CN106754846B - Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof - Google Patents
Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof Download PDFInfo
- Publication number
- CN106754846B CN106754846B CN201611094369.9A CN201611094369A CN106754846B CN 106754846 B CN106754846 B CN 106754846B CN 201611094369 A CN201611094369 A CN 201611094369A CN 106754846 B CN106754846 B CN 106754846B
- Authority
- CN
- China
- Prior art keywords
- mutant
- final concentration
- glu
- gly
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y401/00—Carbon-carbon lyases (4.1)
- C12Y401/99—Other Carbon-Carbon Lyases (1.4.99)
- C12Y401/99002—Tyrosine phenol-lyase (4.1.99.2)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a fusobacterium nucleatum tyrosine phenol lyase mutant, a gene, a vector, an engineering bacterium and application thereof in synthesizing levodopa. The accumulation concentration of the synthesized levodopa by the TPL mutant is up to more than 140g/L, which is improved by 17-25% compared with the wild type, and the optical purity is more than 99.5%; the conversion rate of the substrate catechol reaches over 99.8 percent, and is improved by 15 to 20 percent compared with the wild type.
Description
(I) technical field
The invention relates to a Tyrosinol PhonolLyase (TPL) mutant derived from fusobacterium nucleatum, a coding gene and application thereof in catalyzing and synthesizing levodopa (L-DOPA).
(II) background of the invention
Levodopa (beta-3, 4-dihydroxyphenyl-alpha-alanine, 3, 4-dihydrophenylelalanine-L-alanine, L-DOPA) is an important bioactive substance in the body. It can reach central nervous system through blood brain barrier, and under the action of decarboxylase in vivo, it is converted into dopamine, so as to exert the action of treating Parkinson's syndrome. With the increasing pressure of life and the increasing aging of population of modern society, the number of patients with Parkinson disease is increasing day by day, and the demand of levodopa as a first choice drug for treating Parkinson's disease is increasing continuously.
The traditional main method for preparing levodopa comprises extraction from plants such as chenopodium quinoa and phaseolus calcaratus, chemical asymmetric synthesis and the like. Wherein, the extraction of levodopa from plants is limited by the source of raw materials, and the extraction steps are complicated, the yield is low, and the market demand can not be met; the chemical asymmetric synthesis method is limited in industrial production due to the problems of harsh reaction conditions, low conversion rate and stereoselectivity, environmental unfriendliness and the like. Biocatalysis has become an important method for industrial production of levodopa due to its advantages of mild reaction conditions, efficient process, high degree of stereoselectivity, regioselectivity, chemoselectivity and the like.
The biocatalyst for synthesizing levodopa by an enzyme method mainly comprises tyrosinase, aminoacylase, p-hydroxyphenylacetic acid 3-hydroxylase, tyrosol lyase and the like. The tyrosinase catalyzes L-tyrosine to synthesize levodopa, the enzyme activity is low, and the tyrosinase has diphenol oxidation activity, so that the levodopa is further oxidized to generate a byproduct dopaquinone. Amino acylase kinetic resolution N-acetyl-3- (3, 4-dimethoxyphenyl) alanine is hydrolyzed to synthesize 3- (3, 4-dimethoxyphenyl) alanine, and the methoxy group is deprotected by HBr to synthesize levodopa. The process has long route, and has large potential safety hazard due to the use and generation of toxic gas MeBr. When the p-hydroxyphenylacetic acid 3-hydroxylase catalyzes L-tyrosine to synthesize levodopa, the cofactor NADH is required to participate in the catalytic reaction, and the production cost is high. Compared with the enzyme method process, the Tyrosine Phenol Lyase (TPL) process takes catechol, pyruvic acid and ammonia as substrates, synthesizes the levodopa through C-C bond forming reaction, and has high atom economy. Because the solubility of the levodopa in water is low, the levodopa is continuously separated out in a biocatalytic reaction, the reversible reaction is favorably carried out towards the generation direction of a product, and a higher conversion rate is achieved, so that the levodopa has an important industrial development prospect.
TPL is widely present in various microorganisms, and currently, sources of TPL reported for levodopa synthesis include citrobacter freundii (Citrobacterfreundii), erwinia herbicola (erwinia herbicola), and thermophilus (Symbiobacterium sp).
Since catechol, one of the substrates for synthesizing levodopa catalyzed by TPL, is not a natural substrate of the enzyme, the catalytic efficiency of the enzyme needs to be improved. On the other hand, catechol is a strong protein denaturant, and in a high-strength industrial production environment, high-concentration catechol can inhibit TPL and even irreversibly inactivate TPL. Therefore, the development of new TPL with high activity and high catechol tolerance has very important significance for realizing the industrial production of levodopa.
Disclosure of the invention
The invention aims to modify a tyrosine phenol lyase derived from fusobacterium nucleatum by means of directed evolution, provide a mutant protein, improve the protein activity, and efficiently catalyze and synthesize levodopa by using catechol, pyruvic acid and ammonia as substrates.
The technical scheme adopted by the invention is as follows:
the invention provides a mutant (namely TPL mutant) of fusobacterium nucleatum tyrosine phenol lyase, which is obtained by carrying out error-prone PCR double mutation on 84 th site and 129 th site of an amino acid sequence shown in SEQ ID NO. 2. Specifically, the double mutation is to mutate 84 th glutamic acid (E) into lysine (K), and simultaneously mutate 129 th threonine (T) into isoleucine (I), wherein the amino acid sequence of the mutant is shown in SEQ ID NO. 4. Any amino acid sequence shown in SEQ ID NO.4 with one or more amino acids deleted, inserted or substituted and having TPL activity still belongs to the protection scope of the present invention.
