CN110373421A - A kind of tyrosine phenol lyase gene recombination plasmid and application - Google Patents

A kind of tyrosine phenol lyase gene recombination plasmid and application Download PDF

Info

Publication number
CN110373421A
CN110373421A CN201910571335.1A CN201910571335A CN110373421A CN 110373421 A CN110373421 A CN 110373421A CN 201910571335 A CN201910571335 A CN 201910571335A CN 110373421 A CN110373421 A CN 110373421A
Authority
CN
China
Prior art keywords
plasmid
tpl
tyrosine phenol
phenol lyase
kanr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910571335.1A
Other languages
Chinese (zh)
Inventor
郑仁朝
汤晓玲
郑裕国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University of Technology ZJUT
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN201910571335.1A priority Critical patent/CN110373421A/en
Publication of CN110373421A publication Critical patent/CN110373421A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/99—Other Carbon-Carbon Lyases (1.4.99)
    • C12Y401/99002—Tyrosine phenol-lyase (4.1.99.2)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a kind of tyrosine phenol lyase gene recombination plasmid and applications, cer locus is inserted on the plasmid of resistant gene containing kanamycin by the present invention on plasmid, when that antibiotic of card is not added, under cer effect, after fermentation 20-48h, plasmid stability maintains 60%-90%, and Fn-TPL volume enzyme activity reaches 10000-12000U/L.The present invention is in resistant gene containing kanamycin and cer1 locus, when having added kanamycins, ferments after 20-48h, plasmid stability is maintained 100%, Fn-TPL volume enzyme activity and reaches 12000-15000U/L.

