CN118256528A - Method for preparing dipsacus root saponin VI outside plant body - Google Patents

Abstract

The invention discloses a method for preparing dipsacus root saponin VI outside a plant body, which prepares dipsacus root saponin VI by using a dipsacus root glucosyltransferase DaUGT gene. Belongs to the field of biotechnology. The invention takes HN saponin F and uridine diphosphate-glucose as raw materials, and carries out glycosylation reaction on the glucose radical on the C-28 position of HN saponin F under the catalysis of the teasel root glucose transferase obtained by encoding the teasel root glucose transferase DaUGT gene to generate teasel root saponin VI. The gene DaUGT120,120 separated and identified from dipsacus root can lay a foundation for the industrialized production of triterpenoid saponins such as dipsacus root saponin VI.

Description

Method for preparing dipsacus root saponin VI outside plant body

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for preparing dipsacus root saponin VI outside a plant body, a dipsacus root glucosyltransferase DaUGT gene and application thereof.

Background

Radix Dipsaci (Dipsacus Asperoides) is also called Sambucus chinensis, is a perennial herb plant of Dipsacus genus of Dipsacaceae family, is used as root, is a basic source plant of radix Dipsaci which is a common Chinese medicinal material in large amount in China, and has effects of treating liver and kidney deficiency, tendons injury and fracture, etc. The 2020 edition of Chinese pharmacopoeia prescribes that the index component of radix Dipsaci medicinal material is radix Dipsaci saponin VI, and its content is not lower than 2%. Modern pharmacological research shows that dipsacoside VI has the functions of resisting myocardial atrophy, preventing or treating acute and chronic liver injury, liver fibrosis and the like.

The downstream pathway of triterpenoid saponin biosynthesis involves reactions in which UGTs catalyze the glycosylation of the triterpenoid saponin backbone, which in vivo catalyzes the attachment of activated sugars to different receptor molecules, through activation, inhibition or modulation of solubility of a range of compounds, thereby participating in a variety of regulatory and metabolic pathways in plants.

Dipsacus asperoides saponin VI is index component of Dipsacus asperoides medicinal material specified in pharmacopoeia, and is also main active component of Dipsacus asperoides. In recent years, with the continuous and intensive pharmacological research of radix dipsaci, radix dipsaci extract is found to improve the cognitive disorder of animals, wherein the cognitive disorder is a typical characteristic of Alzheimer's disease, so radix dipsaci is probably a potential drug for treating Alzheimer's disease.

In recent years, wild resources of dipsacus root are continuously reduced, the pharmacodynamic monomers are produced by utilizing synthetic biology, but the biosynthetic paths of the pharmacodynamic monomers are not clear enough at present, such AS dipsacus root saponin VI in dipsacus root, which is oleanane type pentacyclic triterpene, are synthesized by starting from 2, 3-oxidation squalene, forming beta-amyrin under the catalysis of beta-AS, then forming aglycone hederagenin of dipsacus root triterpenoid saponin by oxidizing and modifying beta-amyrin by CYP450s, and finally forming triterpenoid saponin such AS dipsacus root saponin VI by modifying with glucosyltransferase, wherein glucosylation is the last two steps of synthesizing dipsacus root saponin VI. Although many UGTs which can catalyze glycosylation in triterpenes are found at present, UGTs which catalyze glycosylation at the C-28 position of the clematis saponins A in teasel roots are not found yet, so that analysis of the paths of the biosynthesis of triterpene saponins such as teasel roots saponin VI in teasel roots is influenced, and the method is one of the biggest barriers for industrially producing the triterpene saponins.

Disclosure of Invention

In view of the above problems, the present invention has an object to provide a teasel root glucosyltransferase DaUGT gene.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

a teasel root glucosyltransferase DaUGT gene, wherein the nucleic acid sequence of the teasel root glucosyltransferase DaUGT gene is shown in SEQ ID NO: 1.

The amino acid sequence of the protein encoded by the teasel root glucosyltransferase DaUGT gene is shown in SEQ ID NO: 2.

