CN112961870A

CN112961870A - Carbon glycosyltransferase DhCGT2 gene in pseudo-ginseng plant and application thereof

Info

Publication number: CN112961870A
Application number: CN202110215836.3A
Authority: CN
Inventors: 郝冰; 袁慧娟; 张广辉; 杨生超; 刘祥宇; 谢家伟; 陈小巧
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2021-02-26
Filing date: 2021-02-26
Publication date: 2021-06-15
Anticipated expiration: 2041-02-26
Also published as: CN112961870B

Abstract

The invention relates to a carbon glycosyltransferase in a pseudo-ginseng plantDhCGT2Genes and application thereof, belonging to the field of biotechnology. The carbon glycosyltransferase in the Vietnamese plantDhCGT2The gene nucleotide sequence is shown as SEQ ID NO.1, and the total length of the sequence is 1422 bp; the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, 473 amino acid residues are encoded, and the encoded protein can be used for preparing schaftoside and isoschaftoside. The invention discovers a carbon sugar in desmodium plant false pachyrhizus for the first timeThe transferase has the functions of catalyzing the generation of vitexin and isovitexin by taking dihydroxynaringenin as a substrate and catalyzing the generation of schaftoside and isoschaftoside by taking dihydroxynaringenin glucosylcarbinoside as a substrate, and provides a high-efficiency biosynthesis method for heterogeneously expressing vitexin, isovitexin, schaftoside and isoschaftoside in a plant body.

Description

Carbon glycosyltransferase DhCGT2 gene in pseudo-ginseng plant and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a carbon glycosyltransferase DhC GT2 gene in a pseudo-ginseng plant and application thereof in preparation of vitexin, isovitexin, schaftoside and isoschaftoside.

Background

The medicinal plant Desmodium herbaceum (L.) DC is Desmodium (L.) of Desmodium of Leguminosae, and is distributed at home and abroad, and China is mainly distributed in Yunnan and Guangdong and other areas. The whole herb of herba Psidii Guajavae has the effects of relieving pain, clearing heat, promoting urination, diminishing inflammation, calming the liver, removing toxic substances, promoting blood circulation, relieving cough and asthma. According to records of Chinese materia medica, the pseudo-ginseng has obvious effect on treating epidemic encephalitis B, hepatitis and parotitis. The herba Viburni Sargentii mainly contains flavonoid glycoside, alkaloid, terpenes, etc., and has high medicinal and feeding values. The related literature reports that schaftoside and isoschaftoside are natural products with biological activity widely existing in high-grade plants such as food crops and Chinese herbal medicines. Their biosynthesis may be linked to plant defense. They have a variety of biological activities in mammals, including anti-respiratory virus, anti-diabetic, anti-hypertensive, hepatoprotective, anti-inflammatory and antioxidant activities, which implicate their potential use as pharmaceuticals or dietary supplements.

Currently, studies on Oxygen Glycosyltransferases (OGTs) are widespread, but there is less interest in Carbon Glycosyltransferases (CGTs). In recent years, the flavonoid carbon glycoside attracts scientific researchers to pay extensive attention to CGTs through remarkable pharmacological activity and a stable structure which is not easy to hydrolyze. At present, the CGT gene is found to be mainly in 14 monocotyledons and dicotyledons such as rice, corn, wheat, mango, kudzu root, gentiana trilobata, kumquat, mandarin orange, dendrobium, horseradish, glycyrrhiza glabra, aloe, scutellaria baicalensis, trollflower and the like. Most CGT in the plant can catalyze 2-hydroxyflavanone to generate C-glycosylation to generate 6-and 8-single-carbon glycoside of corresponding flavone in one step, such as vitexin, isovitexin, puerarin, erythroside and isoerythroside. At present, only SbCGTb in the scutellaria baicalensis can generate glycosylation reactions in two steps to generate the dicarboglycoside schaftoside and isoschaftoside. The research on the key enzyme CGTs in the biosynthesis pathway of the flavonoid carbon glycoside in the medicinal plant pseudo-ginseng has not been reported.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provides a carbon glycosyltransferase DhCGT2 gene in a pseudo-ginseng plant, which can be used as a biosynthesis regulation gene of vitexin, isovitexin, schaftoside and isoschaftoside and applied to preparation of vitexin, isovitexin, schaftoside and isoschaftoside.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the invention provides a carbon glycosyltransferase DhCGT2 gene in a pseudo-kidney bean plant, wherein the nucleotide sequence of the carbon glycosyltransferase DhCGT2 gene in the pseudo-kidney bean plant is shown in SEQ ID NO.1, and the full length of the sequence is 1422 bp.