Description

A kind of tyrosine phenol lyase gene recombination plasmid and application
(1) technical field
The present invention relates to a kind of tyrosine phenol lyase gene recombination plasmid and applications.
(2) background technique
Tyrosine phenol lyase (tyrosine phenol lyase, TPL, E.C.4.1.99.2) also known as β-tyrosine Enzyme is a kind of phosphopyridoxal pyridoxal phosphate (pyridoxal-5 '-phosphate, PLP) dependent form enzyme, and catalysis l-tyrosine is cracked to form Phenol, pyruvic acid and ammonia.This reaction is reversible reaction, if substituting phenol with catechol, it is left-handed which can inversely be catalyzed generation DOPA.TPL catalyzes and synthesizes that levodopa Atom economy is high, reaction condition is mild, environmental-friendly.
For the target product for obtaining high expression quantity, foreign gene imports host cell carry out table after being frequently connected to plasmid It reaches.This laboratory successfully constructs composing type Fusobacterium nucleatum (Fusobacterium nucleatum) TPL (Fn-TPL) large intestine It is left-handed to be catalyzed catechol, Sodium Pyruvate and ammonium one-step synthesis using recombination bacillus coli as catalyst for bacillus expression system DOPA.High density fermentation is the essential industry means for obtaining high recombination bacillus coli biomass and TPL enzyme activity, general using in batches Feed profile carries out, and during the fermentation, plasmid stabilisation sexual factor seriously affects producing enzyme.On the one hand, plasmid and its expression Albumen, which grows recombinant bacterium, constitutes burden, on the other hand, after cell grows into stationary phase, Toxic Metabolites and purpose product Start to accumulate, adverse circumstance pressure is generated to thalli growth, activated cell is removed to the Stress responses of internal exogenous plasmid, so as to cause The reduction or loss of plasmid.Plasmid stability is kept to have very important significance in fermenting and producing.
(3) summary of the invention
It is an object of the present invention to provide a kind of tyrosine phenol lyase gene recombination plasmid and its improving tyrosine phenols cracking Card is received mycin resistant gene and cer locus is connected on plasmid, to reach raising plasmid stability by the application in enzyme enzyme activity Purpose, improve E.coli BL21 (DE3) host cell plasmid stability, increase tyrosine phenol lyase (Fn-TPL) production Amount, not only contributes to the fermenting and producing of recombinant bacterium, can more reduce the use of antibiotic, reduce the cost, and avoids generating environment Pollution.
The technical solution adopted by the present invention is that:
The present invention provides a kind of tyrosine phenol lyase gene recombination plasmid, and the recombinant plasmid is by kalamycin resistance Gene (KanR), cer gene and tyrosine phenol lyase gene import carrier acquisition jointly；The kalamycin resistance gene (KanR) nucleotide sequence is as shown in SEQ ID NO.1, and the cer gene nucleotide series are as shown in SEQ ID NO.2.
Further, the carrier is constitutive expression plasmid pET-3a.
Further, the tyrosine phenol lyase gene Fn-TPL nucleotides sequence is classified as shown in SEQ ID NO.3.
Tyrosine phenol lyase gene recombination plasmid of the present invention constructs as follows: by tyrosine phenol lyase base Because Fn-TPL is connect with linearization plasmid pET-3a, plasmid pET-3a-Fn-TPL is obtained；Again by kalamycin resistance gene (KanR) it is connect with linearization plasmid pET-3a-Fn-TPL, obtains plasmid pET-3a-KanR-Fn-TPL；Finally by cer gene It is connect with linearization plasmid pET-3a-KanR-Fn-TPL, obtains recombinant plasmid pET-3a-KanR-cer-Fn-TPL.
The present invention also provides a kind of genetic engineering bacterium of tyrosine phenol lyase gene recombination plasmid building, the works Journey bacterium is that host is built-up with E. coli BL21 (DE3).
The present invention provides a kind of tyrosine phenol lyase gene recombination plasmid and is improving tyrosine phenol lyase yield In application, specific the method are as follows: (1) engineering bacteria that tyrosine phenol lyase gene recombination plasmid constructs is seeded to and is contained On the LB plate of 100 μ g/mL kanamycins, 37 DEG C of culture 15h obtain activation thallus；