The invention also provides a recombinant plasmid containing the teasel root glucosyltransferase DaUGT gene.

The teasel root glucosyltransferase DaUGT gene is obtained by homologous recombination with a pET28a vector and is named pET28 a-DaUGT.

The invention also provides a transgenic engineering bacterium, which contains the recombinant plasmid or the genome of the transgenic engineering bacterium is integrated with the exogenous teasel root glucosyltransferase DaUGT gene.

The transgenic engineering bacteria are escherichia coli BL21 (DE 3) strains.

The invention also provides an application of the teasel root glucosyltransferase DaUGT gene in preparing teasel root saponin VI.

Meanwhile, the invention provides an application of the teasel root glucosyltransferase DaUGT gene in preparing medicaments for treating myocardial atrophy, treating acute and chronic liver injury, treating hepatic fibrosis, resisting osteoporosis, promoting neovascularization and treating Alzheimer's disease, and the teasel root glucosyltransferase DaUGT gene is prepared into teasel root saponin VI so as to realize pharmacological activity of the application in preparing medicaments for treating myocardial atrophy, treating acute and chronic liver injury, treating hepatic fibrosis, resisting osteoporosis, promoting neovascularization and treating Alzheimer's disease.

And the application of the dipsacoside VI in preparing medicaments for treating myocardial atrophy, acute and chronic liver injury, hepatic fibrosis, osteoporosis, neovascular formation and Alzheimer disease.

The invention further provides a preparation method of the dipsacus root saponin VI for synthesizing the dipsacus root saponin VI, which comprises the following steps: taking HN saponin F and uridine diphosphate-glucose as raw materials, and carrying out glycosylation reaction on glucose radical on C-28 position of HN saponin F under the catalysis of teasel root glucose transferase obtained by encoding teasel root glucose transferase DaUGT gene to generate teasel root saponin VI.

Preferably, the preparation method comprises the following steps:

(1) Preparing a cDNA template;

(2) Amplifying and recovering genes;

(3) Constructing and identifying a gene recombinant vector;

(4) Protein expression and purification of candidate gene DaUGT120,120;

(5) And (5) enzyme activity reaction.

Preferably, the preparation method of the cDNA template in the step (1) comprises the following steps: taking fresh roots, stems and leaves of dipsacus root, slicing, quickly freezing with liquid nitrogen, extracting RNA, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit, and preserving at-20 ℃ for later use;

The gene amplification and recovery in the step (2) comprises the following steps: using the reverse transcription to cDNA as a template, adopting DNA polymerase to carry out gene amplification, adding 2 μl and 2x phantaMax Master mix25 μl of cDNA, 2 μl of each of the upstream and downstream primers, and supplementing ddH2O to 50 μl, wherein the amplification system is as follows: 95 ℃, 3min,95 ℃, 15s,55 ℃, 15s,72 ℃, 1min,36 cycles; 72 ℃ for 5min; recovering the target gene by using the kit, and storing in a refrigerator at-20 ℃ for later use;

The construction and identification of the gene recombinant vector in the step (3) comprises the following steps: linearizing a vector, carrying out gene recombination and detecting bacteria water; the vector linearization is to carry out single enzyme digestion on pET-28a by utilizing endonuclease BamHI to obtain a linearization vector pET-28a, purify and recycle the linearization vector pET-28a by using a kit, and measure the concentration of the linearization vector pET-28a and store the linearization vector pET-28a in a refrigerator at the temperature of minus 20 ℃ for later use; the gene recombination is to connect a target gene obtained by amplifying a kit with a linearized pET-28a vector, and the transformed strain is E.coli BL21 (DE 3) competent; in the PCR amplification in the bacteria water detection, the PCR program is for 35 cycles of 95 ℃, 3min,95 ℃, 30s,55 ℃,15 s,72 ℃, 30/kb; 72 ℃ for 5min; obtaining bacterial liquid;

Protein expression in step (4): resuscitating the bacterial liquid at 37 ℃ and 220rpm/min, inoculating to kanamycin LB liquid culture medium for expansion culture, and adding IPTG to perform protein induction expression at low temperature; protein purification: after the induced expression is finished, centrifugally collecting thalli, re-suspending thalli by buffer solution, breaking bacteria, centrifuging at high speed, loading supernatant onto a Ni-NTA agarose affinity column, eluting by using imidazole passing columns with different concentrations, collecting filtrate, and detecting results of eluate and precipitate by SDS-PAGE protein electrophoresis;

The enzyme activity reaction in the step (5) comprises the following steps: the substrate and sugar donor were mixed and reacted by adding enzyme and Tris-HCl buffer.

