CN104818300A - Method for synthesizing ferulic acid through enzyme method - Google Patents

Abstract

The present invention discloses a method for synthesizing ferulic acid through an enzyme method, wherein the methyl on S-adenosyl methionine (SAM) is transferred onto caffeic acid so as to finally form the product ferulic acid. The method comprises: a) highly expressing ligusticum chuanxiong hort caffeic acid-O methyltransferase(COMT) through fermentation of escherichia coli, collecting bacteria through centrifugation, re-suspending the bacteria with a Tris-HCl buffer solution, and carrying out ultrasonic bacterial lysis to obtain a mixed enzyme solution containing the ligusticum chuanxiong hort COMT; and b) transferring the methyl provided by SAM to the caffeic acid through the ligusticum chuanxiong hort COMT obtained in the step a), and finally converting into the ferulic acid. The method of the present invention has advantages of simple process, mild reaction condition, high conversion efficiency, low conversion cost, and the like.

Description

A kind of method of enzymatic clarification forulic acid

Technical field:

The invention belongs to application of biological engineering field, especially a kind of Ligusticum wallichii coffic acid-O methyltransgerase (being all abbreviated as COMT below) gene in vitro the recombination bacillus coli of allos efficient prokaryotic expression construction method of gene engineering strain and methylated by coffic acid and change into the enzymatic conversion method method of forulic acid.

Background technology:

Forulic acid is the ubiquitous a kind of phenolic acid of vegitabilia, and chemical name is 4-hydroxyl-3 methoxy cinnamic acid.It has many nourishing functions, as scavenging free radicals, antithrombotic, antisepsis and anti-inflammation, Tumor suppression, prevent and treat hypertension, heart trouble, enhancing motility of sperm, suppression people epidermal melanophore propagation, melanin genesis and tyrosinase activity etc., be applied to health protection cosmetic field.Forulic acid is in the food industry mainly for the preparation of natural chinese cymbidium rope, antioxidant, sanitas, linking agent and function promotor etc.; forulic acid forulic acid toxicity is low simultaneously; be easy to as body metabolism; medically treat cardiovascular and cerebrovascular diseases; protection liver, kidney; the disease aspects such as anti-inflammatory and treatment cataract are very valuable, and application prospect is extensive.

Current forulic acid by chemical synthesis and extraction method etc. four class methods obtain.Chemical synthesis is raw material mainly with 4-hydroxyl-3-methoxylbenxaldehyde and propanedioic acid, and be solvent with anhydrous pyridine, piperidines makes catalyzer, is obtained by condensation reaction.But long, the easy generation of this method reaction times is fit along back mixing, solvent load large, and productive rate is low.Equations of The Second Kind adopts Different Extraction Method to extract from differing materials, the gamma oryzanol that such as industrial main employing alkaline process decomposes in rice bran produces highly purified forulic acid, but this method yields poorly, produce environmental pollution and cost is high, thus constrain forulic acid and produce on a large scale and apply.3rd class adopts hydrolysis method to prepare forulic acid, Sodium Ferulate from ferulic acid ester; 4th class methods are biological synthesis process, are such as converted into forulic acid with several microorganism (Arthrobacter Blobiformis) by extracting the eugenol cinnamate obtained in Syzygium aromaticum stem oil.

Summary of the invention:

In view of the above deficiency of prior art, the object of this invention is to provide a kind of method of enzymatic clarification forulic acid, and make it have that technique is simple, reaction conditions is gentle, transformation efficiency is high, transform low cost and other advantages.

The object of the invention is by following means realize.

A method for enzymatic clarification forulic acid, by the Methyl transporters on S-adenosylmethionine (SAM) on coffic acid, final formation product forulic acid, comprises the following steps:

A) by colibacillary fermentation high expression Ligusticum wallichii COMT, by collected by centrifugation thalline, with the resuspended thalline of Tris-HCl damping fluid, ultrasonic degradation thalline, the mixed enzyme solution containing Ligusticum wallichii COMT enzyme is obtained;

B) by a) obtain Methyl transporters that SAM provides by Ligusticum wallichii COMT to coffic acid, finally change into forulic acid.