(2) it chooses single colonie on plate and is inoculated in the LB culture medium that 50mL contains 100 μ g/mL kanamycins, 37 DEG C, 180rpm training 8h is supported, it is spare as seed liquor；
(3) 50mL seed liquor is inoculated into the fermentation of the 5L equipped with 2.5L fermentation medium by the inoculum concentration of volumetric concentration 2% In tank, speed of agitator 300rpm, ventilatory capacity 5m3/ h (ventilation ratio is about 2vvm), pH control are 5.5,37 DEG C of cultures in 0~10h, 32 DEG C of cultures after 10h, when dissolved oxygen is greater than 5%, control dissolved oxygen is 4-6%, carries out fermentation training by the feed process of DO-STAT It supports, obtains the fermentation liquid containing tyrosine phenol lyase；The fermentation medium composition: glycerol 2.3g/L, peptone 20g/L, ferment Female powder 5g/L, sodium chloride 0.5g/L, potassium chloride 0.186g/L, magnesium sulfate 1.026g/L, ammonium sulfate 5g/L, potassium dihydrogen phosphate 10.2g/L, PLP 7.5mg/L, microelement 1.5mL/L, solvent are water；The trace element suite becomes: FeSO4·7H2O 2.8g/L, MnCl2·4H2O 2g/L, CoSO4·7H2O 2.8g/L, CaCl2·2H2O 1.5g/L, CuCl2·2H2O 0.2g/ L, ZnSO4·7H2O 0.3g/L is dissolved in 1mol/L HCl；The supplemented medium composition are as follows: glycerol 110g/L, remaining ingredient For twice of fermentation medium concentration.
The LB culture medium composition are as follows: yeast powder 5g/L, peptone 10g/L, NaCl 10g/L, solvent are water, and pH value is certainly So.
Compared with prior art, beneficial effect of the present invention is mainly reflected in:
The present invention is directed to the initial plasmid pET-3a (having ammonia benzyl mycin resistant gene) (Fig. 1) containing Fn-TPL gene, It is anti-to be inserted into kalamycin resistance gene replacement ammonia benzyl mycin on plasmid for the problem of plasmid is all lost after fermentation reaches 16h Property gene (Fig. 2), increase plasmid stability, ferment 20-48h after plasmid can still keep 20%-50%, Fn-TPL volume enzyme activity Reach 6000-9000U/L.
Cer locus is inserted on the plasmid of resistant gene containing kanamycin (Fig. 3) on plasmid by the present invention, not In the case of Jia Kana antibiotic, under cer effect, ferment after 20-48h, plasmid stability maintains 60%-90%, Fn-TPL Volume enzyme activity reaches 10000-12000U/L.
The present invention is in resistant gene containing kanamycin and cer1 locus, and when having added kanamycins, ferment 20- After 48h, plasmid stability is maintained 100%, Fn-TPL volume enzyme activity and reaches 12000-15000U/L.
(4) Detailed description of the invention
Fig. 1 pET-3a-Fn-TPL plasmid construct schematic diagram.
Fig. 2 pET-3a-Fn-TPL plasmid construct schematic diagram.
Fig. 3 pET-3a-KanR-cer-Fn-TPL plasmid construct schematic diagram.
(5) specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:
The building of 1 Fn-TPL constitutive expression system of embodiment and recombination bacillus coli
Fusobacterium nucleatum (F.nucleatum subsp.CGMCC 1.2526, purchased from China is extracted with DNA extraction kit Research for Industrial Microbial Germ preservation administrative center) complete genome DNA, using the DNA as template, primer TUWith primer TDDraw for effect Object carries out pcr amplification reaction.PCR reaction system each component additional amount (50 μ L of total volume): 5 × Prime STARTM HS DNA Polymerase Buffer 10 μ L, 10mM dNTP mixture (each 2.5mM of dATP, dCTP, dGTP and dTTP) 4 μ L, concentration For 50 μM of primer TU, primer TD0.5 μ L of each 1 μ L, 1 μ L, Prime STARTM HS DNA polymerase of genomic DNA, Seedless 32.5 μ L of sour water.PCR reaction condition are as follows: 95 DEG C of 5min of initial denaturation, subsequently into 95 DEG C of 30s of temperature cycles, 56 DEG C of 30s, 72 DEG C of 90s, totally 30 circulations, last 72 DEG C of extensions 5min, final temperature are 4 DEG C.PCR product uses Clean Up kit PCR product is recycled, and Fn-TPL target gene fragment is obtained, and nucleotides sequence is classified as shown in SEQ ID NO.3.
