL-K402T and E.coli BL21(DE3)/pET28b (+) -Fn-TPL-T409A are respectively obtained.

2. Induced expression of engineering bacteria

Engineering bacteria E.coli BL21(DE3)/pET-28b (+) -Fn-TPL, E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-K402T and E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-T409A are respectively inoculated into an LB liquid culture medium containing 50 mu g/mL kanamycin, cultured overnight at 37 ℃, inoculated into 50mL LB culture medium containing 50 mu g/mL kanamycin in a 2% (v/v) inoculation amount, cultured at 37 ℃ and 200rpm until the thallus concentration OD600 is about 0.6, added with IPTG with the final concentration of 0.1mM, induced cultured at 28 ℃ for 6-8 h, centrifuged at 4 ℃ and 8000rpm for 10min, collected and stored wet thallus at-80 ℃ for later use.

Example 5 preparation of TPL mutant catalysts

(1) Slant culture: respectively inoculating engineering bacteria E.coli BL21(DE3)/pET-28b (+) -Fn-TPL, E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-K402T and E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-T409A to a slant culture medium containing 50 mu g/ml kanamycin, and culturing for 16h at 37 ℃ to obtain slant thalli; the final concentration of the slant culture medium is as follows: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride, 2% agar and distilled water as a solvent, wherein the pH value is 7.0, and 50 mu g/ml of kanamycin is added before use.

(2) Seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride, 50 mu g/ml of kanamycin and distilled water as a solvent, wherein the pH value is 7.0.

(3) Fermentation culture: inoculating the seed solution into a sterile 5L mechanical stirring ventilation universal fermentation tank filled with 3L fermentation medium in an inoculation amount of 2% of volume concentration, directly adding sterilized lactose into the fermentation tank in an amount of 15g/L of final concentration, performing induction culture at 28 ℃ for 6-8 h, then placing the fermentation tank, and collecting wet thalli. The final concentration of the fermentation medium is as follows: 25g/L of peptone, 6.55g/L of yeast powder, 10g/L of NaCl, 9.1g/L of sucrose, 0.05mM of pyridoxal phosphate (PLP), MgSO₄5mM，KH₂PO₄10mM, the solvent is distilled water, and the pH is natural.

EXAMPLE 6 catalytic Synthesis of Levodopa by wild-type and mutant TPL

The levodopa can be catalyzed and synthesized by using engineering bacteria E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-K402T (K402T wet bacteria for short), E.coli BL21(DE3)/pET-28b (+) -Fn-TPL-T409A (T409A wet bacteria for short) and starting strain E.coli BL21(DE3)/pET-28b (+) -Fn-TPL wet bacteria (TPL wet bacteria for short) cells obtained by the method of example 5 as catalysts. The detection method is high performance liquid chromatography, and the mobile phase comprises the following steps: a: B ═ 9:1(A:0.02M KH)₂PO₄-6M HCl, pH 2.6; b is methanol); a chromatographic column: c18(Welchrom 4.6 x 250 mm); the detection wavelength is 280 nm; the column temperature is 34 ℃; the sample volume is 10 mu L; the flow rate was 1 ml/min. The standard substance of catechol and levodopa is prepared into a proper concentration by ultrapure water, and a standard curve of the concentration and the peak area of the substance is prepared by the liquid phase detection method. The standard curve equation of catechol is as follows: and Y is 1283.3X +10.827, the standard curve of the levodopa is Y1437.7X +127.3, and the conversion rate and the yield are calculated according to the reduction amount of the catechol in the reaction system and the accumulation amount of the levodopa.

5g of catechol were added to a 500ml reaction systemL, sodium pyruvate 7g/L, ammonium acetate 0.4M, sodium sulfite 1g/L, EDTA & Na₂2g/L pyridoxal phosphate (PLP)1mM, 20g/L (wet weight) of the K402T mutant recombinant cell wet cell mass prepared in example 5 in a sodium carbonate-sodium bicarbonate buffer (50mM) as a solvent, and adjusting the pH to 8.0 with ammonia water; the reaction is carried out at the temperature of 15 ℃ and the rotation speed of 150rpm, the substrate feeding mode is adopted in the reaction process, the feeding is carried out once every 2h, wherein, 5g/L of catechol is fed each time, 5g/L of sodium pyruvate is fed each time, 3.5g/L of ammonium acetate is fed each time, and 17 batches of the feeding are carried out. After the reaction was complete, 1mL of 1M HCl was added to stop the reaction. Filtering the reaction solution after termination by a filter membrane, taking the reaction solution, and detecting by using high performance liquid chromatography.