The invention successfully clones a gene (Fn-TPL) for coding TPL by extracting a genome of fusobacterium nucleatum (F.nucleolus, CGMCC 1.2526, purchased from China center for culture Collection of industrial microorganisms) as a template, and carrying out expression of the gene after transforming the gene into Escherichia coli. Further extracting Fn-TPL plasmid from escherichia coli, randomly mutating TPL gene by using a multi-round error-prone PCR method, connecting the TPL gene to an expression vector, expressing the TPL gene in the escherichia coli, and screening to obtain the mutant with improved activity, wherein the mutant can be used for industrial production of levodopa.
The invention carries out mutation on TPL coded by SEQ ID NO.1, and can adopt conventional moleculesAnd (5) a modification means. Preferentially, Mg is altered in PCR systems by error-prone PCR amplification2+Concentration, and addition of Mn2+To obtain the mutant DNA sequence SEQ ID NO.3, the amino acid sequence of which is SEQ ID NO. 4.
The invention also provides a coding gene of the fusobacterium nucleatum TPL mutant, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 3.
The invention also relates to a recombinant vector constructed by the coding gene and a recombinant gene engineering bacterium prepared by transforming the recombinant vector.
The present invention can be constructed by ligating the nucleotide sequence of the TPL mutant of the present invention to various vectors by a method conventional in the art. The recombinant vector of the present invention is not limited as long as it can maintain its replication or autonomous replication in various host cells of prokaryotic and/or eukaryotic cells, and it may be various vectors conventional in the art, such as various plasmids, phage or viral vectors, etc., preferably pET-28 a. Preferably, the recombinant expression vector of the present invention can be obtained by: the obtained wild TPL and mutant gene products are connected with a vector pET-28a to construct TPL mutant gene recombinant expression plasmids pET28a-FnTPL and pET28a-FnTPLM of the invention.
The host cell into which the DNA encoding the TPL mutant of the present invention is introduced is not limited as long as a recombinant expression system has been established therefor so that the recombinant expression vector can stably self-replicate and the carried TPL mutant gene of the present invention can be efficiently expressed. Such as Escherichia coli, Bacillus subtilis, yeast, actinomycetes, Aspergillus, and animal cells and higher plant cells. Coli BL21(DE3) is preferred in the present invention. The recombinant plasmids pET28a-FnTPL and pET28a-FnTPLM are transformed into E.coli BL21(DE3) to obtain the engineering bacteria E.coli BL21(DE3)/pET28a-FnTPL and E.coli BL21(DE3)/pET28 a-FnTPLM.
The preparation of the recombinant TPL mutant comprises the steps of culturing the recombinant expression transformant and obtaining the recombinant TPL mutant protein through induction. Wherein, the culture medium used for culturing the recombinant expression transformant can be a medium which can be used for growing the transformant and producing the transformantThe culture medium, preferably LB culture medium, of TPL of the invention: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, water as a solvent and pH 7.2. The culture method and culture conditions are not particularly limited as long as the transformant can grow and produce TPL. The following methods are preferred: coli BL21(DE3)/pET28a-FnTPLM related to the present invention was inoculated into LB medium containing 50. mu.g/ml kanamycin and cultured at 37 ℃ to optical density OD600When the concentration reaches 0.5-0.7, the TPL mutant protein can be efficiently expressed under the induction of isopropyl-beta-D-thiogalactopyranoside (IPTG) with the final concentration of 0.1-1.0 mM.
The invention also provides an application of the fusobacterium nucleatum TPL mutant in the synthesis of levodopa, and specifically the application uses wet thalli obtained by fermentation culture of recombinant genetic engineering bacteria containing coding genes of the fusobacterium nucleatum TPL mutant as a catalyst, pyrocatechol, sodium pyruvate and ammonium acetate as substrates, and sodium sulfite and EDTA & Na2And (3) as an auxiliary agent, forming a conversion system by taking Pyridoxal phosphate (PLP) as a coenzyme and taking a buffer solution with pH of 5.0-9.0 (preferably pH of 8.0) as a reaction medium, carrying out conversion reaction at the temperature of 5-30 ℃ (preferably 15 ℃), and separating and purifying the reaction solution after the reaction is finished to obtain the levodopa.
Further, in the transformation system, at the beginning, catechol is added to the final concentration of 5-50 g/L (preferably 5g/L), sodium pyruvate is added to the final concentration of 5-50 g/L (preferably 8g/L), ammonium acetate is added to the final concentration of 5-100 g/L (preferably 50g/L), sodium sulfite is added to the final concentration of 0.5-10 g/L (preferably 1g/L), EDTA & Na2The final concentration is 0.5-10 g/L (preferably 2g/L), the final concentration is 0.05-5 mM (preferably 1mM), and the wet bacterial cell dosage is 2-50 g/L (preferably 20 g/L).
Furthermore, in the conversion reaction process, pyrocatechol, sodium pyruvate and ammonium acetate are fed, and the feeding is carried out once every 0.5-4 h, wherein the feeding of pyrocatechol is 0.1-10 g/L (preferably 5g/L) for each time, the feeding of sodium pyruvate is 0.1-10 g/L (preferably 5g/L) for each time, and the feeding of ammonium acetate is 1-20 g/L (preferably 3.5g/L) for each time.
The TPL mutant provided by the invention can catalyze and synthesize levodopa in the forms of free enzyme, immobilized enzyme and recombinant free cells.
Further, the catalyst is prepared by the following method:
(1) slant culture: inoculating recombinant genetic engineering bacteria containing coding genes of the fusobacterium nucleatum TPL mutant to a slant culture medium containing 50 mu g/ml kanamycin, and culturing at 37 ℃ for 8-16 h to obtain slant bacteria; the final concentration of the slant culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 1.5% agar and deionized water as a solvent, and the pH value is 7.0. Kanamycin (50. mu.g/ml) was added before use.
(2) Seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 50 mu g/ml of kanamycin and deionized water as a solvent, wherein the pH value is 7.0.