The invention has the following beneficial effects:

Taking HN saponin F and uridine diphosphate-glucose as raw materials, and carrying out glycosylation reaction on glucose at C-28 position of HN saponin F under the catalysis of teasel root glucosyltransferase obtained by encoding teasel root glucosyltransferase DaUGT gene to generate teasel root saponin VI.

The invention obtains target protein after in vitro expression by recombinant plasmid, and further catalyzes substrate HN saponin F to generate dipsacoside VI.

The teasel root glucosyltransferase DaUGT gene is identified from teasel roots through transcriptome sequencing and bioinformatics technology, and is screened after a large number of experiments; extracting RNA of the continuous broken root by adopting an RNA reagent, reversing the RNA into cDNA, and carrying out PCR amplification to obtain the PCR-based DNA. The amplification primers of the Dipsacus asperoides glucosyltransferase DaUGT gene are as follows:

DaUGT120

5'F：ATGGCCATCAACGAACACCA

3'R：TACTACGGTTACACAATATC

In addition, when homologous recombination is performed with the vector pET28a, daUGT.sup.120 gene is amplified and recovered by using a primer with homology wall as follows:

DaUGT120

5'F：gctagcatgactggtggacagcaaatgggtcgcggatccATGGCCATCAACGAACA

3'R：caagcttgtcgacggagctcgaattcggatccTAACACATTGGCATCATTTTTTTCG

the gene DaUGT120,120 separated and identified from dipsacus root can be used as an important marker gene for molecular auxiliary breeding of dipsacus root, and can also be used as an important candidate gene for producing dipsacus root saponin VI in the construction of yeast chassis cells.

Drawings

In FIG. 1, A is the LC-MS analysis of DaUGT of the enzyme activity product, and B is the mass spectrum of the enzyme activity product of HN saponin F and dipsacus saponin VI at DaUGT; c is a biosynthesis path of dipsacoside VI constructed based on DaUGT functions;

FIG. 2 is a schematic diagram showing the construction of recombinant expression plasmid pET28a-DaUGT (for expressing the gene encoding Dipsacus asperoides glucosyltransferase DaUGT) 120;

FIG. 3 shows the result of electrophoresis detection after recombinant Dipsacus asperoides glucosyltransferase DaUGT;

FIG. 4 is a SDS-PAGE protein electrophoresis detection chart (M: protein molecular mass standard) of teasel root glucosyltransferase DaUGT.

Detailed Description

The invention will be further described with reference to specific embodiments. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

Example 1

According to the invention, candidate genes related to a synthetic path of dipsacoside VI are obtained through searching transcriptome data and annotation results of a KEGG protein database by local BLAST, FPKM values are found out from the transcriptome data, differential expression analysis is carried out on the genes by using the FPKM values, heat maps are produced by using TBtool on differential gene expression quantities, the expression quantities of related genes in continuous roots, stems and leaves are respectively compared, the candidate DaUGT120 is functionally identified, and an online tool ORF Finder (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) is used for identifying Open Reading Frames (ORFs) and amino acid sequences of DaUGT. Amino acid sequences of UGT genes from other species can be downloaded from existing databases and aligned with candidate genes by ClustalW and phylogenetic tree constructed by MEGA-X using the adjacency method (neighborjoining method) under default parameters. Then, a series of works such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in-vitro enzyme activity reaction, HPLC and LC/MS detection are carried out, and then DaUGT120 of dipsacoside VI can be finally identified, which can be generated by carrying out glycosylation reaction on glucose at the C-28 position of HN saponin F. The operation steps of each stage are as follows:

(1) Preparation of cDNA templates

Taking fresh roots, stems and leaves of dipsacus asperoides, slicing, quickly freezing with liquid nitrogen, and extracting RNA. Total RNA extraction was performed using HiPure HP PLANT RNA MINI KIT kit from Guangzhou Meiyi Biotechnology Co. Extracting RNA according to the operation steps of the instruction book of the kit, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit after the RNA is detected to be qualified, and preserving the cDNA at-20 ℃ for later use.

