CN113736758B

CN113736758B - Bergenia oxymethyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxy gallic acid

Info

Publication number: CN113736758B
Application number: CN202111040376.1A
Authority: CN
Inventors: 张广辉; 刘祥宇; 陈碧环; 王益娜; 袁慧娟; 向贵生; 张敬丽; 郝冰
Original assignee: Yunnan Agricultural University
Current assignee: Yunnan Agricultural University
Priority date: 2021-09-06
Filing date: 2021-09-06
Publication date: 2023-05-09
Anticipated expiration: 2041-09-06
Also published as: CN113736758A

Abstract

The invention discloses a bergenia oxymethyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxy gallic acid. The sequence of the bergenia oxymethyl transferase BpOMT1 gene is shown in SEQ ID NO: 1. Gallic acid and S-adenosyl-methionine are used as raw materials, 4-methoxy gallic acid is generated under the catalysis of bergenia oxygen methyl transferase BpOMT1, and the method has important significance for the research of bergenin biosynthesis regulation.

Description

Bergenia oxymethyltransferase BpOMT1 gene and application thereof in preparation of 4-methoxy gallic acid

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a bergenia oxygen methyl transferase BpOMT1 gene and application thereof in preparation of 4-methoxy gallic acid.

Background

Bergenia (Bergenia purpurascens) is a plant of Bergenia (Bergenia) of Saxifragaceae. The plant of the genus Asia has 10 kinds in total, and is mainly distributed in regions of Shanxi (Qinling mountain), xinjiang, sichuan, yunnan and Tibet, except 3 kinds of plant which are produced in the east Asia, the north Asia and the south east Asia. The whole plant of bergenia contains bergenin, especially bergenin extracted from root and stem of bergenia is up to 8.2%. Bergenin has various effects of relieving cough, anti-inflammatory, anxiolytic, antioxidant, antimalarial, anticancer, treating diabetes, anti-hepatotoxicity, immunomodulation and neuroprotection etc. (Shihao Xiang, bergenin Exerts Hepatoprotective Effects by Inhibiting the Release of Inflammatory Factors, apoptosis and Autophagy via the PPAR-gamma Pathway. Drug Des development Ther.2020; 14:129-143.). Different from morphine inhibitory center cough-relieving medicines, domestic and foreign scholars also find that bergenin has selective inhibitory effect on cough centers, has no inhibitory effect on other nerve centers, has the characteristics of small toxic and side effects, less adverse reactions, no drug resistance after continuous use and the like (Wang Jin, research on human and animal pharmacokinetics of bergenin and the action of bergenin on IGABA, university of Shandong, 2010).

Bergenin is an isocoumarin compound, wherein the bergenin biosynthesis precursor is 2-glucose-4-methoxy gallic acid which is rearranged after intramolecular dehydration (rearrangement after intramolecular dehydration) or is generated in a closed loop under the action of unknown dehydratase (dehydatase) (Gan B.Bajracharya.diversity, pharmacology and synthesis of bergenin and its derivatives: potential materials for therapeutic usages.Fisterapia.2015; 101:133-52.); 2-glucose-4-methoxy gallic acid is produced by connecting 4-methoxy gallic acid with glucose at the 2-position by using uridine diphosphate (UDP-glucose) as a glycosyl donor under the catalysis of glycosyltransferase (CGT, C-glucosyltransferase); 4-methoxy Gallic acid (4-O-Methylgallic acid, 4-O-ME-GA) is derived from Gallic Acid (GA) and is produced by catalyzing an S-adenosyL-methionine (SAM) with an O-methyltransferase (OMT) as a methyl donor, so that the biosynthesis of 4-methoxy Gallic acid has important significance for the research on the regulation of bergenin biosynthesis.