(3) Fermentation culture: the seed solution was inoculated in an inoculum size of 3% by volume into a sterile 5L mechanically stirred aerated universal fermenter containing 3L of fermentation medium, and sterilized lactose was added directly to the fermenter to a final concentration of 15g/L for induction cultivation at 28 ℃. And after culturing for 6-8 h, putting the culture medium into a tank to collect wet thalli. The final concentration of the fermentation medium is as follows: peptone 15g/L, yeast powder 12g/L, NaCl10g/L, glycerin 15g/L, (NH)4)2SO45g/L，KH2PO41.36g/L，K2HPO4·3H2O 2.28g/L，MgSO4·7H2O0.375 g/L, solvent deionized water, pH.
Compared with the prior art, the invention has the beneficial effects that: compared with the wild type, the Fusobacterium nucleatum TPL mutant provided by the invention has better catalytic performance. The accumulation concentration of the synthesized levodopa by the TPL mutant is up to more than 140g/L, which is improved by 17-25% compared with the wild type, and the optical purity is more than 99.5%; the conversion rate of the substrate catechol reaches over 99.8 percent, and is improved by 15 to 20 percent compared with the wild type.
(IV) description of the drawings
FIG. 1 shows the reaction process of whole cell catalyzed synthesis of levodopa by TPL containing wild type and mutant.
(V) detailed description of the preferred embodiments
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
EXAMPLE 1 obtaining TPL Gene
Extracting the whole genome DNA of Fusobacterium nucleatum (F.Nuclear subsp.CGMCC 1.2526, purchased from China center for Industrial culture Collection of microorganisms) by using a DNA extraction kit, and taking the DNA as a template and an upstream primer (5' GCTGA)GGATC CATGAGATTTGAAGATTATCCAGC3’) And a downstream primer (5' GCATC)CTCGAGTTATTTTTTTATTCCAAATCTAGC3’) PCR amplification reaction was performed for the active primer. The adding amount of each component of the PCR reaction system (the total volume is 50 mu L): 5 XPrimeSTARTM HS DNA polymerase Buffer 10. mu.L, 10mM dNTP mix (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4. mu.L, 50. mu.M concentration of upstream primer, downstream primer each 1. mu.L, genomic DNA 1. mu.L, PrimeSTARTMHS DNA polymerase 0.5. mu.L, no nucleic acid 32.5. mu.L. The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 1min, then temperature cycling at 95 ℃ for 10s, 56 ℃ for 90s, and 72 ℃ for 1min for 30 cycles, and finally extension at 72 ℃ for 10min, and termination at 4 ℃. The sequencing analysis result shows that the length of the nucleotide sequence obtained by the amplification of the process is 1383bp (the nucleotide sequence is shown as SEQ ID NO: 1), the sequence codes a complete open reading frame, and the coded amino acid sequence is shown as SEQ ID NO: 2, respectively.
Example 2 error-prone PCR construction of TPL mutation library
The mutant sequence was obtained by error-prone PCR amplification using the TPL gene obtained in example 1 as a template. The amplification primer is (5' GCTGA)GGATCCATGAGATTTGAAGATTATCCAGC3’) And (5' GCATC)CTCGAGTTATTTTTTTATTCCAAATCTAGC3’)。
The amplification system is as follows: 50 μ l reaction:
10xTaq polymerase buffer：5μL；
Mg2+(25mM)：2-8μL；
Mm2+(25mM):2-8μL；
10mM dNTP mix (2.5 mM each of dATP, dCTP, dGTP and dTTP) 4. mu.m;
1. mu.L of each of the upstream primer and the downstream primer at a concentration of 50. mu.M,
DNA template: 1 mu L of the solution;
taq DNA polymerase: 10U;
the system is complemented with double distilled water.
The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 1min, then temperature cycling at 95 ℃ for 10s, 56 ℃ for 90s, and 72 ℃ for 1min for 30 cycles, and finally extension at 72 ℃ for 10min, and termination at 4 ℃. The PCR product was analyzed by 1% agarose gel electrophoresis and recovered by cutting gel, digested by BamHI/XhoI, ligated with pET28a digested with the same enzyme, E.coli BL21(DE3) competent cells were transformed by electric shock with a ligation solution, plated with LB plate containing kanamycin (50. mu.g/ml), and cultured overnight at 37 ℃ to obtain a mutation library of TPL.
Example 3 screening of TPL mutant libraries
Screening of TPL mutant libraries is described in the literature (Choi, et al., Kor.J. Microbiol.2006,34: 58-62). And (3) primarily screening to obtain positive clones with improved activity by taking the enzyme before mutation as a reference, and further determining by liquid chromatography. After the first round of mutation, the mutant with the highest activity was obtained, and sequencing showed that the obtained mutant was E84K. Extracting plasmid containing E84K mutant as template, performing second round of error-prone PCR, transforming into Escherichia coli as example 2, screening mutation library to obtain mutant with activity higher than that of E84K, and sequencing to show that the obtained mutant is double mutant E84K/T129I with amino acid sequence shown as SEQ ID No.4 and nucleotide sequence shown as SEQ ID No. 3.
EXAMPLE 4 inducible expression of wild-type and mutant TPL engineering bacteria
Engineering bacteria E.coli BL21(DE3)/pET28a-FnTPL and E.coli BL21(DE3)/pET28a-FnTPLM containing wild type (SEQ ID No.1) and mutant TPL (SEQ ID No.3) recombinant plasmids are respectively inoculated into LB liquid culture medium containing 50 mu g/mL kanamycin, cultured at 37 ℃ overnight, then inoculated into 50mL LB culture medium containing 50 mu g/mL kanamycin in an inoculation amount of 1% (v/v), cultured at 37 ℃ at 200rpm until the thallus concentration OD600Adding IPTG to a final concentration of 0.1mM, and inducing at 28 deg.CAfter the induction culture is carried out for 6-8 h, the wet thalli are collected by centrifugation at 8000rpm for 10min at 4 ℃ and stored at-80 ℃ for later use.