The result shows that the concentration of the target product of the K402T wet thallus reaches 146g/L, the conversion rate reaches 99.8%, the yield is higher than 90%, and the optical purity of levodopa is higher than 99.9%.

The K402T wet thallus in the reaction system is replaced by T409A wet thallus, the concentration of the target product reaches 132g/L, the conversion rate reaches 92%, the yield is 82%, and the optical purity of levodopa is more than 99.9%.

The K402T wet thalli in the reaction system is replaced by TPL wet thalli, in the reaction process, the substrate is supplemented for 14 times, the concentration of the target product reaches 118g/L, the conversion rate reaches 89%, the yield is 78%, and the optical purity of levodopa is more than 99.9%.

In the reaction system, the sodium pyruvate is changed to 8g/L, the temperature is changed to 20 ℃, the feed supplement interval time is changed to 1.5h, other conditions are unchanged, the concentration of a target product reaches 139g/L, the conversion rate reaches 94%, the yield is 86%, and the optical purity of levodopa is more than 99.9%.

The invention is not limited by the specific text described above. The invention can be varied within the scope outlined by the claims and these variations are within the scope of the invention.

Sequence listing

<110> Zhejiang industrial university

<120> tyrosine phenol lyase mutant, engineering bacterium and application

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1386

<212> DNA

<213> Unknown (Unknown)

<400> 1

atgcgctttg aagattatcc ggcggaaccg tttcgcatta aatcagtgga aaccgtgaaa 60

atgattgata aagcggcgcg cgaagaagtg attaaaaaag cgggctataa tacctttctg 120

attaattcag aagatgtgta tattgatctg ctgaccgatt ctggcaccaa tgctatgtct 180

gataaacagt ggggcggcct gatgcagggc gatgaagctt atgctggctc tcgtaatttt 240

tttcatctgg aagaaaccgt taaagaaatt tttggcttta aacatattgt tccgacccat 300

cagggtcgtg gtgcagaaaa tattctgagc cagattgcaa ttaaaccggg tcagtatgtt 360

ccgggtaata tgtattttac caccacccgt tatcatcagg aacgtaatgg cggcattttt 420

aaagatatta ttcgcgatga agctcatgat gctaccctga atgtgccgtt taaaggcgat 480

attgatctga ataaactgca gaaactgatt gatgaagttg gtgccgaaaa tattgcctat 540

gtgtgcctgg cggttaccgt taatctggca ggcggccagc cggtgtcaat gaaaaatatg 600

aaagctgtgc gcgaactgac caaaaaacat ggcattaaag tgttttatga tgcgacccgc 660

tgcgtggaaa atgcttattt tattaaagaa caggaagaag gttatcagga taaaaccatt 720

aaagaaattg ttcatgaaat gtttagctat gccgatggtt gtaccatgag cggtaaaaaa 780

gattgtctgg tgaatattgg cggctttctg tgtatgaatg atgaagatct gtttctggcg 840

gcgaaagaaa ttgttgttgt ttatgaaggt atgccgagct atggtggtct ggcaggtcgt 900

gatatggaag cgatggctat tggcctgcgc gaaagtctgc agtatgaata tattcgccat 960

cgtattctgc aggttcgtta tctgggtgaa aaactgaaag aagccggtgt tccgattctg 1020

gaaccggtgg gcggccatgc agtttttctg gatgcccgcc gtttttgtcc gcatattccg 1080

caggaagaat ttccggcaca ggcactggcc gccgccattt atgtggaatg cggtgtgcgt 1140

accatggaac gtggtattat tagtgcaggt cgcgatgtga aaaccggtga aaatcataaa 1200

ccgaaactgg aaaccgttcg cgtgaccatt ccgcgtcgtg tgtataccta taaacatatg 1260

gatgttgttg ccgaaggtat tattaaactg tataaacata aagaagatat taaaccgctg 1320

gaatttgttt atgaaccgaa acagctgcgc ttttttaccg cacgttttgg tattaaaaaa 1380

ctcgag 1386

<210> 2

<211> 462

<212> PRT

<213> Unknown (Unknown)