In actual implementation process, above-mentioned a) step comprises following concrete technology:

A builds to produce and transforms bacterial strain:

1). use respectively with the primer (A1:CGCGGATCCATGAATACGGAGCTGATCCCACC of EcoR1 and BamH1 double enzyme site; A2:CGGAATTCACATTAAGCAGATGCCAGACACCC) from Ligusticum wallichii cDNA, the total length reading frame of Ligusticum wallichii COMT gene is gone out by pcr amplification;

2). use EcoR1 and BamH1 double digested respectively the Ligusticum wallichii COMT gene fragment increased out and pET28a, obtain the fragment of two ends with sticky end; Connect two fragments with T4DNA ligase enzyme, system is the Ligusticum wallichii COMT DNA fragmentation 6ul after 10*T4DNA ligase buffer 2.5ul, double digestion, pET28a carrier 2ul, T4DNA ligase 1ul after double digestion, supplies 25ul with the distilled water of sterilizing; 16 DEG C of connections are spent the night; Obtain the recombinant plasmid connected;

3). get 10ul recombinant plasmid transformed BL21 competent cell.BL21 genetic engineering bacterium of conversion successfully being recombinated coats screening positive clone in the flat board containing 50mg/L kantlex;

4., after being identified with bacterium colony PCR and plasmid double digestion by preliminary screening recombinant bacterial strain out, through order-checking to determine the correct of reading frame, obtain the recombinant bacterial strain of expecting.

B fermentation expands recombinant bacterial strain

1). fermention medium: peptone 10g/L, yeast extract 5g/L, NaCl 10g/L; After dissolving, autoclave sterilization;

2). fermentation condition: 37 DEG C, recombinant bacterial strain is cultured to OD600=0.6 by 200rpm; Add IPTG, make its final concentration be 1mM/L, cultivate 8 ~ 10h for 17 ~ 20 DEG C.

In actual implementation process, above-mentioned b) step comprises following concrete technology::

1). by the fermented liquid 4 DEG C obtained, 5000g centrifugal 10min collected by centrifugation thalline.

2). with the resuspended thalline of damping fluid of the Tris-Hcl pH7.9 of 10ml 20mM, ultrasonic degradation thalline.Ultrasound procedures is 60W, and work 9s, time-out 6s, repeat 199 times under condition of ice bath.4 DEG C, 13000g centrifugal segregation cell debris.Collect supernatant, obtain the mixed enzyme solution containing Ligusticum wallichii COMT.

3) coffic acid of reaction system: 500uM, 1mM SAM, 100mM MgCl2, the potassium phosphate buffer 100ml of 1mM DTT, 100mM, the mixed enzyme solution of 1-5ml;

4) 37 DEG C leave standstill 6 ~ 8h; Add the dense HCl of 5-10ml, termination reaction;

5) be extracted with ethyl acetate 4 times, obtain forulic acid crude extract.

Adopt the inventive method, have that technique is simple, reaction conditions is gentle, transformation efficiency is high, transform low cost and other advantages.

Accompanying drawing explanation

Fig. 1 Technology Roadmap of the present invention.

The plasmid map of Fig. 2 recombinant plasmid pET28a-COMT.

Embodiment:

The structure of embodiment 1:pET28a-COMT recombinant plasmid:

1.pET28a plasmid is Novagen Products, and size is 5369bp, containing a T7 strong promoter, and a kalamycin resistance gene, lac repressor lac I gene.

2. design two and comprise Ligusticum wallichii COMT entire reading frame and forward containing BamH1, oppositely containing the expression primer (A1:CGCGGATCCATGAATACGGAGCTGATCCCACC of EcoR1 two restriction enzyme sites; A2:CGGAATTCACATTAAGCAGATGCCAGACACCC), from Ligusticum wallichii cDNA, go out by pcr amplification the Ligusticum wallichii COMT fragment containing BamH1 and EcoR1 two restriction enzyme sites in two ends.PCR system is: Primer star mix (precious biotech firm) 25ul, cDNA2ul, primer 1 2ul, primer 2 2ul, distilled water supplies 50ul.PCR system is 94 DEG C of 5min, 94 DEG C of 1min, 66 ~ 68 DEG C of 1min, 72 DEG C of 2min, 35 circulations, 72 DEG C of 10min, 4 DEG C of ∞.