EXAMPLE 5 preparation of TPL mutant catalysts
(1) Slant culture: inoculating recombinant genetically engineered bacterium E.coliBL21(DE3)/pET28a-FnTPLM containing coding gene of the TPL mutant of the fusobacterium nucleatum to a slant culture medium containing 50 mu g/ml kanamycin, and culturing for 16h at 37 ℃ to obtain slant thalli; the final concentration of the slant culture medium comprises the following components by mass: 10g/L peptone, 5g/L yeast extract, 10g/L sodium chloride, 1.5% agar, deionized water as solvent, pH7.0, and 50. mu.g/ml kanamycin before use.
(2) Seed culture: inoculating the slant thalli to a seed culture medium, and culturing at 37 ℃ for 8-10 h to obtain a seed solution; the final concentration of the seed culture medium is as follows: 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 50 mu g/ml of kanamycin and deionized water as a solvent, wherein the pH value is 7.0.
(3) Fermentation culture: the seed solution was inoculated in an inoculum size of 3% by volume into a sterile 5L mechanically stirred aerated universal fermenter containing 3L of fermentation medium, and sterilized lactose was added directly to the fermenter to a final concentration of 15g/L for induction cultivation at 28 ℃. And after culturing for 6-8 h, putting the culture medium into a tank to collect wet thalli. The final concentration of the fermentation medium is as follows: peptone 15g/L, yeast powder 12g/L, NaCl10g/L, glycerin 15g/L, (NH)4)2SO45g/L，KH2PO41.36g/L，K2HPO4·3H2O 2.28g/L，MgSO4·7H2O0.375 g/L, deionized water as solvent, and natural pH.
EXAMPLE 6 catalytic Synthesis of Levodopa by wild-type and mutant TPL
The ability to catalyze the synthesis of levodopa was determined using cells of the mutant strain E.coli BL21(DE3)/pET28a-FnTPLM obtained in example 4 and the starting strain E.coli BL21(DE3)/pET28a-FnTPL, respectively.
(1) 5g/L catechol, 5g/L sodium pyruvate, 5g/L ammonium acetate, 0.5g/L sodium sulfite, EDTA & Na were added to a 500ml reaction system20.5g/L, pyridoxal phosphate (PLP)0.05mM, aqueous ammonia to pH80, TPL mutant recombinant cell concentration prepared in example 5 was 5g/L (wet weight); the reaction was carried out at a temperature of 15 ℃. The reaction process is carried out by adopting a feeding mode, feeding is carried out once every 0.5h, wherein 0.5g/L of catechol is fed each time, 0.8g/L of sodium pyruvate is fed each time, and 2g/L of ammonium acetate is fed each time and converted for 24 h. After the reaction is finished, detecting by using a high performance liquid chromatography under the following detection conditions:
mobile phase a: B ═ 9:1(a:0.02M KH2PO4-6M HCl, pH ═ 2.6; B: methanol)
Chromatographic column C18(Welchrom 4.6 x 250mm)
Detection wavelength of 280nm
Column temperature 34 deg.C
The sample injection amount is 10 mu L
Flow rate 1ml/min
The TPL mutant strain catalyzes and synthesizes the levodopa, the concentration of a target product reaches 20g/L, the conversion rate reaches 45%, the yield is 39%, and the optical purity of the levodopa is more than 99.5%; the wild TPL strain cell catalyzes and synthesizes the levodopa, the concentration of a target product reaches 15g/L, the conversion rate reaches 36%, the yield reaches 29%, and the optical purity of the levodopa is more than 99.5%.
(2) 5g/L catechol, 8g/L sodium pyruvate, 50g/L ammonium acetate, 1g/L sodium sulfite, EDTA & Na were added to a 500ml reaction system22g/L, pyridoxal phosphate (PLP)1mM, aqueous ammonia to pH8.0, and the TPL mutant recombinant cell prepared in example 5 at a concentration of 20g/L (wet weight); the reaction was carried out at a temperature of 15 ℃. The reaction process is carried out by adopting a feeding mode, feeding is carried out once every 1h, wherein, 5g/L of catechol is fed each time, 5g/L of sodium pyruvate is fed each time, and 3.5g/L of ammonium acetate is fed each time, and the conversion is carried out for 17 h. The TPL mutant strain catalyzes and synthesizes levodopa, the concentration of a target product reaches 140g/L (figure 1), the conversion rate reaches 99.8%, the yield is higher than 91%, and the optical purity of the levodopa is higher than 99.5%; the wild TPL strain cell catalyzes and synthesizes the levodopa, the concentration of a target product reaches 120g/L (figure 1), the conversion rate reaches 85%, the yield reaches 78%, and the optical purity of the levodopa is more than 99.5%.
(3) 20g/L of catechol, 20g/L of sodium pyruvate, 60g/L of ammonium acetate and 5g/L of sodium sulfite are added into a 500ml reaction system,EDTA·Na25g/L, 3.5mM pyridoxal phosphate (PLP), pH adjusted to 8.0 with ammonia, 35g/L (wet weight) of TPL mutant recombinant cell concentration; the reaction was carried out at a temperature of 15 ℃. The reaction process is carried out by adopting a feeding mode, feeding is carried out once every 2h, wherein, 8g/L of catechol is fed each time, 8g/L of sodium pyruvate is fed each time, and 15g/L of ammonium acetate is fed each time, and the conversion time is 20 h. The TPL mutant strain catalyzes and synthesizes the levodopa, the concentration of a target product reaches 58g/L, the conversion rate reaches 41%, the yield reaches 35%, and the optical purity of the levodopa is more than 99.5%; the wild strain catalyzes and synthesizes the levodopa, the concentration of a target product reaches 45g/L, the conversion rate reaches 35%, the yield reaches 27%, and the optical purity of the levodopa is more than 99.5%.