In recent years, the wild resources of bergenia medicinal materials are increasingly reduced due to disordered mining of human beings and the like. The research on the bergenin biosynthesis pathway is developed, so that a foundation can be provided for the artificial cultivation measures of bergenia and the content of medicinal components is improved, and the pressure of wild resources is relieved. Meanwhile, the bergenin extraction raw material has long planting period and higher requirements on planting plots and planting technologies. Therefore, how to obtain these useful secondary metabolites efficiently has been a problem for scientific researchers to think and study. For natural products with high added value, the establishment of homologous or heterologous expression systems by adopting modern biotechnology for efficiently producing the medicinal active ingredients is widely regarded as an important technical means for solving the shortage of medicinal resources in the future. However, to identify the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes involved in these pathways, and to explore these catalytic enzyme genes as key links in the study of plant metabolite biosynthetic pathways. At present, the synthetic route of the gallic acid catalyzed by methylation reaction of the hydroxyl at the C-4 position to form 4-methoxy gallic acid is not clear, and the function of the oxymethyl transferase responsible for methylation is not verified yet, so that the promotion of bergenin biosynthesis work is influenced.

Disclosure of Invention

In order to solve the technical problem of how to obtain a large amount of high-purity 4-methoxy gallic acid biosynthesis, the invention provides a bergenia oxo methyl transferase BpOMT1 gene which can be used as a biosynthesis regulatory gene of 4-methoxy gallic acid and applied to preparation of 4-methoxy gallic acid.

The invention provides a bergenia oxymethyltransferase BpOMT1 gene, the nucleic acid sequence of which is shown in SEQ ID NO:1, the total length of the sequence is 1077bp.

The invention also provides bergenia oxygen methyl transferase BpOMT1, which is obtained by encoding the bergenia oxygen methyl transferase BpOMT1 gene, and encodes 358 amino acid residues, wherein the amino acid sequence of the bergenia oxygen methyl transferase BpOMT1 is shown as SEQ ID NO: 2.

The invention also provides a recombinant plasmid containing the bergenia oxymethyl transferase BpOMT1 gene.

Preferably, the recombinant plasmid is obtained by homologous recombination of bergenia oxymethyl transferase BpOMT1 gene and pET28a vector, and is named pET28a-BpOMT1.

The invention also provides a transgenic engineering bacterium which contains the recombinant plasmid, or the exogenous bergenia oxymethyl transferase BpOMT1 gene is integrated in the genome of the genetically engineered bacterium.

Preferably, the transgenic engineering bacteria are escherichia coli BL21 (DE 3) strains.

The invention also provides application of the bergenia oxygen methyl transferase BpOMT1 in preparation of 4-methoxy gallic acid.

Preferably, in the application of bergenia oxymethyl transferase BpOMT1 in preparing 4-methoxy Gallic acid, gallic acid and methyl donor S-adenosyl-methionine are used as raw materials, and under the catalysis of bergenia oxymethyl transferase (amino acid series is shown as SEQ ID NO: 2) obtained by encoding the bergenia oxymethyl transferase BpOMT1 gene, methylation reaction is carried out on hydroxyl on C-4 position of Gallic acid (Galic acid) to generate 4-methoxy Gallic acid (4-O-Methylgallic acid, 4-O-ME-GA).

The invention also provides a primer for cloning the bergenia oxygen methyl transferase BpOMT1 gene, wherein the primer consists of a primer F and a primer R, and the nucleotide sequence of the primer F is shown as SEQ ID NO:3, the nucleotide sequence of the primer R is shown as SEQ ID NO: 4.

The invention obtains target protein (bergenia oxymethyl transferase BpOMT 1) through recombinant plasmid after in vitro expression, and directly generates 4-methoxy gallic acid through further catalyzing substrate gallic acid.

The bergenia oxymethyltransferase BpOMT1 gene is identified from the rhizome of bergenia through transcriptome sequencing and bioinformatics technology, and is screened after a large number of experiments; extracting the RNA of the bergenia root and stem by adopting an RNA reagent, carrying out reverse transcription to form cDNA, and carrying out PCR amplification to obtain the bergenia root and stem.

Compared with the prior art, the invention has the beneficial effects that:

(1) With the rapid development of bioinformatics technology, the excavation of key enzyme genes of the 4-methoxy gallic acid biosynthesis path is greatly promoted. The biosynthesis regulating gene of 4-methoxy gallic acid, namely the oxymethyl transferase BpOMT1 gene, is first identified and successfully verified, and opens up a novel biosynthesis method for producing 4-methoxy gallic acid. The invention obtains the target product through heterologous expression and in-vitro enzyme catalysis, adopts in-vitro biosynthesis to carry out directional production, and has the advantages of less byproducts and the like.