<400> 2

Met Arg Phe Glu Asp Tyr Pro Ala Glu Pro Phe Arg Ile Lys Ser Val

1 5 10 15

Glu Thr Val Lys Met Ile Asp Lys Ala Ala Arg Glu Glu Val Ile Lys

20 25 30

Lys Ala Gly Tyr Asn Thr Phe Leu Ile Asn Ser Glu Asp Val Tyr Ile

35 40 45

Asp Leu Leu Thr Asp Ser Gly Thr Asn Ala Met Ser Asp Lys Gln Trp

50 55 60

Gly Gly Leu Met Gln Gly Asp Glu Ala Tyr Ala Gly Ser Arg Asn Phe

65 70 75 80

Phe His Leu Glu Glu Thr Val Lys Glu Ile Phe Gly Phe Lys His Ile

85 90 95

Val Pro Thr His Gln Gly Arg Gly Ala Glu Asn Ile Leu Ser Gln Ile

100 105 110

Ala Ile Lys Pro Gly Gln Tyr Val Pro Gly Asn Met Tyr Phe Thr Thr

115 120 125

Thr Arg Tyr His Gln Glu Arg Asn Gly Gly Ile Phe Lys Asp Ile Ile

130 135 140

Arg Asp Glu Ala His Asp Ala Thr Leu Asn Val Pro Phe Lys Gly Asp

145 150 155 160

Ile Asp Leu Asn Lys Leu Gln Lys Leu Ile Asp Glu Val Gly Ala Glu

165 170 175

Asn Ile Ala Tyr Val Cys Leu Ala Val Thr Val Asn Leu Ala Gly Gly

180 185 190

Gln Pro Val Ser Met Lys Asn Met Lys Ala Val Arg Glu Leu Thr Lys

195 200 205

Lys His Gly Ile Lys Val Phe Tyr Asp Ala Thr Arg Cys Val Glu Asn

210 215 220

Ala Tyr Phe Ile Lys Glu Gln Glu Glu Gly Tyr Gln Asp Lys Thr Ile

225 230 235 240

Lys Glu Ile Val His Glu Met Phe Ser Tyr Ala Asp Gly Cys Thr Met

245 250 255

Ser Gly Lys Lys Asp Cys Leu Val Asn Ile Gly Gly Phe Leu Cys Met

260 265 270

Asn Asp Glu Asp Leu Phe Leu Ala Ala Lys Glu Ile Val Val Val Tyr

275 280 285

Glu Gly Met Pro Ser Tyr Gly Gly Leu Ala Gly Arg Asp Met Glu Ala

290 295 300

Met Ala Ile Gly Leu Arg Glu Ser Leu Gln Tyr Glu Tyr Ile Arg His

305 310 315 320

Arg Ile Leu Gln Val Arg Tyr Leu Gly Glu Lys Leu Lys Glu Ala Gly

325 330 335

Val Pro Ile Leu Glu Pro Val Gly Gly His Ala Val Phe Leu Asp Ala

340 345 350

Arg Arg Phe Cys Pro His Ile Pro Gln Glu Glu Phe Pro Ala Gln Ala

355 360 365

Leu Ala Ala Ala Ile Tyr Val Glu Cys Gly Val Arg Thr Met Glu Arg

370 375 380

Gly Ile Ile Ser Ala Gly Arg Asp Val Lys Thr Gly Glu Asn His Lys

385 390 395 400

Pro Lys Leu Glu Thr Val Arg Val Thr Ile Pro Arg Arg Val Tyr Thr

405 410 415

Tyr Lys His Met Asp Val Val Ala Glu Gly Ile Ile Lys Leu Tyr Lys

420 425 430

His Lys Glu Asp Ile Lys Pro Leu Glu Phe Val Tyr Glu Pro Lys Gln

435 440 445

Leu Arg Phe Phe Thr Ala Arg Phe Gly Ile Lys Lys Leu Glu

450 455 460

<210> 3

<211> 1386

<212> DNA

<213> Unknown (Unknown)