(4) 50g/L of catechol, 50g/L of sodium pyruvate, 100g/L of ammonium acetate, 10g/L of sodium sulfite, EDTA & Na and the like are added into a 500ml reaction system210g/L, pyridoxal phosphate (PLP)5mM, aqueous ammonia to pH8.0, and the TPL mutant recombinant cell prepared in example 5 at a concentration of 50g/L (wet weight); the reaction was carried out at a temperature of 15 ℃. The reaction process is carried out by adopting a feeding mode, feeding is carried out once every 3h, wherein, 10g/L of catechol is fed each time, 10g/L of sodium pyruvate is fed each time, and 20g/L of ammonium acetate is fed each time, and the conversion is carried out for 9 h. The TPL mutant strain catalyzes and synthesizes levodopa, the concentration of a target product reaches 45g/L, the conversion rate reaches 35%, the yield reaches 28%, and the optical purity of the levodopa is more than 99.5%; the wild strain catalyzes and synthesizes the levodopa, the concentration of a target product reaches 30g/L, the conversion rate reaches 25%, the yield reaches 19%, and the optical purity of the levodopa is more than 99.5%.
The invention is not limited by the specific text described above. The invention can be varied within the scope outlined by the claims and these variations are within the scope of the invention.
SEQUENCE LISTING
<110> Zhejiang industrial university
<120> mutant, gene, vector, engineering bacterium of tyrosine phenol lyase of fusobacterium nucleatum and application thereof
<130>
<160>4
<170>PatentIn version 3.5
<210>1
<211>1383
<212>DNA
<213>Fusobacteriumnucleatum
<400>1
atgagatttg aagattatcc agcagagcca tttagaatta aaagtgtaga aactgttaaa 60
atgattgata aggcagcaag agaagaagta attaaaaaag caggatataa tactttctta 120
attaactctg aagatgttta cattgattta ttaactgata gtggaactaa tgctatgagt 180
gataaacaat ggggtggatt aatgcaaggt gatgaagctt atgcaggaag tagaaatttc 240
ttccacttag aagaaactgt aaaagaaata tttgggttta aacatatagt tcctactcac 300
caaggaagag gagcagaaaa tattttatct caaatagcta taaaacctgg acaatatgtt 360
cctggaaata tgtattttac aactactaga tatcaccaag aaagaaatgg tggaatattt 420
aaagatatta tcagagatga ggcacatgat gctactctta atgttccttt caaaggagat 480
attgacttaa ataaattaca aaaattaata gatgaagttg gagcagaaaa cattgcttat 540
gtttgtttag ctgtaactgt aaaccttgct ggtggacaac cagtttctat gaaaaatatg 600
aaagcagtta gagaactaac taaaaaacat ggaataaaag ttttctatga tgcaactaga 660
tgtgttgaaa atgcttactt cattaaagaa caagaagaag gatatcaaga taaaactata 720
aaggaaatag tgcatgaaat gtttagctat gctgatggat gtactatgag tggtaaaaaa 780
gattgtcttg ttaatatagg tggattttta tgtatgaatg atgaagattt attcttagct 840
gcaaaagaaa tagttgttgt ttatgaaggt atgccatctt atggtggact tgctggtaga 900
gatatggaag ctatggcaat agggttaaga gaatctttac aatatgaata cattagacat 960
agaattttac aagttagata cttaggagaa aaattaaaag aagctggtgt acctatactt 1020
gaaccagttg gaggacatgc tgtattccta gatgctagaa gattctgtcc tcatatccca 1080
caagaagaat tcccagctca agctcttgca gcagctatct atgttgaatg tggtgtaaga 1140
actatggaaa gaggaataat ttctgctggt agagatgtaa aaactggtga aaaccataaa 1200
cctaaactag aaactgttag agttactatt ccaagaagag tttatactta taaacatatg 1260
gatgtagtag cagaaggtat aatcaaatta tataaacata aagaagatat aaaaccatta 1320
gaatttgtat atgaaccaaa acaattaaga ttctttacag ctagatttgg aataaaaaaa 1380
taa 1383
<210>2
<211>460
<212>PRT
<213>Fusobacteriumnucleatum
<400>2
Met Arg Phe Glu Asp Tyr Pro Ala Glu Pro Phe Arg Ile Lys Ser Val
1 5 10 15
Glu Thr Val Lys Met Ile Asp Lys Ala Ala Arg Glu Glu Val Ile Lys
20 25 30
Lys Ala Gly Tyr Asn Thr Phe Leu Ile Asn Ser Glu Asp Val Tyr Ile
35 40 45
Asp Leu Leu Thr Asp Ser Gly Thr Asn Ala Met Ser Asp Lys Gln Trp
50 55 60
Gly Gly Leu Met Gln Gly Asp Glu Ala Tyr Ala Gly Ser Arg Asn Phe
65 70 75 80
Phe His Leu Glu Glu Thr Val Lys Glu Ile Phe Gly Phe Lys His Ile
85 90 95
Val Pro Thr His Gln Gly Arg Gly Ala Glu Asn Ile Leu Ser Gln Ile
100 105 110
Ala Ile Lys Pro Gly Gln Tyr Val Pro Gly Asn Met Tyr Phe Thr Thr
115 120 125
Thr Arg Tyr His Gln Glu Arg Asn Gly Gly Ile Phe Lys Asp Ile Ile
130 135 140
Arg Asp Glu Ala His Asp Ala Thr Leu Asn Val Pro Phe Lys Gly Asp
145 150 155 160
Ile Asp Leu Asn Lys Leu Gln Lys Leu Ile Asp Glu Val Gly Ala Glu
165 170 175
Asn Ile Ala Tyr Val Cys Leu Ala Val Thr Val Asn Leu Ala Gly Gly
180 185 190
Gln Pro Val Ser Met Lys Asn Met Lys Ala Val Arg Glu Leu Thr Lys
195 200 205
Lys His Gly Ile Lys Val Phe Tyr Asp Ala Thr Arg Cys Val Glu Asn
210 215 220
Ala Tyr Phe Ile Lys Glu Gln Glu Glu Gly Tyr Gln Asp Lys Thr Ile
225 230 235 240
Lys Glu Ile Val His Glu Met Phe Ser Tyr Ala Asp Gly Cys Thr Met
245 250 255
Ser Gly Lys Lys Asp Cys Leu Val Asn Ile Gly Gly Phe Leu Cys Met
260 265 270
Asn Asp Glu Asp Leu Phe Leu Ala Ala Lys Glu Ile Val Val Val Tyr
275 280 285