In a second aspect, the present invention provides a protein encoded by the gene DhCGT2, which is a carbon glycosyltransferase from the above-mentioned plants of Phaseolus vulgaris, wherein the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and 473 amino acid residues are encoded.

In a third aspect, the present invention provides a recombinant plasmid containing a target gene in the gene DhCGT2 which is a carbon glycosyltransferase in the above-described pseudo-ginseng plant.

Further, it is preferable that the gene DhCGT2 of the c-glycosyltransferase of pseudo-beans is homologously recombined with the vector pET28a to obtain a recombinant plasmid pET28a-DhCGT 2.

Specifically, in the case of homologous recombination with the vector pET28a, the DhCGT2 gene needs to be amplified and recovered using a primer having a homologous wall as follows:

5'F：cagcaaatgggtcgcggatcccgatgaagaaagcagcacggc；(SEQ ID NO.3)

3'R：tggtggtgctcgagtgcggcccgcaattacgaggatacttgattcattatataatcaatg。(SEQ ID NO.4)

the fourth aspect of the invention provides a genetically engineered bacterium, which contains the recombinant plasmid, or integrates the exogenous carbon glycosyltransferase DhCGT2 gene into the genome of the genetically engineered bacterium.

Further, preferably, the genetically engineered bacterium is escherichia coli BL21DE 3.

The fourth aspect of the invention provides the application of the carbon glycosyltransferase DhCGT2 gene in the pseudolarix plants in preparing schaftoside and isoschaftoside.

Further, it is preferable that the carbon glycosyltransferase DhCGT2 encoded by the carbon glycosyltransferase DhCGT2 can catalyze the production of a flavone C-glycoside compound by using dihydroxynaringenin (2-hydroxynaringenin) as a substrate and UDP-glucose and UDP-arabinose as sugar donors. The first step of carbon glycosylation reaction is to connect glucose on C-6 position or C-8 position of dihydroxynaringenin to generate vitexin or isovitexin, and the second step of glycosylation reaction is to generate vitexin or isovitexin as substrate to connect arabinose on C-6 position or C-8 position to generate schaftoside or isoschaftoside.

The invention obtains target protein after in vitro expression through recombinant plasmid, further catalyzes substrate dihydroxynaringenin, generates vitexin or isovitexin through a first glycosylation reaction, and generates schaftoside or isoschaftoside through a second glycosylation reaction by taking a product generated by the first reaction as a substrate for further glycosylation reaction.

The gene DhCGT2 of the carbon glycosyltransferase is extracted from the plant root of the pseudo-ginseng, analyzed by transcriptome sequencing and bioinformatics technology, and identified after being screened after a large number of tests; extracting the RNA of the pseudo-jatropha root by adopting an RNA kit, inverting the RNA into cDNA, and performing PCR amplification to obtain the DNA. The amplification primers of the gene DhCGT2 of the carbon glycosyltransferase are shown as follows:

5'F：atgaagaaagcagcacggc；(SEQ ID NO.5)

3'R：ttacgaggatacttgattcattatataatcaatg。(SEQ ID NO.6)

the carbon glycosyltransferase DhCGT2 separated and identified from the pseudo-ginseng can be used as an important candidate gene for producing schaftoside and isoschaftoside which is also an inhibitor for seed germination of parasitic plant striga asiatica.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a carbon glycosyltransferase DhCGT2 gene in a pseudo-ginseng plant, which can be used as a biosynthesis regulation gene of schaftoside and isoschaftoside and applied to preparation of schaftoside and isoschaftoside. The invention relates to a method for preparing vitexin, isovitexin, schaftoside and isoschaftoside by using in-vitro biological heterologous expression, which solves the problem of extracting a short plate of vitexin, isovitexin, schaftoside and isoschaftoside by using wild medicinal plant resources.