3. glue reclaims rear BamH1 and the EcoR1 Ligusticum wallichii COMT fragment that amplifies of double digestion and pET28a carrier respectively.The enzyme system of cutting is: BamH10.5ul, EcoR10.5ul, 10*K Buffer 2ul, DNA fragmentation 9ul, distilled water supplies 20ul.37 DEG C of enzymes cut 4h.Two ends are obtained respectively containing Ligusticum wallichii COMT DNA fragmentation and the pET28a plasmid of sticky end after glue reclaims

4. adopt T4DNA to connect two sticky ends, system is the Ligusticum wallichii COMT DNA fragmentation 6ul after 10*T4DNA ligase buffer2.5ul, double digestion, pET28a carrier 2ul, T4DNA ligase 1ul after double digestion, supplies 25ul with the distilled water of sterilizing.16 DEG C of connections are spent the night.Obtain the recombinant plasmid connected.

5. by the recombinant plasmid transformed BL21 competent cell after connection, coat screening positive clone in the LB flat board containing 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, 12g/L agar, 50mg/L kantlex, picking screening after mono-clonal bacterium colony in containing 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, 50mg/L kantlex LB liquid nutrient medium in 37 DEG C, 200rpm shakes bacterium and spends the night.

6. adopt bacterium liquid PCR and plasmid double digestion preliminary evaluation transformant.Bacterium liquid PCR system is: dNTP8ul, forward primer 1ul, and reverse primer 1ul, 10*rTaq buffer 5ul, Mgcl24ul, bacterium liquid 2ul, rTaq0.5ul, distilled water supplies 50ul.PCR system is 94 DEG C of 5min, 94 DEG C of 1min, 66 ~ 68 DEG C of 1min, 72 DEG C of 2min, 35 circulations, 72 DEG C of 10min, 4 DEG C of ∞.Plasmid extraction carries out with reference to OmegaPlasmidMini Kit I specification sheets.Double digestion system is: BamH10.5ul, EcoR10.5ul, 10*K Buffer2ul, and DNA fragmentation 9ul, distilled water supplies 20ul.37 DEG C of enzymes cut 4h.

7. send DNA sequencing by the transformant of preliminary evaluation, to verify the exactness of the recombinant plasmid of acquisition.

Embodiment 2: the fermentation of recombinant bacterial strain:

1. the recombinant bacterial strain getting 1ml incubated overnight is inoculated in the LB liquid nutrient medium of 100ml containing 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, 50mg/L kantlex, and 500ml triangular flask 37 DEG C, 200rpm cultivates 2 ~ 4h and obtains seed liquor.

2. getting 5ml seed liquor is inoculated in 100mlLB liquid nutrient medium, and 37 DEG C, 200rpm is cultured to ODOD600=0.6.Add IPTG, make its final concentration be 1mM/L, 17 ~ 20 DEG C, 200rpm cultivates 8 ~ 10h.

Embodiment 3: the enzyme process conversion of forulic acid

1. the fermented liquid 4 DEG C will obtained, 5000g centrifugal 10min collected by centrifugation thalline.

2. with the resuspended thalline of damping fluid of the Tris-Hcl pH7.9 of 10ml 20mM, ultrasonic degradation thalline.Ultrasound procedures is 60W, and work 9s, time-out 6s, repeat 199 times under condition of ice bath.4 DEG C, 13000g centrifugal segregation cell debris.Collect supernatant, obtain the mixed enzyme solution containing Ligusticum wallichii COMT.

3. the coffic acid of reaction system: 500uM, 1mM SAM, 100mM MgCl2, the potassium phosphate buffer 100ml of 1mM DTT, 100mM, the mixed enzyme solution of 1-5ml.

4.37 DEG C leave standstill 6 ~ 8h.Add the dense HCl of 5-10ml, termination reaction.

5. be extracted with ethyl acetate 3 times, obtain forulic acid crude extract.

Embodiment 4: high performance liquid chromatography detects forulic acid transformation efficiency

1. the membrane filtration of forulic acid crude extract 0.22um will obtained, gets the upper high performance liquid chromatography of filtrate and detects.