(2) Gene amplification and recovery

The ORF (open reading frame) of 13 candidate DaOSC genes of Dipsacus asperoides was found out using NCBI on-line software (https:// www.ncbi.nlm.nih.gov/orffinder). Then using SnapGene software to design specific primer of full-length sequence of gene coding region, said designed primer is provided with homologous arm of colibacillus expression vector pET28a-DaUGT120,

The general primers for pET28a-DaUGT vector were introduced: 5'F: GCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCATGGCCATCAACGAACAC; the downset is 3' r: CAAGCTTGTCGACGGAGCTCGAATTCGGATCCTAACACATTGGCATCATTTTTTTCG.

The cDNA obtained by the reverse transcription was used as a template, and gene amplification was performed using DNA polymerase (phanta enzyme). The amplification system is as follows: cDNA 2 μl,2x phantaMax Master mix25 μl, up and down primers 2 μl each, ddH2O up to 50 μl, amplification system: 95 ℃, 3min,95 ℃, 15s,55 ℃, 15s,72 ℃, 1min,36 cycles; 72 ℃ for 5min. After the PCR amplification procedure was completed, 1.2% agarose gel electrophoresis was used to determine whether the amplified gene band was consistent with the length of the target gene band. If the lengths are similar, the target gene can be recovered by using GenStar's kit. And the recovery concentration is measured in a Nanodrop2000, and finally the mixture is stored in a refrigerator at the temperature of minus 20 DEG C

(3) Construction and identification of Gene recombination vectors

Linearization of a vector: the linearized vector pET-28a was obtained by single cleavage of pET-28a with the endonuclease BamHI. Using omega companyThe Cycle Pure Kit is purified and recovered, and the concentration of the purified Pure Kit is measured and stored in a refrigerator at the temperature of minus 20 ℃ for standby.

B gene recombination: the target gene amplified by using a ready-to-use seamless cloning enzyme kit of biological engineering (Shanghai) Co., ltd is connected with a linearized pET-28a vector, the connection method and the transformation mode are shown in figure 2, and the transformed strain is E.coli BL21 (DE 3) competent.

C, bacteria water detection: randomly selecting 8 colonies from a transformation medium on an ultra-clean workbench, and taking 3 mu l of colonies to carry out PCR amplification, wherein a PCR reaction system adopts a 2x Taq Master Mix enzyme reaction system of Nanjinouzan biotechnology Co., ltd, and the PCR process is 95 ℃,3min,95 ℃,30s,55 ℃,15s,72 ℃,30/kb and 35 cycles; after the reaction procedure was completed at 72℃for 5min, the length of the PCR product was measured with 1% agarose. If the PCR product is similar in length to the fragment of interest, it is positive. Indicating successful assembly and sequencing. After sequencing is successful, seed preservation is carried out by a method of using 50% glycerol and bacterial liquid according to the volume ratio of 1:1. As shown in fig. 2.

(4) Protein expression and purification of candidate Gene DaUGT A120

Protein expression: resuscitating the bacterial liquid preserved before, recovering under the condition of 220r/min at 37 ℃, inoculating 300mL of kanamycin (100 mug/mL) LB liquid culture medium for expansion culture after the bacterial liquid is fully turbid, adding 0.5mM IPTG (isopropyl-beta-D-thiogalactoside) when the OD value of the bacterial liquid is increased to the range of 0.6-0.8, and carrying out protein induction expression for 12-16h under the low temperature condition.