By constitutive expression plasmid pET-3a (purchased from Feng Hui biology), with primer PUWith primer PDLine is carried out by PCR amplification Property, PCR product uses I restriction enzyme enzymatic treatment 2h of Dpn, then using Clean Up kit recycling PCR product, as Linearization plasmid pET-3a.By one-step cloning kit (II) by Fn-TPL target gene fragment and linearly Change plasmid pET-3a to be attached, obtain plasmid pET-3a-Fn-TPL, it is big to obtain recombination for conversion to E.coil BL21 (DE3) Enterobacteria E.coil BL21 (DE3) (pET-3a-Fn-TPL).
Primer TU: 5 ' GTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG 3 '；
Primer TD: 5 ' GGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAG 3 '.
Primer PU: 5 ' TTAAACAAAATTATTTCTAGAGGGAAACCGTTGTGG3 '；
Primer PD: 5 ' CACCACCACCACTGAGATCCGGCTGCTAACAAAGCC3 '.
2 that resistant gene of pET-3a-Fn-TPL card of embodiment replaces the building of ampicillin resistance and recombination bacillus coli
Using the pET-28b plasmid (purchased from Feng Hui biology) of resistant gene containing kanamycin as template, using primer KU With primer KDIt carries out PCR amplification (amplification system and condition are with embodiment 1), both ends is obtained from template plasmid and carry the same of 15bp The kalamycin resistance gene (KanR) of source arm genetic fragment, nucleotide sequence (do not include homologous as shown in SEQ IDNO.1 Arm).
Using pET-3a-Fn-TPL plasmid constructed by embodiment 1 as template, pass through primer P 'UWith primer P 'DCarry out PCR expansion Increase (amplification system and condition are with embodiment 1), pET-3a-Fn-TPL is linearized, while removing AmpR gene, PCR product makes With I restriction enzyme enzymatic treatment 2h of Dpn, PCR product then is recycled using Clean Up kit, obtains linearization plasmid pET- 3a-Fn-TPL (contains 15bp homology arm genetic fragment identical with KanR gene both ends).
By one-step cloning kit (II) by the kalamycin resistance gene expanded and linearisation Plasmid pET-3a-Fn-TPL is attached, and obtains plasmid pET-3a-KanR-Fn-TPL, and conversion to E.coil BL21 (DE3) obtains It obtains recombination bacillus coli E.coil BL21 (DE3) (pET-3a-KanR-Fn-TPL).
Primer KU: 5 ' AACTTGGTCTGACAGTTAGAAAAACTCATCGAGCAT3 '；
Primer KD: 5 ' TGAAAAAGGAAGAGTATGAGCCATATTCAACGGGAA3 '.
Primer P 'U: 5 ' TTGAATATGGCTCATACTCTTCCTTTTTCAATATTA3 '；
Primer P 'D: GATGAGTTTTTCTAACTGTCAGACCAAGTTTACTCA.
The insertion of cer locus and the building of recombination bacillus coli in embodiment 3pET-3a-KanR-Fn-TPL plasmid
Cer locus sequence is as shown in SEQ ID NO.2, and by Beijing, Qing Ke company is synthesized.Constructed by embodiment 2 PET-3a-KanR-Fn-TPL plasmid is template, passes through primer P "U-Cer1 and primer P "D-Cer1 carries out PCR amplification (amplification body System and condition are with embodiment 1), pET-3a-KanR-Fn-TPL is linearized.PCR product uses I restriction enzyme enzymatic treatment of Dpn Then 2h recycles PCR product using Clean Up kit.By one-step cloning kit (II) by cer Locus sequence and linearisation pET-3a-KanR-Fn-TPL are attached, and are obtained pET-3a-KanR-cer-Fn-TPL and are recombinated matter Grain, and convert to E. coli BL21 (DE3), obtain recombination bacillus coli E.coliBL21 (DE3) (pET-3a- KanR-cer-Fn-TPL)。
Primer P "U-Cer1:5 ' CCTCGTAGCCATCGAGTCTTCAAGAATTCTCATGTT3 '；
Primer P "D-Cer1:5 ' TTCCTGTATTTCCGGGAAAGGGCCTCGTGATACGCC3 '.
4 recombination bacillus coli fermentation process plasmid stability of embodiment and enzyme activity test
1, activation culture: 1 recombination bacillus coli E.coil BL21 (DE3) (pET-3a-Fn-TPL) of embodiment is seeded to On LB plate containing 100 μ g/mL ammonia benzyl mycins, 37 DEG C of culture 15h obtain activation thallus；
2, seed liquor prepare: choose single colonie on plate be inoculated in 50mL contain 100 μ g/mL ammonia benzyl mycins LB culture medium, 37 DEG C, 180rpm cultivate 8h, it is spare as seed liquor.
3,5L fermented and cultured: first fermentor progress sky is disappeared (121 DEG C, 20min), is added after fermentor tank body is cooling 2.5L fermentation medium, then carry out real elimination bacterium (115 DEG C, 30min).PH electrode, molten is installed according to explanation after the completion of sterilizing Oxygen electrode, temperature electrode, the attachmentes such as stirring rotator, connect condensate line and aeration equipment, are cooled to 37 DEG C.