<400> 3

atgcgctttg aagattatcc ggcggaaccg tttcgcatta aatcagtgga aaccgtgaaa 60

atgattgata aagcggcgcg cgaagaagtg attaaaaaag cgggctataa tacctttctg 120

attaattcag aagatgtgta tattgatctg ctgaccgatt ctggcaccaa tgctatgtct 180

gataaacagt ggggcggcct gatgcagggc gatgaagctt atgctggctc tcgtaatttt 240

tttcatctgg aagaaaccgt taaagaaatt tttggcttta aacatattgt tccgacccat 300

cagggtcgtg gtgcagaaaa tattctgagc cagattgcaa ttaaaccggg tcagtatgtt 360

ccgggtaata tgtattttac caccacccgt tatcatcagg aacgtaatgg cggcattttt 420

aaagatatta ttcgcgatga agctcatgat gctaccctga atgtgccgtt taaaggcgat 480

attgatctga ataaactgca gaaactgatt gatgaagttg gtgccgaaaa tattgcctat 540

gtgtgcctgg cggttaccgt taatctggca ggcggccagc cggtgtcaat gaaaaatatg 600

aaagctgtgc gcgaactgac caaaaaacat ggcattaaag tgttttatga tgcgacccgc 660

tgcgtggaaa atgcttattt tattaaagaa caggaagaag gttatcagga taaaaccatt 720

aaagaaattg ttcatgaaat gtttagctat gccgatggtt gtaccatgag cggtaaaaaa 780

gattgtctgg tgaatattgg cggctttctg tgtatgaatg atgaagatct gtttctggcg 840

gcgaaagaaa ttgttgttgt ttatgaaggt atgccgagct atggtggtct ggcaggtcgt 900

gatatggaag cgatggctat tggcctgcgc gaaagtctgc agtatgaata tattcgccat 960

cgtattctgc aggttcgtta tctgggtgaa aaactgaaag aagccggtgt tccgattctg 1020

gaaccggtgg gcggccatgc agtttttctg gatgcccgcc gtttttgtcc gcatattccg 1080

caggaagaat ttccggcaca ggcactggcc gccgccattt atgtggaatg cggtgtgcgt 1140

accatggaac gtggtattat tagtgcaggt cgcgatgtga aaaccggtga aaatcataaa 1200

ccgactctgg aaaccgttcg cgtgaccatt ccgcgtcgtg tgtataccta taaacatatg 1260

gatgttgttg ccgaaggtat tattaaactg tataaacata aagaagatat taaaccgctg 1320

gaatttgttt atgaaccgaa acagctgcgc ttttttaccg cacgttttgg tattaaaaaa 1380

ctcgag 1386

<210> 4

<211> 462

<212> PRT

<213> Unknown (Unknown)