Glu Gly Met Pro Ser Tyr Gly Gly Leu Ala Gly Arg Asp Met Glu Ala
290 295 300
Met Ala Ile Gly Leu Arg Glu Ser Leu Gln Tyr Glu Tyr Ile Arg His
305 310 315 320
Arg Ile Leu Gln Val Arg Tyr Leu Gly Glu Lys Leu Lys Glu Ala Gly
325 330 335
Val Pro Ile Leu Glu Pro Val Gly Gly His Ala Val Phe Leu Asp Ala
340 345 350
Arg Arg Phe Cys Pro His Ile Pro Gln Glu Glu Phe Pro Ala Gln Ala
355 360 365
Leu Ala Ala Ala Ile Tyr Val Glu Cys Gly Val Arg Thr Met Glu Arg
370 375 380
Gly Ile Ile Ser Ala Gly Arg Asp Val Lys Thr Gly Glu Asn His Lys
385 390 395 400
Pro Lys Leu Glu Thr Val Arg Val Thr Ile Pro Arg Arg Val Tyr Thr
405 410 415
Tyr Lys His Met Asp Val Val Ala Glu Gly Ile Ile Lys Leu Tyr Lys
420 425 430
His Lys Glu Asp Ile Lys Pro Leu Glu Phe Val Tyr Glu Pro Lys Gln
435 440 445
Leu Arg Phe Phe Thr Ala Arg Phe Gly Ile Lys Lys
450 455 460
<210>3
<211>1383
<212>DNA
<213>unknown
<220>
<223> Artificial sequence
<400>3
atgagatttg aagattatcc agcagagcca tttagaatta aaagtgtaga aactgttaaa 60
atgattgata aggcagcaag agaagaagta attaaaaaag caggatataa tactttctta 120
attaactctg aagatgttta cattgattta ttaactgata gtggaactaa tgctatgagt 180
gataaacaat ggggtggatt aatgcaaggt gatgaagctt atgcaggaag tagaaatttc 240
ttccacttag aaaaaactgt aaaagaaata tttgggttta aacatatagt tcctactcac 300
caaggaagag gagcagaaaa tattttatct caaatagcta taaaacctgg acaatatgtt 360
cctggaaata tgtattttac aactattaga tatcaccaag aaagaaatgg tggaatattt 420
aaagatatta tcagagatga ggcacatgat gctactctta atgttccttt caaaggagat 480
attgacttaa ataaattaca aaaattaata gatgaagttg gagcagaaaa cattgcttat 540
gtttgtttag ctgtaactgt aaaccttgct ggtggacaac cagtttctat gaaaaatatg 600
aaagcagtta gagaactaac taaaaaacat ggaataaaag ttttctatga tgcaactaga 660
tgtgttgaaa atgcttactt cattaaagaa caagaagaag gatatcaaga taaaactata 720
aaggaaatag tgcatgaaat gtttagctat gctgatggat gtactatgag tggtaaaaaa 780
gattgtcttg ttaatatagg tggattttta tgtatgaatg atgaagattt attcttagct 840
gcaaaagaaa tagttgttgt ttatgaaggt atgccatctt atggtggact tgctggtaga 900
gatatggaag ctatggcaat agggttaaga gaatctttac aatatgaata cattagacat 960
agaattttac aagttagata cttaggagaa aaattaaaag aagctggtgt acctatactt 1020
gaaccagttg gaggacatgc tgtattccta gatgctagaa gattctgtcc tcatatccca 1080
caagaagaat tcccagctca agctcttgca gcagctatct atgttgaatg tggtgtaaga 1140
actatggaaa gaggaataat ttctgctggt agagatgtaa aaactggtga aaaccataaa 1200
cctaaactag aaactgttag agttactatt ccaagaagag tttatactta taaacatatg 1260
gatgtagtag cagaaggtat aatcaaatta tataaacata aagaagatat aaaaccatta 1320
gaatttgtat atgaaccaaa acaattaaga ttctttacag ctagatttgg aataaaaaaa 1380
taa 1383
<210>4
<211>460
<212>PRT
<213>unknown
<220>
<223> Artificial sequence
<400>4
Met Arg Phe Glu Asp Tyr Pro Ala Glu Pro Phe Arg Ile Lys Ser Val
1 5 10 15
Glu Thr Val Lys Met Ile Asp Lys Ala Ala Arg Glu Glu Val Ile Lys
20 25 30
Lys Ala Gly Tyr Asn Thr Phe Leu Ile Asn Ser Glu Asp Val Tyr Ile
35 40 45
Asp Leu Leu Thr Asp Ser Gly Thr Asn Ala Met Ser Asp Lys Gln Trp
50 55 60
Gly Gly Leu Met Gln Gly Asp Glu Ala Tyr Ala Gly Ser Arg Asn Phe
65 70 75 80
Phe His Leu Lys Glu Thr Val Lys Glu Ile Phe Gly Phe Lys His Ile
85 90 95
Val Pro Thr His Gln Gly Arg Gly Ala Glu Asn Ile Leu Ser Gln Ile
100 105 110
Ala Ile Lys Pro Gly Gln Tyr Val Pro Gly Asn Met Tyr Phe Thr Thr
115 120 125
Ile Arg Tyr His Gln Glu Arg Asn Gly Gly Ile Phe Lys Asp Ile Ile
130 135 140
Arg Asp Glu Ala His Asp Ala Thr Leu Asn Val Pro Phe Lys Gly Asp
145 150 155 160
Ile Asp Leu Asn Lys Leu Gln Lys Leu Ile Asp Glu Val Gly Ala Glu
165 170 175
Asn Ile Ala Tyr Val Cys Leu Ala Val Thr Val Asn Leu Ala Gly Gly
180 185 190
Gln Pro Val Ser Met Lys Asn Met Lys Ala Val Arg Glu Leu Thr Lys
195 200 205
Lys His Gly Ile Lys Val Phe Tyr Asp Ala Thr Arg Cys Val Glu Asn
210 215 220
Ala Tyr Phe Ile Lys Glu Gln Glu Glu Gly Tyr Gln Asp Lys Thr Ile
225 230 235 240
Lys Glu Ile Val His Glu Met Phe Ser Tyr Ala Asp Gly Cys Thr Met
245 250 255
Ser Gly Lys Lys Asp Cys Leu Val Asn Ile Gly Gly Phe Leu Cys Met
260 265 270
Asn Asp Glu Asp Leu Phe Leu Ala Ala Lys Glu Ile Val Val Val Tyr
275 280 285
Glu Gly Met Pro Ser Tyr Gly Gly Leu Ala Gly Arg Asp Met Glu Ala
290 295 300
Met Ala Ile Gly Leu Arg Glu Ser Leu Gln Tyr Glu Tyr Ile Arg His
305 310 315 320
Arg Ile Leu Gln Val Arg Tyr Leu Gly Glu Lys Leu Lys Glu Ala Gly
325 330 335
Val Pro Ile Leu Glu Pro Val Gly Gly His Ala Val Phe Leu Asp Ala
340 345 350
Arg Arg Phe Cys Pro His Ile Pro Gln Glu Glu Phe Pro Ala Gln Ala
355 360 365
Leu Ala Ala Ala Ile Tyr Val Glu Cys Gly Val Arg Thr Met Glu Arg
370 375 380
Gly Ile Ile Ser Ala Gly Arg Asp Val Lys Thr Gly Glu Asn His Lys
385 390 395 400
Pro Lys Leu Glu Thr Val Arg Val Thr Ile Pro Arg Arg Val Tyr Thr
405 410 415
Tyr Lys His Met Asp Val Val Ala Glu Gly Ile Ile Lys Leu Tyr Lys
420 425 430