The batch feeding stage: 50mL seed liquor is inoculated into equipped with 2.5L fermented and cultured by the inoculum concentration of volumetric concentration 2% In the 5L fermentor of base (during switching, upper pyrosphere, the alcohol swab that addition is soaked with alcohol in pyrosphere, point are covered in injection port Combustion opens injection port, pours into the seed liquor in shaking flask, screws injection port, extinguishes pyrosphere), speed of agitator 300rpm, ventilatory capacity 5m3/ h (ventilation ratio is about 2vvm), pH control are 5.5, with 30% ammonium hydroxide and 45% phosphorus acid for adjusting pH value.37 DEG C within 0~10h It cultivates, 32 DEG C of cultures after 10h, by dissolved oxygen control 5%, passes through DO-STAT method feed supplement and carry out fermented and cultured 40h.Feed supplement training Support base composition are as follows: glycerol 110g/L, remaining ingredient are that fermentation medium is concentrated twice.
Fermentation medium composition: glycerol 2.3g/L, peptone 20g/L, yeast powder 5g/L, sodium chloride 0.5g/L, potassium chloride 0.186g/L, magnesium sulfate 1.026g/L, ammonium sulfate 5g/L, potassium dihydrogen phosphate 10.2g/L, PLP 7.5mg/L, microelement 1.5mL/L, solvent are water；The trace element suite becomes: FeSO4·7H2O 2.8g/L, MnCl2·4H2O 2g/L, CoSO4· 7H2O 2.8g/L, CaCl2·2H2O 1.5g/L, CuCl2·2H2O 0.2g/L, ZnSO4·7H2O 0.3g/L, is dissolved in 1mol/L In HCl.
4, plasmid stability is measured using replica plating: after fermentation liquid is diluted with distilled water, is inoculated in the training of LB plate It supports on base, after 37 DEG C of cultures for 24 hours, wherein 100 bacterium colonies copy to the LB plate of the ammonia benzyl mycin containing 100 μ g/mL to picking On culture medium, then 37 DEG C of culture 48h, reading bacterium colony and forming number/100 is as a result to see containing percentage shared by plasmid cell Table 1- table 4.
The fermented and cultured of 2 recombination bacillus coli E.coil BL21 (DE3) (pET-3a-KanR-Fn-TPL) of embodiment be by 100 μ g/mL ammonia benzyl mycins in steps 1 and 2 and 4 are changed to 100 μ g/mL kanamycins；3 recombination bacillus coli of embodiment The fermented and cultured of E.coliBL21 (DE3) (pET-3a-KanR-cer-Fn-TPL) is by 100 μ g/mL ammonia in steps 1 and 2 and 4 Benzyl mycin is changed to delete or 100 μ g/mL kanamycins, other operations are identical.
5, enzyme activity determination: using recombination bacillus coli fermentation wet thallus as synthesis L-DOPA catalyst, by measure by The ability of Sodium Pyruvate, catechol and ammonia Synthesis L-DOPA evaluates the vigor of Fn-TPL, specifically: take respectively- The wet thallus of 20 DEG C of stored frozens is added in 10mL enzyme activity reaction solution with final concentration 2.5g/L, is reacted in 15 DEG C, 150rpm 10mL 1M HCL is added after reaction and terminates reaction, centrifugation, dilution, the concentration through HPLC detection L-DOPA by 30min.Enzyme activity Is defined as: under the above reaction condition, enzyme amount needed for generating 1 μm of oL L-DOPA per minute is an enzyme-activity unit U.
Enzyme activity reaction solution composition: contain 8g/L Sodium Pyruvate, 5g/L neighbour's benzene in 8.0 solution of Tris-HCL of 10mL 50mM Diphenol, 34.7g/L ammonium chloride, 1mM PLP, 1g/L Na2SO3With 2g/L EDTA-2Na, pH to 8.0 is adjusted with ammonium hydroxide.
HPLC testing conditions: column temperature is 34 DEG C；Flow velocity is 1mL/min；Detection wavelength is UV 280nm；Sample volume is 10 μ L；Analysis time is 20min.
(1) after recombinant bacterium E.coil BL21 (DE3) (pET-3a-Fn-TPL) fermentation to 16h, plasmid retention is 0 (table 1), TPL volume enzyme activity reaches 4000-5000U/L.
The assessment of 1 embodiment of table, 1 recombination bacillus coli fermentation process plasmid stability
(2) after recombination bacillus coli E.coil BL21 (DE3) (pET-3a-KanR-Fn-TPL) fermentation to 28h, plasmid is residual Remaining is 20% (table 2), and TPL volume enzyme activity reaches 6000-9000U/L.
The assessment of 2 embodiment of table, 2 recombination bacillus coli fermentation process plasmid stability
(3) recombination bacillus coli E.coliBL21 (DE3) (pET-3a-KanR-cer-Fn-TPL) is acted in cer locus Under, after kanamycins fermentation to 32h is not added, plasmid remnants are 60% or more (table 3), and TPL volume enzyme activity reaches 10000- 12000U/L。