<400> 4

Met Arg Phe Glu Asp Tyr Pro Ala Glu Pro Phe Arg Ile Lys Ser Val

1 5 10 15

Glu Thr Val Lys Met Ile Asp Lys Ala Ala Arg Glu Glu Val Ile Lys

20 25 30

Lys Ala Gly Tyr Asn Thr Phe Leu Ile Asn Ser Glu Asp Val Tyr Ile

35 40 45

Asp Leu Leu Thr Asp Ser Gly Thr Asn Ala Met Ser Asp Lys Gln Trp

50 55 60

Gly Gly Leu Met Gln Gly Asp Glu Ala Tyr Ala Gly Ser Arg Asn Phe

65 70 75 80

Phe His Leu Glu Glu Thr Val Lys Glu Ile Phe Gly Phe Lys His Ile

85 90 95

Val Pro Thr His Gln Gly Arg Gly Ala Glu Asn Ile Leu Ser Gln Ile

100 105 110

Ala Ile Lys Pro Gly Gln Tyr Val Pro Gly Asn Met Tyr Phe Thr Thr

115 120 125

Thr Arg Tyr His Gln Glu Arg Asn Gly Gly Ile Phe Lys Asp Ile Ile

130 135 140

Arg Asp Glu Ala His Asp Ala Thr Leu Asn Val Pro Phe Lys Gly Asp

145 150 155 160

Ile Asp Leu Asn Lys Leu Gln Lys Leu Ile Asp Glu Val Gly Ala Glu

165 170 175

Asn Ile Ala Tyr Val Cys Leu Ala Val Thr Val Asn Leu Ala Gly Gly

180 185 190

Gln Pro Val Ser Met Lys Asn Met Lys Ala Val Arg Glu Leu Thr Lys

195 200 205

Lys His Gly Ile Lys Val Phe Tyr Asp Ala Thr Arg Cys Val Glu Asn

210 215 220

Ala Tyr Phe Ile Lys Glu Gln Glu Glu Gly Tyr Gln Asp Lys Thr Ile

225 230 235 240

Lys Glu Ile Val His Glu Met Phe Ser Tyr Ala Asp Gly Cys Thr Met

245 250 255

Ser Gly Lys Lys Asp Cys Leu Val Asn Ile Gly Gly Phe Leu Cys Met

260 265 270

Asn Asp Glu Asp Leu Phe Leu Ala Ala Lys Glu Ile Val Val Val Tyr

275 280 285

Glu Gly Met Pro Ser Tyr Gly Gly Leu Ala Gly Arg Asp Met Glu Ala

290 295 300

Met Ala Ile Gly Leu Arg Glu Ser Leu Gln Tyr Glu Tyr Ile Arg His

305 310 315 320

Arg Ile Leu Gln Val Arg Tyr Leu Gly Glu Lys Leu Lys Glu Ala Gly

325 330 335

Val Pro Ile Leu Glu Pro Val Gly Gly His Ala Val Phe Leu Asp Ala

340 345 350

Arg Arg Phe Cys Pro His Ile Pro Gln Glu Glu Phe Pro Ala Gln Ala

355 360 365

Leu Ala Ala Ala Ile Tyr Val Glu Cys Gly Val Arg Thr Met Glu Arg

370 375 380

Gly Ile Ile Ser Ala Gly Arg Asp Val Lys Thr Gly Glu Asn His Lys

385 390 395 400

Pro Thr Leu Glu Thr Val Arg Val Thr Ile Pro Arg Arg Val Tyr Thr

405 410 415

Tyr Lys His Met Asp Val Val Ala Glu Gly Ile Ile Lys Leu Tyr Lys

420 425 430

His Lys Glu Asp Ile Lys Pro Leu Glu Phe Val Tyr Glu Pro Lys Gln

435 440 445

Leu Arg Phe Phe Thr Ala Arg Phe Gly Ile Lys Lys Leu Glu

450 455 460

<210> 5

<211> 1386

<212> DNA

<213> Unknown (Unknown)