His Lys Glu Asp Ile Lys Pro Leu Glu Phe Val Tyr Glu Pro Lys Gln
435 440 445
Leu Arg Phe Phe Thr Ala Arg Phe Gly Ile Lys Lys
450 455 460
Claims (5)
1. A coding gene of a mutant of fusobacterium nucleatum tyrosine phenol lyase is characterized in that the nucleotide sequence of the coding gene is shown in SEQ ID NO. 3.
2. A recombinant vector constructed from the coding gene of claim 1.
3. A recombinant genetically engineered bacterium transformed with the recombinant vector of claim 2.
4. The use of the mutant coding gene of F.nucleatum tyrosine phenol lyase described in claim 1 in the synthesis of levodopa.
5. The use of claim 4, wherein the use is characterized in that the wet thallus obtained by fermentation culture of recombinant genetic engineering bacteria containing coding genes of the mutant tyrosol lyase of fusobacterium nucleatum is used as a catalyst, catechol, sodium pyruvate and ammonium acetate are used as substrates, sodium sulfite and EDTA & Na are used as substrates2Taking pyridoxal phosphate as a coenzyme, taking a buffer solution with the pH value of 5.0 ~ 9.0.0 as a reaction medium to form a conversion system, carrying out conversion reaction at the temperature of 5 ~ 30 ℃, and after the reaction is finished, separating and purifying the reaction solution to obtain levodopa;
in the transformation system, at the beginning, catechol with a final concentration of 5 ~ 50g/L, sodium pyruvate with a final concentration of 5 ~ 50g/L, ammonium acetate with a final concentration of 5 ~ 100g/L, sodium sulfite with a final concentration of 0.5 ~ 10g/L, EDTA & Na2A final concentration of 0.5 ~ 10g/L was added, and pyridoxal phosphate was added to a final concentration of 0.05 ~ 5mM, and the using amount of wet thalli is 2 ~ 50 g/L;
in the conversion reaction process, pyrocatechol, sodium pyruvate and ammonium acetate are supplemented every 0.5 ~ 4 hours, wherein the pyrocatechol is supplemented by 0.1 ~ 10g/L, the sodium pyruvate is supplemented by 0.1 ~ 10g/L and the ammonium acetate is supplemented by 1 ~ 20 g/L;
the catalyst is prepared by the following method:
(1) slant culture, namely inoculating recombinant genetic engineering bacteria containing coding genes of the mutant of the fusobacterium nucleatum tyrosine phenol lyase to a slant culture medium containing 50 mu g/ml kanamycin, and culturing for 8 ~ 16h at 37 ℃ to obtain slant thalli, wherein the final mass concentration of the slant culture medium comprises 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 1.5 percent agar, deionized water as a solvent and the pH value is 7.0;
(2) seed culture, namely inoculating the slant thallus to a seed culture medium, and culturing for 8 ~ 10h at 37 ℃ to obtain a seed solution, wherein the final concentration of the seed culture medium comprises 10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride, 50 mu g/ml of kanamycin, deionized water as a solvent and the pH value of 7.0;
(3) fermenting and culturing, namely inoculating the seed solution into a sterile 5L mechanical stirring ventilation universal fermentation tank filled with 3L fermentation medium by the inoculation amount with the volume concentration of 3 percent, directly adding sterilized lactose with the final concentration of 15g/L into the fermentation tank for induction culture at 28 ℃, putting the fermentation tank after culturing for 6 ~ 8h, and collecting wet thalli, wherein the final concentration of the fermentation medium comprises 15g/L of peptone, 12g/L of yeast powder, 10g/L of NaCl, 15g/L of glycerol, (NH)4)2SO45g/L，KH2PO41.36g/L，K2HPO4·3H2O2.28g/L，MgSO4·7H2O0.375 g/L, deionized water as solvent, and natural pH.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611094369.9A CN106754846B (en) | 2016-12-02 | 2016-12-02 | Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611094369.9A CN106754846B (en) | 2016-12-02 | 2016-12-02 | Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754846A CN106754846A (en) | 2017-05-31 |
| CN106754846B true CN106754846B (en) | 2020-01-14 |
Family
ID=58882810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611094369.9A Active CN106754846B (en) | 2016-12-02 | 2016-12-02 | Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754846B (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107586797B (en) * | 2017-09-25 | 2020-06-09 | 长兴制药股份有限公司 | Method for preparing levodopa by one-pot enzyme method |
| CN108642130B (en) * | 2018-03-29 | 2021-10-15 | 浙江工业大学 | High-throughput screening method for high-activity strain of tyrosine phenol lyase |
| CN108715827B (en) * | 2018-06-08 | 2021-07-20 | 鲁东大学 | Extracellular expression of tyrosine phenol lyase and application thereof |