The assessment of kanamycins fermentation process plasmid stability is not added in 3 embodiment of table, 3 recombination bacillus coli
(4) recombination bacillus coli E.coliBL21 (DE3) (pET-3a-KanR-cer-Fn-TPL) is acted in cer locus Under, after addition kanamycins fermentation to 35h, plasmid stability remains at 100% (table 4), and TPL volume enzyme activity reaches 12000- 15000U/L。
4 embodiment of table, 3 recombination bacillus coli fermentation process plasmid stability under kanamycins effect is assessed
Conclusion: plasmid stability during recombination bacillus coli fed batch fermentation is studied.And it is anti-by blocking that Property as screening pressure, cer locus insertion and block that resistance and cer locus collective effect in the case of these three and improve The plasmid stability of recombination bacillus coli.The finally recombination bacillus coli matter under that resistance of card and the collective effect of cer locus Grain stability can achieve 100%.
Sequence table
<110>Zhejiang Polytechnical University
<120>a kind of tyrosine phenol lyase gene recombination plasmid and application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 816
<212> DNA
<213>unknown (Unknown)
<400> 1
ttagaaaaac tcatcgagca tcaaatgaaa ctgcaattta ttcatatcag gattatcaat 60
accatatttt tgaaaaagcc gtttctgtaa tgaaggagaa aactcaccga ggcagttcca 120
taggatggca agatcctggt atcggtctgc gattccgact cgtccaacat caatacaacc 180
tattaatttc ccctcgtcaa aaataaggtt atcaagtgag aaatcaccat gagtgacgac 240
tgaatccggt gagaatggca aaagtttatg catttctttc cagacttgtt caacaggcca 300
gccattacgc tcgtcatcaa aatcactcgc atcaaccaaa ccgttattca ttcgtgattg 360
cgcctgagcg agacgaaata cgcgatcgct gttaaaagga caattacaaa caggaatcga 420
atgcaaccgg cgcaggaaca ctgccagcgc atcaacaata ttttcacctg aatcaggata 480
ttcttctaat acctggaatg ctgttttccc ggggatcgca gtggtgagta accatgcatc 540
atcaggagta cggataaaat gcttgatggt cggaagaggc ataaattccg tcagccagtt 600
tagtctgacc atctcatctg taacatcatt ggcaacgcta cctttgccat gtttcagaaa 660
caactctggc gcatcgggct tcccatacaa tcgatagatt gtcgcacctg attgcccgac 720
attatcgcga gcccatttat acccatataa atcagcatcc atgttggaat ttaatcgcgg 780
cctagagcaa gacgtttccc gttgaatatg gctcat 816
<210> 2
<211> 284
<212> DNA
<213>unknown (Unknown)
<400> 2
ccggaaatac aggaacgcac gctggatggc ccttcgctgg gatggtgaaa ccatgaaaaa 60
tggcagcttc agtggattaa gtgggggtaa tgtggcctgt accctctggt tgcataggta 120
ttcatacggt taaaatttat caggcgcgat cgcggcagtt tttcgggtgg tttgttgcca 180
tttttacctg tctgctgccg tgatcgcgct gaacgcgttt tagcggtgcg tacaattaag 240
ggattatggt aaatccactt actgtctgcc ctcgtagcca tcga 284
<210> 3
<211> 1383
<212> DNA
<213>unknown (Unknown)
<400> 3
atgagatttg aagattatcc agcagagcca tttagaatta aaagtgtaga aactgttaaa 60
atgattgata aggcagcaag agaagaagta attaaaaaag caggatataa tactttctta 120
attaactctg aagatgttta cattgattta ttaactgata gtggaactaa tgctatgagt 180
gataaacaat ggggtggatt aatgcaaggt gatgaagctt atgcaggaag tagaaatttc 240
ttccacttag aaaaaactgt aaaagaaata tttgggttta aacatatagt tcctactcac 300
caaggaagag gagcagaaaa tattttatct caaatagcta taaaacctgg acaatatgtt 360
cctggaaata tgtattttac aactattaga tatcaccaag aaagaaatgg tggaatattt 420
aaagatatta tcagagatga ggcacatgat gctactctta atgttccttt caaaggagat 480
attgacttaa ataaattaca aaaattaata gatgaagttg gagcagaaaa cattgcttat 540
gtttgtttag ctgtaactgt aaaccttgct ggtggacaac cagtttctat gaaaaatatg 600
aaagcagtta gagaactaac taaaaaacat ggaataaaag ttttctatga tgcaactaga 660
tgtgttgaaa atgcttactt cattaaagaa caagaagaag gatatcaaga taaaactata 720
aaggaaatag tgcatgaaat gtttagctat gctgatggat gtactatgag tggtaaaaaa 780
gattgtcttg ttaatatagg tggattttta tgtatgaatg atgaagattt attcttagct 840
gcaaaagaaa tagttgttgt ttatgaaggt atgccatctt atggtggact tgctggtaga 900
gatatggaag ctatggcaat agggttaaga gaatctttac aatatgaata cattagacat 960
agaattttac aagttagata cttaggagaa aaattaaaag aagctggtgt acctatactt 1020
gaaccagttg gaggacatgc tgtattccta gatgctagaa gattctgtcc tcatatccca 1080
caagaagaat tcccagctca agctcttgca gcagctatct atgttgaatg tggtgtaaga 1140
actatggaaa gaggaataat ttctgctggt agagatgtaa aaactggtga aaaccataaa 1200
cctaaactag aaactgttag agttactatt ccaagaagag tttatactta taaacatatg 1260
gatgtagtag cagaaggtat aatcaaatta tataaacata aagaagatat aaaaccatta 1320
gaatttgtat atgaaccaaa acaattaaga ttctttacag ctagatttgg aataaaaaaa 1380
taa 1383