Drawings

FIG. 1 is a schematic diagram of the derivation of vitexin, isovitexin, schaftoside and isoschaftoside;

FIG. 2 is a key diagram of the synthesis of schaftoside and isoschaftoside by presuming the CGT catalytic reaction;

FIG. 3 is a schematic diagram of the construction of recombinant expression plasmid pET28a-DhCGT2 (for expressing the gene of carbon glycosyltransferase DhCGT 2);

FIG. 4 shows the electrophoretic detection of DhCGT2 after recombination; m: NormalRunTM prestaged 250bp-I/II DNA ladder DNA Marker (250bp-I/II nucleic acid Marker); 1: recombining a target gene;

FIG. 5 is an SDS-PAGE protein electrophoretic detection map of DhCGT 2; wherein, M: protein molecular mass standard; 1 is the target protein electrophoresis detection of DhCGT2 without nickel column purification; 2, SDS-PAGE protein electrophoresis detection of the DhCGT2 protein purified by the nickel column; arrow indicates the purification of the target protein;

FIG. 6 shows the result of HPLC detection of the enzyme-activated reaction product of carbon glycosyltransferase DhCGT 2; i represents a liquid phase classification chart of 4 compound mixed standard products; II, a liquid phase detection diagram of an enzyme reaction blank control test; III is a liquid phase detection map of DhCGT2 which takes dihydroxynaringenin as a substrate and takes UDP-glucose as enzyme provided by sugar to generate flavone monosaccharide vitexin and isovitexin; IV, reacting DhCGT1 with enzyme provided by dihydroxynaringenin and UDP-glucose and UDP-arabinoside 2 to generate flavone disaccharide schaftoside and isoschaftoside;

FIG. 7 shows the results of LC-MS detection of the standard; the I is LC-MS detection mixed standard vitexin, isovitexin, schaftoside and isoschaftoside maps; wherein II, III, IV and V are LC-MS extraction spectra of the molecular weight of the standard substance; wherein a: charaftoside; b: isoureafur carbon glycoside; c: vitexin; d: isovitexin;

FIG. 8 shows the results of LC-MS detection of the reaction product; the I is a detection result of LC-MS detecting DhCGT2 to generate flavone monosaccharide and disaccharide vitexin, isovitexin, schaftoside and isoschaftoside through enzymatic reaction provided by dihydroxynaringenin and UDP-glucose and UDP-arabinosine 2 sugars; wherein II, III, IV and V are molecular weight maps of 4 compounds extracted from enzyme reaction, a: charaftoside; b: isoureafur carbon glycoside; c: vitexin; d: isovitexin;

FIG. 9 shows the first glycosylation step of C-6 or C-8 catalyzed dihydroxynaringenin (2-hydroxynaringenin) by the carboglycosyltransferase DhCGT1 and the second glycosylation step of carbon on the hydroxyl groups at the C-6 and C-8 positions with vitexin or isovitexin;

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials or equipment used are not indicated by manufacturers, and all are conventional products available by purchase.

Example 1

Based on the basic function annotation information of the Candida Unigene, CGT candidate genes are screened from the sequencing annotation result, meanwhile, the genes of the carbon glycosyl transferase (TcCGT1) identified from the trollius chinensis plant and the carbon glycosyl transferase (Ggcgt) in Glycyrrhiza glabra are taken as clues, the screening result is subjected to sorting analysis through sequence local BLAST, and finally 11 CGT type carbon glycosyl transferases (TcCGT) are found. Then, after a series of work such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, HPLC (high performance liquid chromatography) and LC/MS (liquid chromatography/mass spectrometry) detection and the like, the target candidate carbon glycosyltransferase DhCGT2 gene which can catalyze C-6 or C-8 site of the dihydroxynaringenin to generate vitexin or isovitexin is finally identified (figure 1). The synthetic steps of schaftoside and isoschaftoside in each stage are as follows:

(1) preparation of cDNA template

Taking a fresh leaf sample of the tonka-bean, quickly freezing by using liquid nitrogen, and extracting RNA. Total RNA extraction was performed using the HiPure Plant RNA Mini Kit from magenta (Meyki Biotech, Guangzhou). Extracting RNA according to the operation steps of the kit, after the RNA is detected to be qualified, using a TAKARA reverse transcription kit to reversely transcribe the RNA into cDNA, and storing at-20 ℃ for later use.

(2) Gene amplification and recovery

The primers with homologous arms of the gene (the homologous arms are Escherichia coli pET28a) are designed by using primer design software Snapgene3.2.1, and then gene amplification is carried out by using Q5 high fidelity enzyme. The PCR reaction program is: at 98 ℃ for 30S; at 98 deg.C, 10S, 58 deg.C, 30S, 72 deg.C, 50min, 35 cycles; 72 deg.C, 2 min. The PCR system amplification system is shown in Table 1, and after the PCR is finished, the target band is recovered after the glue running confirms the successful amplification.

Then adopting the primers shown in SEQ ID NO.3 and SEQ ID NO.4 to carry out PCR reaction, wherein the PCR reaction program comprises the following steps: at 98 ℃ for 30S; at 98 deg.C, 10S, 58 deg.C, 30S, 72 deg.C, 50min, 35 cycles; 72 deg.C, 2 min. The primers shown in SEQ ID NO.3 and SEQ ID NO.4 are adopted to carry out PCR system amplification system shown in Table 2, after PCR is finished, the gel is run to confirm that amplification is successful, and then target strips are recovered to obtain the gene segments with homologous arms.

Gene cutting recovery Using EasyPure Quick Gel Extraction Kit from Beijing all-terrain gold Biotechnology Ltd, recovery of the target gene was performed. After recovery, the concentration of the recovered water is measured on a NanoReady ultramicro ultraviolet-visible spectrophotometer, and finally the water is stored in a refrigerator at the temperature of-20 ℃ for later use.

5'F：atgaagaaagcagcacggc；(SEQ ID NO.5)

3'R：ttacgaggatacttgattcattatataatcaatg。(SEQ ID NO.6)

TABLE 1

Components	Gene amplification System. mu.L
		Q5 high fidelity enzyme	25
5'F(SEQ ID NO.5)10μmol/L	1
		3'R(SEQ ID NO.6)10μmol/L	1
cDNA	1
		ddH₂O	to 50μL

TABLE 2

The primers with homology arms were as follows:

5'F：cagcaaatgggtcgcggatcccgatgaagaaagcagcacggc；(SEQ ID NO.3)

(3) construction and identification of Gene recombination vector

A schematic representation of homologous recombination is shown in detail in FIG. 3. The vector pET28a was first linearized, and the linearized vector was obtained by double digestion with BamH I enzyme and Not1 at 37 ℃ for 40min on a PCR instrument as shown in Table 3. Assembling according to the operation instruction of homologous recombinase during homologous recombination, and then calculating the use amount of each component according to the concentrations of the inserted gene segment and the vector and the recombination instruction; finally, the components were added to the PCR reaction tube on ice as in Table 4. The homologous recombination PCR reaction program is as follows: at 98 ℃ for 30S; at 98 deg.C, 10S, 58 deg.C, 30S, 72 deg.C, 50min, 35 cycles; 72 deg.C, 2 min. The results were examined after assembly and sent to the company for sequencing, and the results of electrophoresis after assembly are shown in FIG. 4, indicating successful assembly. The recombination operation is carried out according to the following processes:

TABLE 3 digestion system

Components	mu.L of enzyme digestion reaction system
		pET28a	X

	1×Buffer	5
BamH I			2
	Not1	2
ddH₂O			to 50μL

Wherein the concentration of extracted plasmid X is 1000/pET28a

TABLE 4 candidate Gene recombination reaction System

Components	Recombination reaction μ L
		Linearized pET28a	X
Gene fragment with homology arm	Y
		5×CE II Buffer	4
Exnase II	2
		ddH₂O	to 20μL

Wherein X ═ (0.02 × pET28a base pairs) ng/linearized pET28a concentration ng/μ L; y ═ (base pair 0.02 × pET28a) ng/DhCGT2 recovery concentration ng/. mu.l;

(4) SDS-PAGE protein electrophoresis and immunoblot detection

After being determined by a protein expression small test, the protein is amplified and expressed, and the induction conditions of the DhCGT2 protein are as follows: inducing at 16 deg.C with 0.1mM IPTG at 220r/min for 18 h; using a Pet28a empty vector without the target gene as a control test; after induction, shaking greatly, collecting bacteria (4 ℃, 5000rpm), breaking cell wall, centrifuging (4 ℃, 3600rpm) to obtain protein supernatant, purifying by 80mM imidazole eluting nickel column, concentrating, and performing SDS-PAGE protein electrophoresis and detection. As shown in FIG. 5, the target gene DhCGT2 has a band at the position corresponding to the protein Marker50KD, while the control experiment shows that the target band is found, thereby preliminarily confirming that the gene DhCGT2 is successfully expressed.

(5) Enzyme activity reaction

The activity of the DhCGT2 enzyme was determined by the synthesis of schaftoside and isoschaftoside by carboglycosylation in 200ul centrifuge tubes. The mixture in the reaction system comprises: 40. mu.g of purified recombinant protein DhCGT2 was added to 20mM dihydroxynaringenin, 100mM UDP-glucose, 100mM UDP-arabinose, and 80mM Tris-hcl buffer (pH7.5), and the total volume of the reaction system was 100. mu.L. After 12 hours of incubation at 30 ℃ the reaction was stopped with 100ul of methanol, followed by brief centrifugation and supernatant was taken. Detection of the reaction product was performed by HPLC and LC-MS analysis.

(6) Product detection

The HPLC detection conditions were as follows:

the HPLC detection instrument is an Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column is ACE AQC-18column (250mm × 4.6mm, 5um), and the schaftoside and isoschaftoside mobile phase are determined to be formic acid aqueous solution (B) -methanol (C) -acetonitrile (D) with the volume concentration of 0.01% for gradient elution: 0-5 min, 90% B-10% D; 5-10 min, 82% of B-18% of D; 10-17 min, 80% B-20% C; 17-37 min, 55% B-45% C; 37-47 min, 45% B-55% C; the sample amount is 20ul, the detection wavelength is 260nm, the flow rate is 0.4ml/min, the column temperature is 25 ℃, the detector is a diode array detector, the detection result is shown in figure 7, the peak time of the product of the DhCGT2 enzyme reaction is consistent with the peak time of the standard vitexin, isovitexin, schaftoside and isoschaftoside, and the generation of flavone C-glycoside compound monosaccharide and disaccharide is preliminarily determined.

The LC-MS detection conditions were as follows:

to further confirm the reaction products detected by HPLC, Agilent 1290UPLC/6540Q-TOF liquid chromatography mass spectrometer (LC/MS) was used for detection as follows: mass spectrum conditions: the ion source adopts a positive ion mode, and the voltage: 3500V; fragmentation voltage: 135V; taper hole voltage: 60V; radio frequency voltage: 750V, scanning range: 100-1000 m/z. Chromatographic conditions are as follows: the chromatographic column is ACE AQ C-18column (250mm is multiplied by 4.6mm, 5um), and the schaftoside and the isoschaftoside are determined to be eluted by formic acid aqueous solution (B) -methanol (C) -acetonitrile (D) with the volume concentration of 0.01 percent in a gradient way: 0-5 min, 90% B-10% D; 5-10 min, 82% of B-18% of D; 10-17 min, 80% B-20% C; 17-37 min, 55% B-45% C; 37-47 min, 45% B-55% C; the detection wavelength is 260nm, the flow rate is 0.4ml/min, the column temperature is 25 ℃, the detector is a diode array detector, the detection result is shown in figures 7 and 8, figure 7 is a standard LC-MS spectrum, and figure 8 is an LC-MS spectrum of the target gene enzyme activity reaction. As can be seen from the results, the peak-out time and characteristic peaks of the reaction product are compared with the standard vitexin and isovitexin; the peak emergence times of schaftoside and isoschaftoside are matched with the results of characteristic peaks, the generated products are further confirmed to be schaftoside and isoschaftoside, and the correctness of earlier guess is further verified, as shown in fig. 9, DhCGT1 can catalyze dihydroxynaringenin to react to generate vitexin, isovitexin, schaftoside and isoschaftoside.

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

SEQ ID NO.1

SEQ ID NO.2

Sequence listing

<110> Yunnan university of agriculture

<120> carbon glycosyltransferase DhCGT2 gene in pseudo-ginseng plant and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1422

<212> DNA

<213> Artificial sequence ()

<400> 1

atgaagaaag cagcacggct tgtattcatc cctgcaccgg gagttggtca tcttgtgtcc 60

accattgagt tcgcaaagct tctaacaaat catgatcaaa atctctggat aactatattc 120

ttaatcaaac taccatttga taccacaacc tctacttaca cagaatccct agtttccttc 180

tccgaccgtg tggagatcat acaactccct gaaattatct ccaatgaccc aaaaccaacc 240

ttcgctatcc tccacctaca gaaaccaaac gtcaaagaag ccgtctcaaa actcacacct 300

actccgccac tggcagcctt cgtcgtcgac atgttctgca ccaccatgat tgaagtcgct 360

aaagagttga aggtcccttc actcgtcttc ttcacctcag atgtatcctt cctgggtgtg 420

gtccttcatc ttcacacgct tcgtgaacaa gacagcactc aattcagaga ctcccaaact 480

gagttctcca gccccgtttt tagcaacccg ctcccttcca catctttgcc tactgtcgcc 540

atcagcaagg aatgggactc tattttcttg gactacggga aaggcctcaa ggaagccgat 600

ggcattatcg taaattcatt ccaagagctc gaatcccatg cggttcactc attctctaag 660

gtggactcac gtttacctat ttatccggtt gggcccataa taaacctcaa gcccaaggcc 720

catgtcgaga gtgatgacac tgtcactgat atcctcaact ggcttgataa tcaacctcct 780

tcctcggtag tattcctgtg ctttgggagc atgggttctt ttcgtgagga acaggttagg 840

gagattgcgc atgctcttga gaatagcaag gcccggttct tgtgggccct acgaaaatcc 900

ccaccaaagg attccaagtt tttgatttct ccctctgaat atcttccctc cgaattggct 960

caagttttac cccaaggctt cttagatcgg acggctgaca tcggaaaggt cattggatgg 1020

gcccctcaga cccaagtact ggcccatcca tccacggcag gctttgtttc gcactgcggc 1080

tggaactcta ccctcgagag catatatttt ggtgttcccg ttgccacgtg gccgctttac 1140

gctgaacaac agaccaatgc atttttattg gtgcgtgagt tgaagattgc tgtggagatt 1200

tccttggatt ataaggtcga ctttaaaggt gaatctaaca ctcttttgag tgctgacaaa 1260

attgaaaaag gaatcaggag tctgctggac atggatgaag acacacgaaa gagagttaag 1320

gaaatgagtg aaaagagtaa gacgacttta ttggaaggtg gttgttccta ctctcattta 1380

cgacgtctca ttgattatat aatgaatcaa gtatcctcgt aa 1422

<210> 2

<211> 473

<212> PRT

<213> Artificial sequence ()