(2) The invention provides a recombinant plasmid, genetically engineered bacterium and recombinant protein containing bergenia oxygen methyl transferase BpOMT1 gene, which lays a foundation for synthesizing a large amount of 4-methoxy gallic acid by a bioengineering method and further for bergenia element biosynthesis regulation and control research.

(3) The 4-methoxy gallic acid is synthesized by in vitro biology, the controllability is strong, the requirement on raw material planting can be reduced, the production product is single, and the separation and purification of the 4-methoxy gallic acid in the later stage are convenient; can also reduce the problems of difficult chemical synthesis, complex synthesis path and the like. The bergenia oxygen methyl transferase BpOMT1 gene is used as a key gene for biosynthesis of 4-methoxy gallic acid, and can also be used for plant breeding research of bergenia and the like.

(4) The bergenia oxymethyltransferase BpOMT1 gene separated and identified from bergenia is used as an important marker gene for molecular auxiliary breeding of bergenia and also as an important candidate gene for producing 4-methoxy gallic acid in construction of yeast chassis cells.

SEQ ID NO:1 shows the nucleotide sequence of bergenia oxymethyl transferase BpOMT1 gene.

SEQ ID NO:2 shows the amino acid sequence of bergenia oxymethyl transferase BpOMT1.

SEQ ID NO:3 shows the nucleotide sequence of primer F.

SEQ ID NO:4 shows the nucleotide sequence of primer R.

SEQ ID NO:5 shows the nucleotide sequence of the upstream homology arm primer.

SEQ ID NO: shown at 6 is the nucleotide sequence of the downstream homology arm primer.

Drawings

FIG. 1 is a schematic diagram of the synthetic route deduced from 4-methoxy gallic acid.

FIG. 2 is a schematic diagram of the construction of recombinant expression plasmid pET28a-BpOMT1 (for expression of bergenia oxymethyl transferase BpOMT1 gene).

FIG. 3 shows the result of electrophoresis detection of bergenia oxymethyl transferase BpOMT1 after gene recombination. Wherein M is a nucleic acid Marker, and 1, 2 and 3 are three positive single colony detection results.

FIG. 4 shows the SDS-PAGE protein electrophoresis of bergenia oxymethyl transferase BpOMT1. Wherein M: protein molecular mass standard;

lanes

1, 2, 3, 4, 5, 6, 7 are respectively sediment, flow-through eluent, 20mmol/L imidazole eluent, 30mmol/L imidazole eluent, 50mmol/L imidazole eluent, 100mmol/L imidazole eluent, 250mmol/L imidazole eluent protein.

FIG. 5 shows HPLC detection of methylation of the hydroxy group at the C-4 position of Gallic acid (Gallicic acid) by the oxymethyl transferase BpOMT1. Fig. 5A: a putative methylation pathway at the hydroxyl group at the C-4 position of Gallic Acid (GA); fig. 5B: the enzyme activity reaction result of bergenia oxymethyl transferase BpOMT1, the abscissa is time, unit min; the ordinate is the response value, the unit is mAU; wherein, CK: enzyme activity reaction results of enzyme inactivation of a control group (gallic acid+S-adenosyl-methionine+inactivated bergenin methyltransferase BpOMT 1); and (5) marking: gallic acid standard substance+4-methoxy gallic acid standard substance; bpOMT1: results of the enzymatic activity reaction of the experimental group (gallic acid + S-adenosyl-methionine + bergenia oxymethyl transferase BpOMT 1).

FIG. 6 is a mass spectrometry (LC/MS/MS) spectrum of a standard, wherein FIG. 6-A is a total ion flow diagram;

FIG. 6-B shows the retention time of gallic acid as standard for 15.96 minutes; FIG. 6-C shows the retention time of 4-methoxy gallic acid as a standard for 23.26 minutes.

FIG. 7 is a mass spectrometry (LC/MS/MS) spectrum of the enzyme activity verification reaction product, wherein FIG. 7-A is a total ion flow diagram; FIG. 7-B shows the retention time of gallic acid as substrate for 15.45 minutes; FIG. 7-C shows the retention time of 4-methoxy gallic acid as a reaction product of 23.86 minutes.

FIG. 8 shows the fragment ion (theoretical molecular weight 184) of 4-methoxy gallic acid as a standard (LC/MS/MS).

FIG. 9 shows the fragment ion (theoretical molecular weight 184) of 4-methoxy gallic acid (LC/MS/MS) as a reaction product.

Detailed Description

Example 1

Screening OMT candidate genes in sequencing annotation results based on the basic functional annotation information of the bergenia transcriptome Unigene, simultaneously carrying out sequence local BLAST analysis by using the identified oxymethyl transferase (OMT) in plants, carrying out finishing analysis on the screening results, and finally discovering 1 oxymethyl transferase (OMT) gene. Then, a series of works such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in-vitro enzyme activity reaction, HPLC and LC/MS/MS detection are carried out, and finally the target candidate oxymethyl transferase BpOMT1 gene (figure 1) capable of catalyzing methylation reaction on hydroxyl on C-4 position of Gallic acid is identified. The operation steps of each stage of the synthesis of 4-methoxy gallic acid are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

(1) Preparation of cDNA templates

Taking a fresh sample of bergenia root and stem, slicing, quickly freezing with liquid nitrogen, and extracting total RNA. The total RNA is extracted by adopting a HiPure Plant RNA Mini Kit kit of Magen (American-based biotechnology Co., ltd.) according to the operation steps of the kit, and after the total RNA is detected to be qualified, the total RNA is reversely transcribed into cDNA by using a TAKARA reverse transcription kit, and the cDNA is preserved at-20 ℃ for standby.

(2) Gene amplification and recovery

The primer for amplifying bergenia oxymethyltransferase BpOMT1 gene is designed by using primer Design software (CE Design) v1.04, and consists of a primer F (SEQ ID NO: 3) and a primer R (SEQ ID NO: 4), and is operated according to a high-fidelity KOD enzyme using instruction manual, and the bergenia cDNA is used as a template for gene amplification by adopting the KOD high-fidelity enzyme. The PCR reaction procedure was: 94 ℃ for 5min;94 ℃, 30S,58 ℃, 50S,72 ℃, 1min,35 cycles; 72 ℃ for 7min. After the PCR is completed, running the gel, and recovering the target band after confirming that the amplification is successful. The gene cutting gel was recovered and the target gene was recovered using EasyPure Quick Gel Extraction Kit kit from Beijing full gold biotechnology Co., ltd. After recovery, the recovery concentration is measured on a NanoReady ultra-micro ultraviolet visible spectrophotometer, and finally the recovered concentration is put into a refrigerator at the temperature of minus 20 ℃ for standby, so that the bergenia oxymethyl transferase BpOMT1 gene fragment is obtained, and the nucleic acid sequence is shown as SEQ ID NO: 1.

In addition, when the bergenia oxymethyl transferase BpOMT1 gene fragment with the homologous arm of the carrier and the carrier pET28a are subjected to homologous recombination (the homologous arm is escherichia coli pET28 a), the bergenia oxymethyl transferase BpOMT1 gene needs to be amplified and recovered by using a primer with the homologous arm (namely the homologous arm primer), wherein the homologous arm primer consists of an upstream homologous arm primer (shown as SEQ ID NO:5 in a sequence table) and a downstream homologous arm primer (shown as SEQ ID NO:6 in the sequence table), the bergenia oxymethyl transferase BpOMT1 gene is used as a template, the PCR amplification is performed again according to the high-fidelity KOD enzyme using specification, and the bergenia oxymethyl transferase BpOMT1 gene fragment with the homologous arm of the carrier is obtained.

Upstream homology arm primer: atgggtcgcggatcc ATGGCTCCACAAAATGAAGCAG (SEQ ID NO: 5).

Downstream homology arm primer:

acggagctcgaattcggatccCTACTTCAAGAATTCCATGATATAAGAATTGAAAGC (SEQ ID NO: 6).

The upstream homology arm primer (SEQ ID NO: 5) and the downstream homology arm primer (SEQ ID NO: 6) are represented by lower case letters representing pET28a homology arms, and capital letters representing amplified bergenia oxymethyl transferase BpOMT1 gene primer sequences.

(3) Construction and identification of Gene recombination vectors

A schematic diagram of homologous recombination is shown in FIG. 2. The vector pET28a was first linearized and a single cleavage with BamH I enzyme was performed to obtain a linearized vector. During homologous recombination, assembling according to the operation instruction of homologous recombinase, and then calculating the consumption of each component according to the recombination instruction according to the concentration of the bergenia oxymethyl transferase BpOMT1 gene fragment inserted into the homologous arm with the carrier and the pET28a carrier; and finally, adding the components into a PCR reaction tube on ice, and carrying out homologous recombination on bergenia oxymethyl transferase BpOMT1 gene and a pET28a vector to obtain a recombinant plasmid which is named pET28a-BpOMT1. The results after assembly are detected and sent to the company for sequencing, and the electrophoresis detection results after assembly are shown in figure 3, which shows that the assembly is successful. The method comprises the following steps of:

table 1 candidate Gene recombination reaction System

Wherein, x= (0.02×pet28a base pair number) ng/linearising pET28a concentration ng/μl; and Y= (0.02×pET28a base pair) ng/bergenia oxymethyl transferase BpOMT1 recovery concentration ng/. Mu.L, wherein the inserted gene fragment is a bergenia oxymethyl transferase BpOMT1 gene fragment inserted with a carrier homology arm.

(4) SDS-PAGE protein electrophoresis detection

Protein induction conditions of BpOMT1 were determined after protein expression experiments as follows: 17 ℃ and 0.1mM IPTG, 220r/min, and inducing for 12h; then shaking greatly, collecting bacteria, breaking cell wall, centrifuging at high speed (12000 r/min) to obtain protein supernatant, and performing SDS-PAGE protein electrophoresis and detection. The detection result is shown in FIG. 4, and FIG. 4 shows that BpOMT1 protein can be eluted and purified under the condition of 250mmol/L imidazole eluent.

(5) Enzymatic reaction

The enzymatic activity of bergenia oxymethyl transferase BpOMT1 was determined by methylation to 4-methoxy gallic acid in a 1.5mL centrifuge tube. The mixture in the experimental sample reaction system comprises: 100mM S-adenosyl-methionine 2. Mu.l, 100mM gallic acid 2. Mu.l, 40. Mu.g purified bergenia oxymethyl transferase BpOMT1, 50mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100. Mu.l, and the total volume of the reaction system was 100. Mu.l. After 2 hours of incubation at 31℃the 1M hydrochloric acid was stopped in an equal volume, and the supernatant was removed by brief centrifugation (12000 r/min). Finally, the reaction product was detected by HPLC and LC-MS/MS analysis.

Control (CK) reaction system: 100mM gallic acid 2. Mu.l, 100mM S-adenosyl-methionine 2. Mu.l, 40. Mu.g of inactivated purified bergenia oxymethyl transferase BpOMT1 was added with 50mM Tris-HCl buffer (pH 8.0) to a total volume of 100. Mu.L, and the total volume of the reaction system was 100. Mu.L.

And (5) marking: 50. Mu.l of 10mM gallic acid standard and 50. Mu.l of 10mM 4-methoxy gallic acid standard.

(6) Product detection

The HPLC detection conditions were as follows:

the instrument used for HPLC detection is Agilent 1290 ultra-high performance liquid chromatograph. The column was XBridge Shield RP (4.6 mm. Times.250 mm,5 μm) column temperature: 30 ℃; determination of the mobile phase of 4-methoxy gallic acid 0.01% v/v formic acid in water (A) -acetonitrile (B), gradient elution: 0-8 min, 1-5% B; 8-13 min, 5-10% B; 13-20 min, 10-20% B; 20-25 min, 20-45% B; 25-35 min, 45-90% B; 35-40 min, 90-90% B; elution time: for 40min; sample injection amount: 10 microliters; flow rate: 0.6ml/min; the detection wavelength is 230nm. The detection result is shown in fig. 5, which shows that the experimental sample has the production of 4-methoxy gallic acid under the catalysis of bergenia oxymethyl transferase BpOMT1.