Claims (8)

1. a kind of tyrosine phenol lyase gene recombination plasmid, it is characterised in that the recombinant plasmid is by kalamycin resistance base Because KanR, cer gene and tyrosine phenol lyase gene import carrier acquisition jointly；The kalamycin resistance gene KanR Nucleotide sequence is as shown in SEQ NO.1, and the cer gene nucleotide series are as shown in SEQ ID NO.2.
2. tyrosine phenol lyase gene recombination plasmid as described in claim 1, it is characterised in that the carrier is composing type table Up to plasmid pET-3a.
3. tyrosine phenol lyase gene recombination plasmid as described in claim 1, it is characterised in that the tyrosine phenol lyase Gene Fn-TPL nucleotides sequence is classified as shown in SEQ ID NO.3.
4. the construction method of tyrosine phenol lyase gene recombination plasmid described in a kind of claim 1, it is characterised in that the side Method are as follows: tyrosine phenol lyase gene Fn-TPL is connect with linearization plasmid pET-3a, obtains plasmid pET-3a-Fn-TPL； Kalamycin resistance gene KanR is connect with linearization plasmid pET-3a-Fn-TPL again, obtains plasmid pET-3a-KanR-Fn- TPL；Cer gene is connect with linearization plasmid pET-3a-KanR-Fn-TPL finally, obtains recombinant plasmid pET-3a-KanR- cer-Fn-TPL。
5. a kind of genetic engineering bacterium of the building of tyrosine phenol lyase gene recombination plasmid described in claim 1.
6. engineering bacteria as claimed in claim 5, it is characterised in that the engineering bacteria is with E. coli BL21 (DE3) Host is built-up.
7. tyrosine phenol lyase gene recombination plasmid described in a kind of claim 1 is in improving tyrosine phenol lyase yield Using.
8. the use as claimed in claim 7, it is characterised in that the application method are as follows:
(1) engineering bacteria that tyrosine phenol lyase gene recombination plasmid constructs the LB containing 100 μ g/mL kanamycins is seeded to put down On plate, 37 DEG C of culture 15h obtain activation thallus；
(2) it chooses single colonie on plate and is inoculated in the LB culture medium that 50mL contains 100 μ g/mL kanamycins, 37 DEG C, 180rpm culture 8h, as seed liquor；
(3) 50mL seed liquor is inoculated into the 5L fermentor equipped with 2.5L fermentation medium by the inoculum concentration of volumetric concentration 2%, Speed of agitator 300rpm, ventilatory capacity 5m3/ h, pH control are 5.5,37 DEG C of cultures in 0~10h, 32 DEG C of cultures after 10h, when molten When oxygen is greater than 5%, control dissolved oxygen is 4-6%, carries out fermented and cultured by the feed process of DO-STAT, obtains phenol containing tyrosine The fermentation liquid of lyases；The fermentation medium composition: glycerol 2.3g/L, peptone 20g/L, yeast powder 5g/L, sodium chloride 0.5g/L, potassium chloride 0.186g/L, magnesium sulfate 1.026g/L, ammonium sulfate 5g/L, potassium dihydrogen phosphate 10.2g/L, phosphopyridoxal pyridoxal phosphate 7.5mg/L, microelement 1.5mL/L, solvent are water；The trace element suite becomes: FeSO4·7H2O 2.8g/L, MnCl2· 4H2O 2g/L, CoSO4·7H2O 2.8g/L, CaCl2·2H2O 1.5g/L, CuCl2·2H2O 0.2g/L, ZnSO4·7H2O 0.3g/L is dissolved in 1mol/L HCl；The supplemented medium composition are as follows: glycerol 110g/L, remaining ingredient are fermentation medium Twice of concentration.
CN201910571335.1A 2019-06-28 2019-06-28 A kind of tyrosine phenol lyase gene recombination plasmid and application Pending CN110373421A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910571335.1A CN110373421A (en) 2019-06-28 2019-06-28 A kind of tyrosine phenol lyase gene recombination plasmid and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910571335.1A CN110373421A (en) 2019-06-28 2019-06-28 A kind of tyrosine phenol lyase gene recombination plasmid and application