| CN109161568A (en) * | 2018-08-10 | 2019-01-08 | 浙江工业大学 | A method of improving levodopa product quality and yield |
| CN111793615B (en) * | 2019-04-07 | 2023-03-24 | 宁波酶赛生物工程有限公司 | Engineered polypeptides and their use in the synthesis of tyrosine or tyrosine derivatives |
| CN109897845B (en) * | 2019-04-18 | 2020-11-03 | 江南大学 | Escherichia coli expressing thermostable tyrosine phenol hydrolase and application thereof |
| CN110331153B (en) * | 2019-06-24 | 2021-04-30 | 浙江工业大学 | Kluyveromyces tyrosol lyase mutant and application thereof |
| CN110305805B (en) * | 2019-06-24 | 2021-07-13 | 浙江工业大学 | Recombinant pichia pastoris engineering bacteria and application thereof in synthesis of levodopa |
| CN110373421A (en) * | 2019-06-28 | 2019-10-25 | 浙江工业大学 | A kind of tyrosine phenol lyase gene recombination plasmid and application |
| CN110903998B (en) * | 2019-10-23 | 2021-09-21 | 上海市第十人民医院 | Intestinal tract separated fusobacterium nucleatum Wenzeri strain and application thereof |
| CN111411132A (en) * | 2020-05-14 | 2020-07-14 | 山东惠仕莱生物科技有限公司 | Conversion and extraction method for producing levodopa by enzyme method |
| CN114250237B (en) * | 2020-09-23 | 2024-05-03 | 浙江工业大学 | Tyrosine phenol lyase mutant, engineering bacterium and application thereof in catalytic synthesis of levodopa |
| CN113621548B (en) * | 2021-08-25 | 2023-11-24 | 上海交通大学 | Method for producing levodopa based on vibrio natrii |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047846A (en) * | 2013-03-22 | 2016-10-26 | 中国科学院生物物理研究所 | An 8-hydroxyquinoline alanine translation system and applications thereof |
-
2016
- 2016-12-02 CN CN201611094369.9A patent/CN106754846B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047846A (en) * | 2013-03-22 | 2016-10-26 | 中国科学院生物物理研究所 | An 8-hydroxyquinoline alanine translation system and applications thereof |
Non-Patent Citations (3)
| Title |
|---|
| 酪氨酸酚裂解酶WP_011015962;无;《NCBI GenBank数据库》;20150322 * |
| 酪氨酸酚裂解酶及其在L-酪氨酸酶法合成中的应用;韦平和等;《中国生化药物杂志》;20121231;第33卷(第5期);第695-697页 * |
| 重组酪氨酸酚裂解酶全细胞催化合成L-酪氨酸;常俊俊等;《精细化工》;20131031;第30卷(第10期);第1112-1116页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754846A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754846B (en) | Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, vector, engineering bacterium and application thereof | |
| CN108424900B (en) | Nitrilase mutant and construction method and application thereof | |
| CN108823179B (en) | Transaminase derived from actinomycetes, mutant, recombinant bacterium and application | |
| CN108660122B (en) | Transaminase, mutant and application of transaminase to production of L-glufosinate-ammonium | |
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| CN105296456B (en) | A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application | |
| US20240101974A1 (en) | D-amino acid oxidase mutants and uses thereof in preparing l-glufosinate | |
| CN110791493A (en) | Aspartate ammonia lyase mutant and application thereof | |
| CN112626057B (en) | Chimeric plant nitrilase mutant, coding gene and application thereof | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| CN108841844B (en) | Method for efficiently producing phenylpyruvic acid | |
| CN111748535B (en) | Alanine dehydrogenase mutant and application thereof in fermentation production of L-alanine | |
| CN111705030A (en) | Escherichia coli genetic engineering bacterium capable of producing L-homoserine with high yield, construction method and strain | |
| CN112746067B (en) | Lysine decarboxylase mutants for preparing D-ornithine | |
| CN108546697B (en) | Enzyme method for preparing beta alanine | |
| CN111808829B (en) | Gamma-glutamyl methylamine synthetase mutant and application thereof | |
| CN113462666A (en) | Carbonyl reductase mutant and construction method and application thereof | |
| CN110872593B (en) | Serine hydroxymethyl transferase mutant and application thereof | |
| CN107988131B (en) | Method for high-yield production of α -ketone-gamma-methylthiobutyric acid | |
| CN113621592B (en) | Transaminase mutant and coding gene and application thereof | |
| CN115896081A (en) | Aspartase mutant and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN113789307A (en) | Pantothenate synthetase mutant, encoding gene, vector and application | |
| CN114250237B (en) | Tyrosine phenol lyase mutant, engineering bacterium and application thereof in catalytic synthesis of levodopa | |
| KR20170030824A (en) | Gene encoding lysine decarboxylase derived from H. alvei, recombinant vector, host cell and method for producing cadaverine using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |