CN117778422A - Radix dipsaci arabinosyl transferase DaUGT044 gene and application thereof - Google Patents

Abstract

The invention discloses a teasel root arabinosytransferase DaUGT044 gene and application thereof in preparing a precursor, gnonia first saponin A for synthesizing teasel root saponin VI. The invention has the advantages that: taking Hederagenin and uridine diphosphate-arabinose as raw materials, and carrying out glycosylation reaction on hydroxyl at C-3 position of Hederagenin (Hederagenin) under the catalysis of radix dipsaci arabinosyltransferase obtained by encoding radix dipsaci arabinosyltransferase DaUGT044 gene to generate the gnomonic acid celestial saponin A (Cauloside A). The gene DaUGT044 separated and identified from the teasel root can lay a foundation for industrially producing the teasel root saponin VI and other triterpene saponins, and can also be used as an important marker gene for molecular auxiliary breeding of the teasel root.

Description

Radix dipsaci arabinosyl transferase DaUGT044 gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a teasel root arabinosyltransferase DaUGT044 gene and application thereof.

Background

Radix DipsaciDipsacus Asperoides) Is perennial herb of Dipsacus genus of Dipsacaceae. Takes rhizome as medicine, is the only basic source for recording the Chinese medicinal materials of dipsacus root in Chinese pharmacopoeia (2020 edition)And (5) a plant. Radix Dipsaci has effects of nourishing liver and kidney, strengthening tendons and bones, continuing fracture injury, and stopping metrorrhagia, and can be used for treating liver and kidney deficiency, soreness of waist and knees, rheumatalgia, traumatic injury, tendons injury fracture, metrorrhagia, and miscarriage, etc., and is a common bulk Chinese medicinal material for traumatology and gynecology. The chemical components mainly comprise triterpenes, saponins, alkaloids, iridoid glycosides, volatile oil compounds and the like. Dipsacus asperoides saponin VI is index component of Dipsacus asperoides medicinal material specified in pharmacopoeia, and is also main active component of Dipsacus asperoides.

In recent years, along with the continuous reduction of wild resources of radix dipsaci, the use of synthetic biology for producing pharmacodynamic monomers is one of key ways, but at present, the biosynthetic ways of the pharmacodynamic monomers are not clear enough, such AS radix dipsaci saponin VI in radix dipsaci is oleanane-type saponin of pentacyclic triterpene, the synthesis of the oleanane-type saponin begins from 2, 3-oxidation squalene, beta-amyrin is formed under the catalysis of beta-AS, then CYP450s is oxidized and modified to form aglycone hederagenin of radix dipsaci triterpenoid saponin, and finally, the triterpenoid saponin such AS radix dipsaci saponin VI, radix dipsaci saponin B and the like is formed through glycosyltransferase modification, wherein arabinosylation is the first key step. However, currently, few UGTs which can catalyze arabinosylation in triterpenes are found, but UGTs which can catalyze arabinosylation of Chuan rattan sapogenin C-3 in teasel roots are not found yet, so that analysis of the way of biosynthesis of triterpene saponins such as teasel root saponin VI in teasel roots is influenced, and the method is one of the biggest barriers for industrial production of the triterpene saponins.

Disclosure of Invention

In view of the above problems, the present invention aims to provide a radix Dipsaci arabinosyl transferase DaUGT044 gene.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

a teasel root arabinosyl transferase DaUGT044 gene, wherein the nucleic acid sequence of the teasel root arabinosyl transferase DaUGT044 gene is shown in SEQ ID NO: 1.

The amino acid sequence of the protein encoded by the teasel root arabinosyltransferase DaUGT044 gene is shown as SEQ ID NO: 2.

The invention also provides a recombinant plasmid containing the teasel root arabinosyltransferase DaUGT044 gene.

The teasel root arabinosytransferase DaUGT044 gene is obtained by homologous recombination with a pET28a vector and is named pET28a-DaUGT044.

The invention also provides a transgenic engineering bacterium which contains the recombinant plasmid or the genome of the transgenic engineering bacterium is integrated with the exogenous radix dipsaci arabinosyl transferase DaUGT044 gene.

The transgenic engineering bacteria are escherichia coli BL21 (DE 3) strains.

The invention also provides an application of the teasel root arabinosytransferase DaUGT044 gene in preparing teasel root saponin VI.

The invention also provides a preparation method of the gnonianic rock-curculin A for synthesizing the dipsacus root saponin VI, which comprises the following steps: taking hederagenin and uridine diphosphate-arabinose as raw materials, and carrying out glycosylation reaction on hydroxyl on the C-3 position of the hederagenin under the catalysis of teasel root arabinosyltransferase obtained by encoding teasel root arabinosyltransferase DaUGT044 genes to generate the gnomonic acid celestial saponin A.

Preferably, the preparation method comprises the following steps:

(1) Preparing a cDNA template;

(2) Amplifying and recovering genes;

(3) Constructing and identifying a gene recombinant vector;

(4) Protein expression and purification of candidate gene DaUGT 044;

(5) And (5) enzyme activity reaction.

Preferably, the preparation method of the cDNA template in the step (1) comprises the following steps: taking fresh roots, stems and leaves of dipsacus root, slicing, quickly freezing with liquid nitrogen, extracting RNA, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit, and preserving at-20 ℃ for later use;

the gene amplification and recovery in the step (2) comprises the following steps: using the reverse transcription to cDNA as a template, adopting DNA polymerase to carry out gene amplification, adding 2 μl of cDNA and 2x phantaMax Master mix25 μl of cDNA, respectively adding 2 μl of upstream and downstream primers, and supplementing ddH2O to 50 μl, wherein the amplification system is as follows: 95 ℃ and 3min,95 ℃ and 15s and 55 ℃ and 15s and 72 ℃ and 1min, and 36 cycles; 72 ℃ and 5min; recovering the target gene by using the kit, and storing in a refrigerator at-20 ℃ for later use;

the construction and identification of the gene recombinant vector in the step (3) comprises the following steps: linearizing a vector, carrying out gene recombination and detecting bacteria water; the vector linearization is to carry out single enzyme digestion on pET-28a by utilizing endonuclease BamHI to obtain a linearization vector pET-28a, purify and recycle the linearization vector pET-28a by using a kit, and measure the concentration of the linearization vector pET-28a and store the linearization vector pET-28a in a refrigerator at the temperature of minus 20 ℃ for later use; the gene recombination is to connect the target gene obtained by amplifying the kit with a linearized pET-28a carrier, and transform the strain intoE.coliBL21 (DE 3) competence; in the PCR amplification in the bacteria water detection, the PCR program is for 35 cycles of 95 ℃,3min,95 ℃,30s,55 ℃,15s,72 ℃, 30/kb; 72 ℃ for 5min; obtaining bacterial liquid;

protein expression in step (4): resuscitating the bacterial liquid at 37 ℃ and 220rpm/min, inoculating to kanamycin LB liquid culture medium for expansion culture, and adding IPTG to perform protein induction expression at low temperature; protein purification: after the induced expression is finished, centrifugally collecting thalli, re-suspending thalli by buffer solution, breaking bacteria, centrifuging at high speed, loading supernatant onto a Ni-NTA agarose affinity column, eluting by using imidazole passing columns with different concentrations, collecting filtrate, and detecting results of eluate and precipitate by SDS-PAGE protein electrophoresis;

the enzyme activity reaction in the step (5) comprises the following steps: the substrate and sugar donor were mixed and reacted by adding enzyme and Tris-HCl buffer.

The invention has the following beneficial effects:

taking Hederagenin and uridine diphosphate-arabinose as raw materials, and carrying out glycosylation reaction on hydroxyl at C-3 position of Hederagenin (Hederagenin) under the catalysis of radix dipsaci arabinosyltransferase obtained by encoding radix dipsaci arabinosyltransferase DaUGT044 gene to generate the gnomonic acid celestial saponin A (Cauloside A).

The invention obtains target protein after in vitro expression by recombinant plasmid, and further catalyzes the substrate hederagenin to generate the gnomonic acid A.

The radix dipsaci arabinosyl transferase DaUGT044 gene is identified from radix dipsaci through transcriptome sequencing and bioinformatics technology, and is screened after a large number of experiments; extracting RNA of the continuous broken root by adopting an RNA reagent, reversing the RNA into cDNA, and carrying out PCR amplification to obtain the PCR-based DNA. The amplification primers of the teasel root arabinosyltransferase DaUGT044 gene are as follows:

5'F：ATGGAAGAAATCAGTTCAAAGCC

3'R：TTAGGATTTTGCTAGCAAAACTTC

in addition, when homologous recombination is performed with the vector pET28a, the DaUGT044 gene needs to be amplified and recovered by using a primer with a homology wall, and the primer with the homology wall is as follows:

5'F：cagcaaatgggtcgcggatccATGGAAGAAATCAGTTCAAAGCC

3'R：gtcgacggagctcgaattcTTAGGATTTTGCTAGCAAAACTTC

the gene separated and identified from dipsacus root, daUGT044 can be used as an important marker gene for molecular auxiliary breeding of dipsacus root, and can also be used as an important candidate gene for producing dipsacus root saponin VI in yeast chassis cell construction.

Drawings

FIG. 1 is an HPLC analysis of the enzyme activity product of DaUGT 044;

FIG. 2A is the biosynthetic pathway of the gnomonic acid A constructed based on the function of DaUGT 044; b is LC-MS analysis of DaUGT044 enzyme activity product; c is mass spectrum of real standard of the gnomonic acid A and DaUGT044 enzyme activity product (peak (6));

FIG. 3 is a schematic diagram of the construction of recombinant expression plasmid pET28a-DaUGT044 (for expressing the gene encoding Dipsacus aspergillosis transferase DaUGT 044);

FIG. 4 shows the result of electrophoresis detection after recombination of radix Dipsaci arabinosyltransferase DaUGT 044;

FIG. 5 is a SDS-PAGE protein electrophoresis detection chart of the teasel root arabinosyltransferase DaUGT044 (M: protein molecular mass standard; 1 is a SDS-PAGE protein electrophoresis detection of the purified protein).

Description of the embodiments

The invention will be further described with reference to specific embodiments. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.

DETAILED DESCRIPTION OF EMBODIMENT (S) OF INVENTION

The research obtains candidate genes related to a synthetic path of the dipsacoside VI through searching transcriptome data and annotation results of a KEGG protein database by local BLAST, finds out FPKM values from the transcriptome data, performs differential expression analysis on the genes by using the FPKM values, makes a heat map by using TBtool for differential gene expression quantity, compares the expression quantity of related genes in continuous roots, stems and leaves respectively, performs functional identification on the candidate DaUGT044, and uses an online tool ORF Finder (http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) to identify an Open Reading Frame (ORF) and an amino acid sequence of the DaUGT044. Amino acid sequences of UGT genes from other species can be downloaded from existing databases and aligned with candidate genes by ClustalW, and phylogenetic trees constructed by MEGA-X using the adjacency method (neighborjoining method) under default parameters. Then carrying out a series of works such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, HPLC and LC/MS detection, and the like, and finally identifying that the cDNA can catalyze (carrying out glycosylation reaction on hydroxyl on the C-3 position of hederagenin to generate the gnomonic saponin A (figure 2):

(1) Preparation of cDNA templates

Taking fresh roots, stems and leaves of dipsacus asperoides, slicing, quickly freezing with liquid nitrogen, and extracting RNA. Total RNA extraction was performed using the HiPure HP Plant RNA Mini Kit kit from Guangzhou Meiyi Biotechnology Co. Extracting RNA according to the operation steps of the instruction book of the kit, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit after the detection is qualified, and preserving at-20 ℃ for standby.

(2) Gene amplification and recovery

The ORF (open reading frame) of 13 candidate DaOSC genes of Dipsacus asperoides was found out using NCBI online software (https:// www.ncbi.nlm.nih.gov/orffinder). Then, a specific primer of the full-length sequence of a coding region of the gene is designed by using SnapGene software, the designed primer is provided with a homology arm of a yeast expression vector pET28a-DaUGT044, and the up-draw of a general primer of the vector is as follows: 5'F: ccatggctgatatcggatccATGGAGATGCCATTGAAAGTG; the downset is 3' r: tgtcgacggagctcgaattcCTAAACTTGAATGACATTAGGATTTATGG. The cDNA obtained by the reverse transcription was used as a template, and gene amplification was performed using DNA polymerase (phanta enzyme). The amplification system is as follows: cDNA 2 μl, 2x phantaMax Master mix25 μl, up and down primers 2 μl each, ddH2O up to 50 μl, amplification system: 95 ℃ and 3min,95 ℃ and 15s and 55 ℃ and 15s and 72 ℃ and 1min, and 36 cycles; 72 ℃ and 5min. After the PCR amplification procedure was completed, 1.2% agarose gel electrophoresis was used to determine whether the amplified gene band was consistent with the length of the target gene band. If the lengths are similar, the gene of interest can be recovered using GenStar's kit. And the recovery concentration was determined in a NanoDrop2000 and finally stored in a-20 ℃ refrigerator.

(3) Construction and identification of Gene recombination vectors

Linearization of a vector: the linearized vector pET-28a was obtained by single cleavage of pET-28a with the endonuclease BamHI. The samples were purified using the omega E.Z.N.A. Cycle Pure Kit, and their concentrations were measured and stored in a-20deg.C refrigerator for use.

B gene recombination: the target gene obtained by amplification by using a ready-to-use seamless cloning enzyme kit of biological engineering (Shanghai) Co., ltd, and a linearized pET-28a vector are connected, the connection method and the transformation mode are shown in figure 2, and the transformed strain isE.coliBL21 (DE 3) competence.

C, bacteria water detection: randomly selecting 8 colonies from a transformation medium on an ultra-clean workbench, and taking 3 mu l of colonies to carry out PCR amplification, wherein a PCR reaction system adopts a 2x Taq Master Mix enzyme reaction system of Nanjinouzan biotechnology Co., ltd, and the PCR process is 95 ℃,3min,95 ℃,30s,55 ℃,15s,72 ℃,30/kb and 35 cycles; after the reaction procedure was completed at 72℃for 5min, the length of the PCR product was measured with 1% agarose. If the PCR product is similar in length to the fragment of interest, it is positive. Indicating successful assembly and sequencing. After sequencing is successful, seed preservation is carried out by a method of using 50% glycerol and bacterial liquid according to the volume ratio of 1:1. As shown in fig. 3.

(4) Protein expression and purification of candidate gene DaUGT044

Protein expression: resuscitating the bacterial liquid preserved before, recovering under the condition of 220r/min at 37 ℃, inoculating 300mL of kanamycin (100 mug/mL) LB liquid culture medium for expansion culture after the bacterial liquid is fully turbid, adding 0.5mM IPTG (isopropyl-beta-D-thiogalactoside) when the OD value of the bacterial liquid is increased to the range of 0.6-0.8, and carrying out protein induction expression for 12-16h under the low temperature condition.

Protein purification: after the induction expression is finished, the bacterial cells are collected by centrifugation for 20min at 4 ℃ and 5000rpm/min by a large-scale high-speed refrigerated centrifuge. The cells were resuspended in 20mL of 50mM Tris,200mM NaCl, tris-HCl (pH=8.0) buffer, and after completion, the cells were broken 1 to 2 times with a high pressure low temperature breaker (Guangzhou energy-accumulating biosciences Co., ltd.), and then centrifuged at a high speed at 4℃and 12000rpm/min for 30 minutes, the supernatant was loaded onto a Ni-NTA agarose affinity column, and the filtrate was collected by eluting with different concentrations of imidazole (20 mM, 50mM, 60mM, 200 mM) and subjected to SDS-PAGE for detection of the eluate and precipitate. As shown in fig. 4-5.

(5) Enzymatic reaction

In vitro enzyme activity reactions were performed in 100. Mu.l of a mixed system, substrate 100mM (oleanolic acid, hederagenin, williams, etc.), sugar donor 100mM (UDP-glucose, UDP-arabinose), enzyme 10. Mu.g/. Mu.l, tris-HCl buffer (50 mM, pH=8.0), 30℃for 2h, quenched by addition of an appropriate amount of methanol, centrifuged at 12000g for 20min, the supernatant was aspirated, the product was dissolved in methanol, and finally the reaction product was detected by HPLC and LC-MS analysis.

(6) Product detection

The HPLC detection conditions were as follows:

the candidate DaUGT in-vitro enzyme activity reaction product is detected by adopting an Agilent 1290 ultra-high performance liquid chromatograph. The column was Agilent extension-C18 (250 mm x 4.6mm,5 μm), column temperature: 30 ℃; the mobile phase of the product was determined to be 0.01% v/v formic acid in water (A) -acetonitrile (B), gradient elution: 0-3 min, 85-60% of A; 3-7 min, 60-35% of A; 7-9.5 min, 35-12% of A; 9.5-25 minA. Elution time: 25min; sample injection amount: 10. Mu.L; flow rate: 0.5mL/min; the detection wavelength 210nm. The detection result is shown in figure 1, which indicates that the production of the gnonia melanocarpa is carried out.

LC-MS detection conditions were as follows:

to further confirm the HPLC results, detection was performed using an Agilent 1290UPLC/6540Q-TOF liquid chromatography mass spectrometer (LC/MS): mass spectrometry conditions: the ion source adopts a negative ion mode and voltage: 3500V; fragmentation voltage: 135V; taper hole voltage: 60V; radio frequency voltage: 750V, scan range: 100-1000m/z, scanning mode: and SRM. Chromatographic conditions: the column was Agilent extension-C18 (250 mm. Times.4.6 mm,5 μm), column temperature: 30 ℃, the mobile phase of the product was determined to be 0.01% v/v formic acid in water (A) -acetonitrile (B), gradient elution: 0-3 min, 85-60% of A; 3-7 min, 60-35% of A; 7-9.5 min, 35-12% A; 9.5-25 minA. Elution time: 25min; sample injection amount: 10. Mu.L; flow rate: 0.5mL/min; the detection wavelength is 210nm. The detection results are shown in fig. 2, and from the results, it can be seen that the peak time (fig. 2B) and the characteristic peak (fig. 2C) of the reaction product are identical to the peak time (fig. 2B) and the characteristic peak (fig. 2C) of the standard product, so that the generated product is further confirmed to be the gnognateglinide a.

The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.

Claims (10)

1. The teasel root arabinosyl transferase DaUGT044 gene is characterized in that the nucleic acid sequence of the teasel root arabinosyl transferase DaUGT044 gene is shown in SEQ ID NO: 1.

2. The protein encoded by the teasel root arabinosyltransferase DaUGT044 gene according to claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 2.

3. A recombinant plasmid comprising the teasel root arabinosyltransferase DaUGT044 gene according to claim 1.

4. The recombinant plasmid of claim 3, wherein the teasel root arabinosyltransferase DaUGT044 gene is obtained by homologous recombination with a pET28a vector and is named pET28a-DaUGT044.

5. A transgenic engineering bacterium, characterized by comprising the recombinant plasmid of claim 3 or 4, or the genome of the genetically engineered bacterium integrated with the exogenous radix dipsaci arabinosyl transferase DaUGT044 gene of claim 1.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is a strain of e.coli BL21 (DE 3).

7. An application of radix Dipsaci arabinosyl transferase DaUGT044 gene in preparing radix Dipsaci saponin VI is provided.

8. A process for preparing a gnomonic acid a for synthesizing the teasel root saponin VI of claim 7, comprising the steps of: taking hederagenin and uridine diphosphate-arabinose as raw materials, and carrying out glycosylation reaction on hydroxyl on the C-3 position of the hederagenin under the catalysis of teasel root arabinosyltransferase obtained by encoding teasel root arabinosyltransferase DaUGT044 genes to generate the gnomonic acid celestial saponin A.

9. The method of preparing according to claim 8, comprising the steps of:

(1) Preparing a cDNA template;

(2) Amplifying and recovering genes;

(3) Constructing and identifying a gene recombinant vector;

(4) Protein expression and purification of candidate gene DaUGT 044;

(5) And (5) enzyme activity reaction.

10. The method of claim 9, wherein the method of preparing the cDNA template in step (1) comprises the steps of: taking fresh roots, stems and leaves of dipsacus root, slicing, quickly freezing with liquid nitrogen, extracting RNA, reversely transcribing the RNA into cDNA by using a TAKARA reverse transcription kit, and preserving at-20 ℃ for later use;

the gene amplification and recovery in the step (2) comprises the following steps: using the reverse transcription to cDNA as a template, adopting DNA polymerase to carry out gene amplification, adding 2 μl of cDNA and 2x phantaMax Master mix25 μl of cDNA, respectively adding 2 μl of upstream and downstream primers, and supplementing ddH2O to 50 μl, wherein the amplification system is as follows: 95 ℃ and 3min,95 ℃ and 15s and 55 ℃ and 15s and 72 ℃ and 1min, and 36 cycles; 72 ℃ and 5min; recovering the target gene by using the kit, and storing in a refrigerator at-20 ℃ for later use;

the construction and identification of the gene recombinant vector in the step (3) comprises the following steps: linearizing a vector, carrying out gene recombination and detecting bacteria water; the vector linearization is to carry out single enzyme digestion on pET-28a by utilizing endonuclease BamHI to obtain a linearization vector pET-28a, purify and recycle the linearization vector pET-28a by using a kit, and measure the concentration of the linearization vector pET-28a and store the linearization vector pET-28a in a refrigerator at the temperature of minus 20 ℃ for later use; the gene recombination is to connect the target gene obtained by amplifying the kit with a linearized pET-28a carrier, and transform the strain intoE.coliBL21 (DE 3) competence; in the PCR amplification in the bacteria water detection, the PCR program is for 35 cycles of 95 ℃,3min,95 ℃,30s,55 ℃,15s,72 ℃, 30/kb; 72 ℃ for 5min; obtaining bacterial liquid;

protein expression in step (4): resuscitating the bacterial liquid at 37 ℃ and 220rpm/min, inoculating to kanamycin LB liquid culture medium for expansion culture, and adding IPTG to perform protein induction expression at low temperature; protein purification: after the induced expression is finished, centrifugally collecting thalli, re-suspending thalli by buffer solution, breaking bacteria, centrifuging at high speed, loading supernatant onto a Ni-NTA agarose affinity column, eluting by using imidazole passing columns with different concentrations, collecting filtrate, and detecting results of eluate and precipitate by SDS-PAGE protein electrophoresis;

the enzyme activity reaction in the step (5) comprises the following steps: the substrate and sugar donor were mixed and reacted by adding enzyme and Tris-HCl buffer.