Protein purification: after the induction expression is finished, the bacterial cells are collected by centrifugation for 20min at 4 ℃ and 5000rpm/min by a large-scale high-speed refrigerated centrifuge. The cells were resuspended in 20mL of 50mM Tris,200mM NaCl, tris-HCl (pH=8.0) buffer, and after completion, the cells were broken 1 to 2 times with a high pressure low temperature breaker (Guangzhou energy-accumulating biosciences Co., ltd.), and then centrifuged at a high speed at 4℃and 12000rpm/min for 30 minutes, the supernatant was loaded onto a Ni-NTA agarose affinity column, and the filtrate was collected by eluting with different concentrations of imidazole (20 mM, 50mM, 60mM, 200 mM) and subjected to SDS-PAGE for detection of the eluate and precipitate. As shown in fig. 4.

(5) Enzymatic reaction

In vitro enzyme activity reactions were performed in 100. Mu.l of a mixed system, substrate 100mM (Williams Saponin A), sugar donor 100mM (UDP-glucose), enzyme 10. Mu.g/. Mu.l, tris-HCl buffer (50 mM, pH=8.0), reaction at 30℃for 2h, termination of the reaction by addition of an appropriate amount of methanol, centrifugation at 12000g for 20min, aspiration of the supernatant, dissolution of the product in methanol, and final analysis by HPLC and LC-MS for detection of the reaction product.

(6) Product detection

The enzyme activity result is detected by an Agilent 1290UPLC/6540Q-TOF liquid chromatography-mass spectrometer (LC/MS): mass spectrometry conditions: the ion source adopts a negative ion mode and voltage: 3500V; fragmentation voltage: 135V; taper hole voltage: 60V; radio frequency voltage: 750V, scan range: 100-1000m/z, scanning mode: and SRM. Chromatographic conditions: the column was Agilent extension-C18 (250 mm. Times.4.6 mm,5 μm), column temperature: 30 ℃, the mobile phase of the product was determined to be 0.01% v/v formic acid in water (A) -acetonitrile (B), gradient elution: 0-3 min, 85-60% of A; 3-7 min, 60-35% of A; 7-9.5 min, 35-12% A;9.5 to 25minA. Elution time: 25min; sample injection amount: 10. Mu.L; flow rate: 0.5mL/min; the detection wavelength is 210nm.

As shown in FIG. 1, the molecular weights of HN Saponin F and dipsacoside VI are 767 and 928, respectively, when EIC (879.43 and 973.52) is extracted in the LC-MS detection negative mode, a new ion characteristic peak appears in DaUGT experimental groups, the peak outlet time is consistent with the peak outlet time of a dipsacoside VI real standard substance, the mass spectrum characteristic of the new peak is found to be the same as that of the dipsacoside VI real standard substance when the mass spectrum characteristic is analyzed, and the molecular characteristics of 927.51[ M-H ] -,973.52[ M+HCOO ] -and 1041.50[ M+CF3COO ] -are provided, so that the generated new peak is the dipsacoside VI, and DaUGT is the glucosyltransferase responsible for catalyzing HN saponine F to generate the dipsacoside VI.

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.

Claims (10)

1. The teasel root glucosyltransferase DaUGT gene is characterized in that the nucleotide sequence of the teasel root glucosyltransferase DaUGT gene is shown in SEQ ID NO: 1.

2. The protein encoded by the teasel root glucosyltransferase DaUGT gene as set forth in claim 1, wherein the amino acid sequence of the protein is as set forth in SEQ ID NO: 2.

3. A recombinant plasmid containing the teasel root glucosyltransferase DaUGT120,120 gene according to claim 1, which is obtained by homologous recombination of teasel root glucosyltransferase DaUGT gene and pET28a vector, and is named pET28 a-DaUGT.

4. A transgenic engineering bacterium, characterized by comprising the recombinant plasmid of claim 3 or the exogenous teasel root glucosyltransferase DaUGT gene of claim 1 integrated in the genome of the genetically engineered bacterium, wherein the transgenic engineering bacterium is escherichia coli BL21 (DE 3) strain.