<400> 2

Met Lys Lys Ala Ala Arg Leu Val Phe Ile Pro Ala Pro Gly Val Gly

1 5 10 15

His Leu Val Ser Thr Ile Glu Phe Ala Lys Leu Leu Thr Asn His Asp

20 25 30

Gln Asn Leu Trp Ile Thr Ile Phe Leu Ile Lys Leu Pro Phe Asp Thr

35 40 45

Thr Thr Ser Thr Tyr Thr Glu Ser Leu Val Ser Phe Ser Asp Arg Val

50 55 60

Glu Ile Ile Gln Leu Pro Glu Ile Ile Ser Asn Asp Pro Lys Pro Thr

65 70 75 80

Phe Ala Ile Leu His Leu Gln Lys Pro Asn Val Lys Glu Ala Val Ser

85 90 95

Lys Leu Thr Pro Thr Pro Pro Leu Ala Ala Phe Val Val Asp Met Phe

100 105 110

Cys Thr Thr Met Ile Glu Val Ala Lys Glu Leu Lys Val Pro Ser Leu

115 120 125

Val Phe Phe Thr Ser Asp Val Ser Phe Leu Gly Val Val Leu His Leu

130 135 140

His Thr Leu Arg Glu Gln Asp Ser Thr Gln Phe Arg Asp Ser Gln Thr

145 150 155 160

Glu Phe Ser Ser Pro Val Phe Ser Asn Pro Leu Pro Ser Thr Ser Leu

165 170 175

Pro Thr Val Ala Ile Ser Lys Glu Trp Asp Ser Ile Phe Leu Asp Tyr

180 185 190

Gly Lys Gly Leu Lys Glu Ala Asp Gly Ile Ile Val Asn Ser Phe Gln

195 200 205

Glu Leu Glu Ser His Ala Val His Ser Phe Ser Lys Val Asp Ser Arg

210 215 220

Leu Pro Ile Tyr Pro Val Gly Pro Ile Ile Asn Leu Lys Pro Lys Ala

225 230 235 240

His Val Glu Ser Asp Asp Thr Val Thr Asp Ile Leu Asn Trp Leu Asp

245 250 255

Asn Gln Pro Pro Ser Ser Val Val Phe Leu Cys Phe Gly Ser Met Gly

260 265 270

Ser Phe Arg Glu Glu Gln Val Arg Glu Ile Ala His Ala Leu Glu Asn

275 280 285

Ser Lys Ala Arg Phe Leu Trp Ala Leu Arg Lys Ser Pro Pro Lys Asp

290 295 300

Ser Lys Phe Leu Ile Ser Pro Ser Glu Tyr Leu Pro Ser Glu Leu Ala

305 310 315 320

Gln Val Leu Pro Gln Gly Phe Leu Asp Arg Thr Ala Asp Ile Gly Lys

325 330 335

Val Ile Gly Trp Ala Pro Gln Thr Gln Val Leu Ala His Pro Ser Thr

340 345 350

Ala Gly Phe Val Ser His Cys Gly Trp Asn Ser Thr Leu Glu Ser Ile

355 360 365

Tyr Phe Gly Val Pro Val Ala Thr Trp Pro Leu Tyr Ala Glu Gln Gln

370 375 380

Thr Asn Ala Phe Leu Leu Val Arg Glu Leu Lys Ile Ala Val Glu Ile

385 390 395 400

Ser Leu Asp Tyr Lys Val Asp Phe Lys Gly Glu Ser Asn Thr Leu Leu

405 410 415

Ser Ala Asp Lys Ile Glu Lys Gly Ile Arg Ser Leu Leu Asp Met Asp

420 425 430

Glu Asp Thr Arg Lys Arg Val Lys Glu Met Ser Glu Lys Ser Lys Thr

435 440 445

Thr Leu Leu Glu Gly Gly Cys Ser Tyr Ser His Leu Arg Arg Leu Ile

450 455 460

Asp Tyr Ile Met Asn Gln Val Ser Ser

465 470

<210> 3

<211> 42

<212> DNA

<213> Artificial sequence ()

<400> 3

cagcaaatgg gtcgcggatc ccgatgaaga aagcagcacg gc 42

<210> 4

<211> 60

<212> DNA

<213> Artificial sequence ()

<400> 4

tggtggtgct cgagtgcggc ccgcaattac gaggatactt gattcattat ataatcaatg 60

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence ()

<400> 5

atgaagaaag cagcacggc 19

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 6

ttacgaggat acttgattca ttatataatc aatg 34

Claims

1. Carbon glycosyltransferase in pseudo-ginseng plantDhCGT2A gene characterized by a carbon glycosyltransferase in a plant of pseudo-ginsengDhCGT2The gene nucleotide sequence is shown in SEQ ID NO. 1.

2. The c-glycosyltransferase of the pseudo-ginseng plant of claim 1DhCGT2The coding protein of the gene is characterized in that the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.

3. A plant-medium carbon glycosyltransferase comprising the pseudolarix kawakamii of claim 1DhCGT2Recombinant plasmid of target gene in gene.

4. The c-glycosyltransferase of claim 3 of a plant containing pseudo-ginsengDhCGT2A recombinant plasmid of a target gene among genes, characterized in that a c-glycosyltransferase of Vicia faba is introducedDhCGT2The gene and pET28a vector homologous recombination, obtain pET28a-DhCGT2 recombinant plasmid.

5. A genetically engineered bacterium comprising the recombinant plasmid of claim 1, or having the carbon-glycosyltransferase of claim 1 incorporated into the genome of the genetically engineered bacteriumDhCGT2A gene.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is Escherichia coli BL21DE 3.

7. The c-glycosyltransferase of the pseudo-ginseng plant of claim 1DhCGT2The gene is used in preparing vitexin, isovitexin, schaftoside and isoschaftoside.

8. The c-glycosyltransferase of claim 7 in a pseudo-ginseng plantDhCGT2The application of the gene in preparing vitexin, isovitexin, schaftoside and isoschaftoside is characterized in that: dihydroxynaringenin is used as a substrate, UDP-glucose and UDP-arabinose are used as sugar donors, and the carbon glycosyl transferase is usedDhCGT2The carbon glycosyltransferase DhCGT2 obtained by gene coding can catalyze to generate a flavone carbon glycoside compound;

the first step of carbon glycosylation reaction is to connect glucose on C-6 position or C-8 position of dihydroxynaringenin to generate vitexin or isovitexin, and the second step of glycosylation reaction is to generate vitexin or isovitexin as substrate to connect arabinose on C-6 position or C-8 position, thereby generating schaftoside or isoschaftoside.