Publications (1)

Publication Number Publication Date
CN110373421A true CN110373421A (en) 2019-10-25

Family

ID=68251103

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910571335.1A Pending CN110373421A (en) 2019-06-28 2019-06-28 A kind of tyrosine phenol lyase gene recombination plasmid and application

Country Status (1)

Country Link
CN (1) CN110373421A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117568348A (en) * 2024-01-15 2024-02-20 苏州左旋星生物科技有限公司 Gene for maintaining monomer supercoiled poly-A plasmid and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007035323A1 (en) * 2005-09-16 2007-03-29 Monsanto Technology Llc Hybrid portable origin of replication plasmids
CN106754846A (en) * 2016-12-02 2017-05-31 浙江工业大学 A kind of Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, carrier, engineering bacteria and its application
CN108715827A (en) * 2018-06-08 2018-10-30 鲁东大学 The extracellular expression of tyrosine phenol lyase and its application
CN109439604A (en) * 2018-05-14 2019-03-08 浙江工业大学 The engineering bacteria and its construction method of raising tyrosine phenol lyase stability and application

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007035323A1 (en) * 2005-09-16 2007-03-29 Monsanto Technology Llc Hybrid portable origin of replication plasmids
CN106754846A (en) * 2016-12-02 2017-05-31 浙江工业大学 A kind of Fusobacterium nucleatum tyrosine phenol lyase mutant, gene, carrier, engineering bacteria and its application
CN109439604A (en) * 2018-05-14 2019-03-08 浙江工业大学 The engineering bacteria and its construction method of raising tyrosine phenol lyase stability and application
CN108715827A (en) * 2018-06-08 2018-10-30 鲁东大学 The extracellular expression of tyrosine phenol lyase and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TANG XL 等: "Statistical medium optimization and DO-STAT fed-batch fermentation for enhanced production of tyrosine phenol lyase in recombinant Escherichia coli", 《PREPARATIVE BIOCHEMISTRY AND BIOTECHNOLOGY》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117568348A (en) * 2024-01-15 2024-02-20 苏州左旋星生物科技有限公司 Gene for maintaining monomer supercoiled poly-A plasmid and application thereof
CN117568348B (en) * 2024-01-15 2024-04-16 苏州左旋星生物科技有限公司 Gene for maintaining monomer supercoiled poly-A plasmid and application thereof

Similar Documents

Publication Publication Date Title
Minnan et al. Isolation and characterization of a high H2-producing strain Klebsiella oxytoca HP1 from a hot spring
CN108913642B (en) Escherichia coli genetic engineering bacteria and application thereof in synchronous production of L-tryptophan and L-valine through fermentation
CN112522223B (en) Genetically engineered bacterium for producing L-sarcosine and construction method and application thereof
CN107022515A (en) One plant of genetic engineering bacterium and its construction method and application using ligno-cellulose hydrolysate anaerobic fermentation production L aspartic acids
CN105051181B (en) The preparation method of the increased recombinant microorganism of the generative capacity of 2,3-butanediol and the 2,3-butanediol using it
CN109652434B (en) Recombinant bacterium for producing succinic acid by using glycerol as substrate and construction method and application thereof
US7354751B2 (en) Alcohol dehydrogenase gene of acetic acid bacterium
CN114874959A (en) Genetically engineered bacterium for producing L-theanine by using glucose from head fermentation, method and application
CN110373421A (en) A kind of tyrosine phenol lyase gene recombination plasmid and application
BR112016018193B1 (en) MODIFIED MICROORGANISM, SUCCINIC ACID PRODUCTION METHOD AND USE OF A MODIFIED MICROORGANISM
CN107299074B (en) Construction method and application of formate dehydrogenase engineering strain
CN113684163B (en) Genetically engineered bacterium for improving lactoyl-N-tetraose yield and production method thereof
CN110499259B (en) Yarrowia lipolytica YW100-1 and application thereof
WO2015154209A1 (en) Bacterial strain capable of producing a large amount of l-alanine and being tolerant to tap water and construction method thereof
CN113956992A (en) L-homoserine-tolerant escherichia coli and application thereof
WO2003078635A1 (en) Gene participating in acetic acid tolerance, acetic acid bacterium bred using the gene, and process for producing vinegar with the use of the acetic acid bacterium
CN113604413B (en) Recombinant strain, preparation method and application
KR102602060B1 (en) Recombinant microorganism for producing 2,3-butanediol with reduced by-product production and method for producing 2,3-butanediol using the same
EP1580267B1 (en) Gene improving temperature-tolerance of acetic acid bacterium, acetic acid bacterium bred using the gene and process for producing vinegar using the acetic acid bacterium
CN111334445B (en) Long-chain dicarboxylic acid producing strain and preparation method and application thereof
CN114456964B (en) Recombinant yarrowia lipolytica for high yield of stigmasterol, construction method thereof, fermentation medium for producing stigmasterol and application
CN114149955B (en) Genetically engineered bacterium for efficiently producing glycerol and construction method and application thereof
CN111705027B (en) Method for producing acetoin by microbial fermentation
CN106636251B (en) Method for high yield of D-ribose by using bacillus subtilis engineering bacteria
CN117965484A (en) Construction method and application of engineering escherichia coli for efficiently synthesizing lactoyl-N-fucosyl pentasaccharide-V

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20191025