5. The use of a teasel root glucosyltransferase DaUGT gene as claimed in claim 1 in the preparation of teasel root saponin VI.

6. The application of the teasel root glucosyltransferase DaUGT gene in preparing a medicament for treating myocardial atrophy, treating acute and chronic liver injury, treating hepatic fibrosis, resisting osteoporosis, promoting neovascularization and treating Alzheimer's disease as claimed in claim 1, wherein the teasel root glucosyltransferase DaUGT gene is prepared into teasel root saponin VI so as to realize pharmacological activity for treating myocardial atrophy, treating acute and chronic liver injury, treating hepatic fibrosis, resisting osteoporosis, promoting neovascularization and treating Alzheimer's disease.

7. The application of the dipsacoside VI in preparing medicaments for treating myocardial atrophy, acute and chronic liver injury, hepatic fibrosis, osteoporosis, neovascular formation promotion and Alzheimer disease treatment.

8. A method for preparing dipsacoside VI, which is characterized by comprising the following steps: taking HN saponin F and uridine diphosphate-glucose as raw materials, and carrying out glycosylation reaction on glucose radical on C-28 position of HN saponin F under the catalysis of teasel root glucose transferase obtained by encoding teasel root glucose transferase DaUGT gene to generate teasel root saponin VI.

9. The method of preparing according to claim 8, comprising the steps of:

(1) Preparing a cDNA template;

(2) Amplifying and recovering genes;

(3) Constructing and identifying a gene recombinant vector;

(4) Protein expression and purification of candidate gene DaUGT120,120;

(5) And (5) enzyme activity reaction.

10. The method of claim 9, wherein the method of preparing the cDNA template in step (1) comprises the steps of: taking fresh roots, stems and leaves of dipsacus root, slicing, quickly freezing with liquid nitrogen, extracting RNA, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit, and preserving at-20 ℃ for later use;

The gene amplification and recovery in the step (2) comprises the following steps: using the reverse transcription to cDNA as a template, adopting DNA polymerase to carry out gene amplification, adding 2 μl and 2 x phantaMax Master mix25 μl of cDNA, 2 μl of each of the upstream and downstream primers, and supplementing ddH2O to 50 μl, wherein the amplification system is as follows: 95 ℃ and 3min,95 ℃ and 15s and 55 ℃ and 15s and 72 ℃ and 1min, and 36 cycles; 72 ℃ and 5min; recovering the target gene by using the kit, and storing in a refrigerator at-20 ℃ for later use;

The construction and identification of the gene recombinant vector in the step (3) comprises the following steps: linearizing a vector, carrying out gene recombination and detecting bacteria water; the vector linearization is to carry out single enzyme digestion on pET-28a by utilizing endonuclease BamHI to obtain a linearization vector pET-28a, purify and recycle the linearization vector pET-28a by using a kit, and measure the concentration of the linearization vector pET-28a and store the linearization vector pET-28a in a refrigerator at the temperature of minus 20 ℃ for later use; the gene recombination is to connect a target gene obtained by amplifying a kit with a linearized pET-28a vector, and the transformed strain is E.coli BL21 (DE 3) competent; in the PCR amplification in the bacteria water detection, the PCR program is for 35 cycles of 95 ℃, 3min,95 ℃, 30s,55 ℃,15 s,72 ℃, 30/kb; 72 ℃ for 5min; obtaining bacterial liquid;

Protein expression in step (4): resuscitating the bacterial liquid at 37 ℃ and 220rpm/min, inoculating to kanamycin LB liquid culture medium for expansion culture, and adding IPTG to perform protein induction expression at low temperature; protein purification: after the induced expression is finished, centrifugally collecting thalli, re-suspending thalli by buffer solution, breaking bacteria, centrifuging at high speed, loading supernatant onto a Ni-NTA agarose affinity column, eluting by using imidazole passing columns with different concentrations, collecting filtrate, and detecting results of eluate and precipitate by SDS-PAGE protein electrophoresis;

the enzyme activity reaction in the step (5) comprises the following steps: the substrate and sugar donor were mixed and reacted by adding enzyme and Tris-HCl buffer.