<400> 5

atgcgctttg aagattatcc ggcggaaccg tttcgcatta aatcagtgga aaccgtgaaa 60

atgattgata aagcggcgcg cgaagaagtg attaaaaaag cgggctataa tacctttctg 120

attaattcag aagatgtgta tattgatctg ctgaccgatt ctggcaccaa tgctatgtct 180

gataaacagt ggggcggcct gatgcagggc gatgaagctt atgctggctc tcgtaatttt 240

tttcatctgg aagaaaccgt taaagaaatt tttggcttta aacatattgt tccgacccat 300

cagggtcgtg gtgcagaaaa tattctgagc cagattgcaa ttaaaccggg tcagtatgtt 360

ccgggtaata tgtattttac caccacccgt tatcatcagg aacgtaatgg cggcattttt 420

aaagatatta ttcgcgatga agctcatgat gctaccctga atgtgccgtt taaaggcgat 480

attgatctga ataaactgca gaaactgatt gatgaagttg gtgccgaaaa tattgcctat 540

gtgtgcctgg cggttaccgt taatctggca ggcggccagc cggtgtcaat gaaaaatatg 600

aaagctgtgc gcgaactgac caaaaaacat ggcattaaag tgttttatga tgcgacccgc 660

tgcgtggaaa atgcttattt tattaaagaa caggaagaag gttatcagga taaaaccatt 720

aaagaaattg ttcatgaaat gtttagctat gccgatggtt gtaccatgag cggtaaaaaa 780

gattgtctgg tgaatattgg cggctttctg tgtatgaatg atgaagatct gtttctggcg 840

gcgaaagaaa ttgttgttgt ttatgaaggt atgccgagct atggtggtct ggcaggtcgt 900

gatatggaag cgatggctat tggcctgcgc gaaagtctgc agtatgaata tattcgccat 960

cgtattctgc aggttcgtta tctgggtgaa aaactgaaag aagccggtgt tccgattctg 1020

gaaccggtgg gcggccatgc agtttttctg gatgcccgcc gtttttgtcc gcatattccg 1080

caggaagaat ttccggcaca ggcactggcc gccgccattt atgtggaatg cggtgtgcgt 1140

accatggaac gtggtattat tagtgcaggt cgcgatgtga aaaccggtga aaatcataaa 1200

ccgaaactgg aaaccgttcg cgtggcaatt ccgcgtcgtg tgtataccta taaacatatg 1260

gatgttgttg ccgaaggtat tattaaactg tataaacata aagaagatat taaaccgctg 1320

gaatttgttt atgaaccgaa acagctgcgc ttttttaccg cacgttttgg tattaaaaaa 1380

ctcgag 1386

<210> 6

<211> 462

<212> PRT

<213> Unknown (Unknown)