LC-MS/MS detection conditions were as follows:

to further confirm the reaction products detected by HPLC, detection was performed using an Agilent 1290UPLC/6540Q-TOF liquid chromatography mass spectrometer (LC/MS/MS): mass spectrometry conditions: the ion source adopts a negative ion mode and voltage: 3500V; the fragmentation voltage is 135V; the taper hole voltage is 60V; radio frequency voltage 750V, scanning range: 100-1000m/z, scanning mode: and SRM. Chromatographic conditions: the column was XBridge Shield RP (4.6 mm,. Times.250 mm,5 μm) column temperature: measurement of the mobile phase of 4-methoxy gallic acid at 30℃was 0.01% v/v aqueous formic acid (A) -acetonitrile (B), gradient elution: 0-8 min, 1-5% B; 8-13 min, 5-10% B; 13-20 min, 10-20% B; 20-25 min, 20-45% B; 25-35 min, 45-90% B; 35-40 min, 90-90% B; elution time: for 40min; sample injection amount: 10 microliters; flow rate: 0.6ml/min; the detection wavelength is 230nm.

The detection results are shown in fig. 6-9, and the results show that the peak time and the characteristic crushed ions of the product are identical to those of the standard 4-methoxy gallic acid, and the reaction product is confirmed to be 4-methoxy gallic acid. Finally, the obtained oxymethyl transferase BpOMT1 has the capability of catalyzing the oxygen at the C4 position of gallic acid to carry out one-time methylation to generate 4-methoxy gallic acid.

Sequence listing

<110> university of agriculture in Yunnan

<120> bergenia oxymethyl transferase BpOMT1 gene and application thereof in preparation of 4-methoxy gallic acid