2. chromatographic condition is: chromatographic column: Yi Lite Hypersil ODS2 (4.6mm*200mm, 5um), applied sample amount 5ul, moving phase: the phosphoric acid-methyl alcohol (68:32) of 0.1%, flow velocity: 1ml/min, and column temperature 30 DEG C, determined wavelength is 323nm.

3. the productive rate of forulic acid is calculated according to the peak area after coffic acid and forulic acid integration.The present embodiment employing purity is the technical grade coffic acid of 78%, and final integral substrate conversion efficiency can reach 75.7%, and caffeinic transformation efficiency then can reach 97.11%.

Claims (3)

1. a method for enzymatic clarification forulic acid, by the Methyl transporters on S-adenosylmethionine SAM on coffic acid, final formation product forulic acid, comprises the following steps:

A) (be all abbreviated as below by colibacillary fermentation high expression Ligusticum wallichii coffic acid-O methyltransgerase

COMT), by collected by centrifugation thalline, with the resuspended thalline of Tris-HCl damping fluid, ultrasonic degradation thalline, obtain the mixed enzyme solution containing Ligusticum wallichii COMT;

B) by a) obtain Methyl transporters that SAM provides by Ligusticum wallichii COMT to coffic acid, finally change into forulic acid.

2. the method for enzymatic clarification forulic acid according to claim 1, it is characterized in that, described a) step comprises following concrete technology:

A builds to produce and transforms bacterial strain:

1). use respectively with the primer (A1:CGCGGATCCATGAATACGGAGCTGATCCCACC of EcoR1 and BamH1 double enzyme site; A2:CGGAATTCACATTAAGCAGATGCCAGACACCC) from Ligusticum wallichii cDNA, the total length reading frame of Ligusticum wallichii COMT gene is gone out by pcr amplification;

2). use EcoR1 and BamH1 double digested respectively the Ligusticum wallichii COMT gene fragment increased out and pET28a, obtain the fragment of two ends with sticky end; Connect two fragments with T4DNA ligase enzyme, system is the Ligusticum wallichii COMT DNA fragmentation 6ul after 10*T4DNA ligase buffer 2.5ul, double digestion, pET28a carrier 2ul, T4DNA ligase 1ul after double digestion, supplies 25ul with the distilled water of sterilizing; 16 DEG C of connections are spent the night; Obtain the recombinant plasmid connected;

3). get 10ul recombinant plasmid transformed BL21 competent cell.BL21 genetic engineering bacterium of conversion successfully being recombinated coats screening positive clone in the flat board containing 50mg/L kantlex;

4). after being identified with bacterium colony PCR and plasmid double digestion by preliminary screening recombinant bacterial strain out, through order-checking to determine the correct of reading frame, obtain the recombinant bacterial strain of expecting;

B fermentation expands recombinant bacterial strain

1). fermention medium: peptone 10g/L, yeast extract 5g/L, NaCl 10g/L; After dissolving, autoclave sterilization;

2). fermentation condition: 37 DEG C, recombinant bacterial strain is cultured to OD600=0.6 by 200rpm; Add IPTG, make its final concentration be 1mM/L, cultivate 8 ~ 10h for 17 ~ 20 DEG C.

3. the method for enzymatic clarification forulic acid according to claim 1, it is characterized in that, described b) step comprises following concrete technology:

1). by the fermented liquid 4 DEG C obtained, 5000g centrifugal 10min collected by centrifugation thalline;

2). with the resuspended thalline of damping fluid of the Tris-Hcl pH7.9 of 10ml 20mM, ultrasonic degradation thalline.Ultrasound procedures is 60W, and work 9s, time-out 6s, repeat 199 times under condition of ice bath; 4 DEG C, 13000g centrifugal segregation cell debris.Collect supernatant, obtain the mixed enzyme solution containing Ligusticum wallichii COMT;

3) coffic acid of reaction system: 500uM, 1mM SAM, 100mM MgCl2, the potassium phosphate buffer 100ml of 1mM DTT, 100mM, the mixed enzyme solution of 1-5ml;

4) 37 DEG C leave standstill 6 ~ 8h; Add the dense HCl of 5-10ml, termination reaction;

5) be extracted with ethyl acetate 4 times, obtain forulic acid crude extract.