<400> 6

Met Arg Phe Glu Asp Tyr Pro Ala Glu Pro Phe Arg Ile Lys Ser Val

1 5 10 15

Glu Thr Val Lys Met Ile Asp Lys Ala Ala Arg Glu Glu Val Ile Lys

20 25 30

Lys Ala Gly Tyr Asn Thr Phe Leu Ile Asn Ser Glu Asp Val Tyr Ile

35 40 45

Asp Leu Leu Thr Asp Ser Gly Thr Asn Ala Met Ser Asp Lys Gln Trp

50 55 60

Gly Gly Leu Met Gln Gly Asp Glu Ala Tyr Ala Gly Ser Arg Asn Phe

65 70 75 80

Phe His Leu Glu Glu Thr Val Lys Glu Ile Phe Gly Phe Lys His Ile

85 90 95

Val Pro Thr His Gln Gly Arg Gly Ala Glu Asn Ile Leu Ser Gln Ile

100 105 110

Ala Ile Lys Pro Gly Gln Tyr Val Pro Gly Asn Met Tyr Phe Thr Thr

115 120 125

Thr Arg Tyr His Gln Glu Arg Asn Gly Gly Ile Phe Lys Asp Ile Ile

130 135 140

Arg Asp Glu Ala His Asp Ala Thr Leu Asn Val Pro Phe Lys Gly Asp

145 150 155 160

Ile Asp Leu Asn Lys Leu Gln Lys Leu Ile Asp Glu Val Gly Ala Glu

165 170 175

Asn Ile Ala Tyr Val Cys Leu Ala Val Thr Val Asn Leu Ala Gly Gly

180 185 190

Gln Pro Val Ser Met Lys Asn Met Lys Ala Val Arg Glu Leu Thr Lys

195 200 205

Lys His Gly Ile Lys Val Phe Tyr Asp Ala Thr Arg Cys Val Glu Asn

210 215 220

Ala Tyr Phe Ile Lys Glu Gln Glu Glu Gly Tyr Gln Asp Lys Thr Ile

225 230 235 240

Lys Glu Ile Val His Glu Met Phe Ser Tyr Ala Asp Gly Cys Thr Met

245 250 255

Ser Gly Lys Lys Asp Cys Leu Val Asn Ile Gly Gly Phe Leu Cys Met

260 265 270

Asn Asp Glu Asp Leu Phe Leu Ala Ala Lys Glu Ile Val Val Val Tyr

275 280 285

Glu Gly Met Pro Ser Tyr Gly Gly Leu Ala Gly Arg Asp Met Glu Ala

290 295 300

Met Ala Ile Gly Leu Arg Glu Ser Leu Gln Tyr Glu Tyr Ile Arg His

305 310 315 320

Arg Ile Leu Gln Val Arg Tyr Leu Gly Glu Lys Leu Lys Glu Ala Gly

325 330 335

Val Pro Ile Leu Glu Pro Val Gly Gly His Ala Val Phe Leu Asp Ala

340 345 350

Arg Arg Phe Cys Pro His Ile Pro Gln Glu Glu Phe Pro Ala Gln Ala

355 360 365

Leu Ala Ala Ala Ile Tyr Val Glu Cys Gly Val Arg Thr Met Glu Arg

370 375 380

Gly Ile Ile Ser Ala Gly Arg Asp Val Lys Thr Gly Glu Asn His Lys

385 390 395 400

Pro Lys Leu Glu Thr Val Arg Val Ala Ile Pro Arg Arg Val Tyr Thr

405 410 415

Tyr Lys His Met Asp Val Val Ala Glu Gly Ile Ile Lys Leu Tyr Lys

420 425 430

His Lys Glu Asp Ile Lys Pro Leu Glu Phe Val Tyr Glu Pro Lys Gln

435 440 445

Leu Arg Phe Phe Thr Ala Arg Phe Gly Ile Lys Lys Leu Glu

450 455 460

Claims

1. A coding gene of a mutant of a tyrosol lyase is characterized in that the nucleotide sequence of the coding gene is shown in SEQ ID No. 3.

2. A genetically engineered bacterium constructed from the gene encoding the mutant tyrosol lyase of claim 1.

3. The use of the mutant tyrosine phenol lyase described in claim 1 for the synthesis of levodopa by a method comprising: the wet thallus obtained by fermentation culture of engineering bacteria containing tyrosine phenol lyase mutant coding gene is used as catalyst, catechol, sodium pyruvate and ammonium acetate are used as substrate, sodium sulfite and EDTA & Na are used as substrate₂Taking pyridoxal phosphate as a coenzyme, taking a buffer solution with the pH value of 6.0-10.5 as a reaction medium to form a conversion system, carrying out conversion reaction at the temperature of 5-30 ℃ and the rotating speed of 100-200 rpm, and separating and purifying reaction liquid after the reaction is finished to obtain levodopa;

in the transformation system, catechol with a final concentration of 5-50 g/L, sodium pyruvate with a final concentration of 5-50 g/L, ammonium acetate with a final concentration of 0.1-1.4M, sodium sulfite with a final concentration of 0.5-10 g/L, EDTA & Na₂Adding the pyridoxal phosphate to the mixture to a final concentration of 0.5-10 g/L and a final concentration of 0.05-5 mM, wherein the wet bacteria dosage is 2-50 g/L;

in the conversion reaction process, feeding pyrocatechol, sodium pyruvate and ammonium acetate once every 0.5-4 h, wherein the feeding of pyrocatechol is 0.1-10 g/L, the feeding of sodium pyruvate is 0.1-10 g/L, and the feeding of ammonium acetate is 1-20 g/L;

the catalyst is prepared by the following method:

(3) fermentation culture: inoculating the seed solution into a sterile 5L mechanical stirring ventilation universal fermentation tank filled with 3L fermentation medium in an inoculation amount with the volume concentration of 2%, directly adding sterilized lactose into the fermentation tank in an amount with the final concentration of 15g/L, performing induction culture at 28 ℃ for 6-8 h, and then putting the fermentation tank to collect wet thalli; the final concentration of the fermentation medium is as follows: 25g/L of peptone, 6.55g/L of yeast powder, 10g/L of NaCl, 9.1g/L of sucrose, 0.05mM of pyridoxal phosphate and MgSO₄ 5 mM，KH₂PO₄10mM, the solvent is distilled water, and the pH is natural.