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1077

<212> DNA

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 1

atggctccac aaaatgaagc agcagcagct gaagaagaag caaacctatt tgccatgcaa 60

ctagcaagtg catcagtctt accaatggta cttaaatcag ccatagaact agaccttcta 120

gaaatcatgg ctaaatctgg cccaggtgca tacatgtcac ccatagatat agcctctcag 180

cttcctacaa acaatccaga tgcacctgtc atgctcgacc gcattttgcg cctgctagca 240

tgctactctg ttctcacttg ctctgtccga aatctccctg atggccgtgt tgagaggctt 300

tatggtctgg cacctgtttg taagtacttg accaagaatg aggaaggtgt ctctattgct 360

gctctttgtc tcatgaatca agacaagatc ctcatggaga gctggtacca cttgaaagat 420

gcagttcttg atggtggcat tccattcaac aaggcttatg gaatgtctgc cttcgagtac 480

cacggcacgg atcctagatt caacaaggtt tttaacaggg gaatgtctga tcactcaaca 540

attaccatga agaaaatcct tgagacatac aaaggatttg agggactcac atctgtcgtc 600

gacgttggtg gtggtactgg agccactctt aacatgatcc tctccaagta tcccaacatt 660

aggggcatta actttgattt gcctcatgtg attgaggatg ccccatctta tcctggtgtg 720

gagcatgttg gaggagacat gtttgttagt gttccaaaag gggatgctat tttcatgaag 780

tggatatgtc atgactggag cgacgaacac tgcttgaaat ttttgaagaa ttgctatgat 840

gcacttccga gcaatgggaa ggtgattctt gctgaatgca ttcttccagt aacgccggac 900

actagccttg caactaaagg agttgtccat atcgatgtga tcatgttagc gcataatcca 960

ggagggaagg aaaggactga gaaggagttt gaggccttgg caaaaggtgc tggatttcaa 1020

ggcttccaag tattctgcaa tgctttcaat tcttatatca tggaattctt gaagtag 1077

<210> 2

<211> 358

<212> PRT

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 2

Met Ala Pro Gln Asn Glu Ala Ala Ala Ala Glu Glu Glu Ala Asn Leu

1 5 10 15

Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu Pro Met Val Leu Lys

20 25 30

Ser Ala Ile Glu Leu Asp Leu Leu Glu Ile Met Ala Lys Ser Gly Pro

35 40 45

Gly Ala Tyr Met Ser Pro Ile Asp Ile Ala Ser Gln Leu Pro Thr Asn

50 55 60

Asn Pro Asp Ala Pro Val Met Leu Asp Arg Ile Leu Arg Leu Leu Ala

65 70 75 80

Cys Tyr Ser Val Leu Thr Cys Ser Val Arg Asn Leu Pro Asp Gly Arg

85 90 95

Val Glu Arg Leu Tyr Gly Leu Ala Pro Val Cys Lys Tyr Leu Thr Lys

100 105 110

Asn Glu Glu Gly Val Ser Ile Ala Ala Leu Cys Leu Met Asn Gln Asp

115 120 125

Lys Ile Leu Met Glu Ser Trp Tyr His Leu Lys Asp Ala Val Leu Asp

130 135 140

Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser Ala Phe Glu Tyr

145 150 155 160

His Gly Thr Asp Pro Arg Phe Asn Lys Val Phe Asn Arg Gly Met Ser

165 170 175

Asp His Ser Thr Ile Thr Met Lys Lys Ile Leu Glu Thr Tyr Lys Gly

180 185 190

Phe Glu Gly Leu Thr Ser Val Val Asp Val Gly Gly Gly Thr Gly Ala

195 200 205

Thr Leu Asn Met Ile Leu Ser Lys Tyr Pro Asn Ile Arg Gly Ile Asn

210 215 220

Phe Asp Leu Pro His Val Ile Glu Asp Ala Pro Ser Tyr Pro Gly Val

225 230 235 240

Glu His Val Gly Gly Asp Met Phe Val Ser Val Pro Lys Gly Asp Ala

245 250 255

Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp Glu His Cys Leu

260 265 270

Lys Phe Leu Lys Asn Cys Tyr Asp Ala Leu Pro Ser Asn Gly Lys Val

275 280 285

Ile Leu Ala Glu Cys Ile Leu Pro Val Thr Pro Asp Thr Ser Leu Ala

290 295 300

Thr Lys Gly Val Val His Ile Asp Val Ile Met Leu Ala His Asn Pro

305 310 315 320

Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu Ala Leu Ala Lys Gly

325 330 335

Ala Gly Phe Gln Gly Phe Gln Val Phe Cys Asn Ala Phe Asn Ser Tyr

340 345 350

Ile Met Glu Phe Leu Lys

355

<210> 3

<211> 22

<212> DNA

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 3

atggctccac aaaatgaagc ag 22

<210> 4

<211> 36

<212> DNA

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 4

ctacttcaag aattccatga tataagaatt gaaagc 36

<210> 5

<211> 37

<212> DNA

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 5

atgggtcgcg gatccatggc tccacaaaat gaagcag 37

<210> 6

<211> 57

<212> DNA

<213> bergenia crassifolia (Bergenia purpurascens)

<400> 6

acggagctcg aattcggatc cctacttcaa gaattccatg atataagaat tgaaagc 57

Claims

1. A bergenia oxymethyl transferase BpOMT1 gene has a nucleic acid sequence shown in SEQ ID NO: 1.

2. Bergenia oxymethyltransferase BpOMT1 has an amino acid sequence shown in SEQ ID NO: 2.

3. A recombinant plasmid comprising the bergenia oxymethyl transferase BpOMT1 gene of claim 1.

4. A recombinant plasmid according to claim 3, characterized in that it is obtained by homologous recombination of the bergenia oxymethyl transferase BpOMT1 gene according to claim 1 with a pET28a vector, designated pET28a-BpOMT1.

5. A transgenic engineering bacterium, characterized in that the recombinant plasmid of claim 3 or 4 is contained, or the exogenous bergenia oxymethyl transferase BpOMT1 gene of claim 1 is integrated in the genome of the transgenic engineering bacterium.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is a strain of e.coli BL21 (DE 3).

7. Use of bergenia oxymethyl transferase BpOMT1 according to claim 2 for the preparation of 4-methoxy gallic acid.

8. The use according to claim 7, characterized in that 4-methoxy gallic acid is produced from gallic acid and S-adenosyl-methionine under the catalysis of bergenia oxymethyl transferase BpOMT1 according to claim 2.

9. A primer for cloning bergenia oxymethyl transferase BpOMT1 gene according to claim 1, wherein the primer consists of primer F and primer R, the nucleotide sequence of the primer F is shown in SEQ ID NO:3, the nucleotide sequence of the primer R is shown as SEQ ID NO: 4.