WO2023108505A1 - Method for improving sam cofactor supply of saccharomyces cerevisiae, engineered yeast and use thereof - Google Patents

Abstract

Provided in the present application are a method for improving the SAM cofactor supply of Saccharomyces cerevisiae, an engineered yeast and the use thereof. The method comprises: introducing an MET6 gene, a cMTFHR gene, a LiMETK1 gene, an SAH1 gene and an ADO1 gene into Saccharomyces cerevisiae. The method can solve the problem of the insufficient supply of endogenous auxiliary factors in the synthesis process of methylation products such as ferulic acid, thereby increasing the synthesis efficiency thereof.

Description

A method for improving the supply of SAM cofactor of Saccharomyces cerevisiae, engineering bacteria and its application technical field

The invention belongs to the application field of microbial genetic engineering and metabolic engineering, and in particular relates to an engineering strain and its preparation method and application.

Background technique

Ferulic acid is a plant-derived phenolic acid compound, which has good pharmacological effects and biological activities such as anti-oxidation, anti-radiation and antibacterial, so it has high application value in medicine, health care products, cosmetic raw materials and food additives. . As a precursor raw material, it can be used to synthesize complex active natural medicines such as rosmarinic acid, salvianolic acid B and silybin. The content of free ferulic acid in plants is low, and the Saccharomyces cerevisiae cell factory provides a new idea for obtaining a large amount of free ferulic acid, which is a more environmentally friendly, green and efficient way.

The conventional strategy of constructing Saccharomyces cerevisiae cell factory is to design the synthetic pathway and find the elements needed for the pathway according to the design-build-test-learn (DBTL) cycle; then construct the synthetic pathway through the pathway modularization strategy to obtain engineering strains; The strains are cultivated and the product is tested to verify the synthesis efficiency of the target compound; finally, the conclusion is analyzed and studied, suggestions for improvement are put forward, and then enters the next DBTL cycle. In this process, maximization of precursor supply and redirection of metabolic flux distribution through element screening and pathway optimization are considered as core engineering strategies to improve yield. The synthesis process of many compounds requires the participation of multiple cofactors. When the target compound is synthesized efficiently, the contradiction of insufficient cofactors is gradually highlighted, which may become the rate-limiting step that limits the synthesis efficiency of cell factories. At present, the supply of cofactors in the synthesis process of natural products is often be ignored.

The last step of the ferulic acid synthesis pathway is catalyzed by caffeic acid oxymethyltransferase, which requires the cofactor adenosylmethionine (SAM) as a methyl donor to participate in the reaction. SAM cofactors have significant spatiotemporal distribution characteristics and strict dynamic regulation mechanism, and it is extremely challenging to design precise SAM engineering strategies in yeast and use them to improve biosynthetic efficiency.

Contents of the invention

According to one aspect of the present application, a method for increasing the supply of SAM cofactors in Saccharomyces cerevisiae is provided, which can overcome the difficulty of insufficient supply of endogenous cofactors during the synthesis of methylated products such as ferulic acid, thereby improving their synthesis efficiency.

A method of increasing the supply of SAM cofactors to Saccharomyces cerevisiae, said method comprising:

MET6 gene, cMTFHR gene, LiMETK1 gene, SAH1 gene and ADO1 gene were introduced into Saccharomyces cerevisiae.

Optionally, the method includes:

A DNA fragment containing T _HSP26 -MET6-P _GAL10/1 -cMTFHR-T _PDC6 -P _GAL7 -liMetK1-Sc ^OPT1 -T _UBX6 was integrated into the HO site of Saccharomyces cerevisiae;

A DNA fragment containing T _PRM9 -ADO1-P _GAL10/1 -SAH1-T _PYK1 was integrated into the V3 locus of S. cerevisiae.

Optionally, the nucleotide sequence of the MET6 gene is shown in SEQ ID NO: 2;

The nucleotide sequence of the cMTFHR gene is shown in SEQ ID NO: 3;

The nucleotide sequence of the LiMETK1 gene is shown in SEQ ID NO: 4;

The nucleotide sequence of the ADO1 gene is shown in SEQ ID NO: 5;

The nucleotide sequence of the SAH1 gene is shown in SEQ ID NO:6.

Optionally, the Saccharomyces cerevisiae is a ferulic acid producing strain;

The ferulic acid producing strain is obtained by introducing the NtCOMT1 gene into the caffeic acid producing strain.

Optionally, the nucleotide sequence of the NtCOMT1 gene is shown in SEQ ID NO:1.

Optionally, the NtCOMT1 gene is introduced into the caffeic acid-producing strain as T _CSP1 -NtCOMT1-Sc ^OPT1 -P _GAL10/1 -NtCOMT1-T _HIS5 and integrated into the XII5 site of the caffeic acid producing strain.

Optionally, the caffeic acid producing strain is obtained by introducing genes related to the phenolic acid synthesis pathway into the starting strain of Saccharomyces cerevisiae:

The phenolic acid synthesis pathway-related genes include at least one of Aro4 ^K229L , Aro7 ^G141S , EcAROL, ARO1, ARO2, ARO3, PHA2, MtPDH1, FjTAL, SbPAL1 ^H123F , AtCPR1, PtrC4H1, PtrC4H2, PtrC3H, PaHPAB, SeHPAC.

The phenolic acid synthesis pathway-related genes include Aro4 ^K229L having the nucleotide sequence shown in SEQ ID NO: 44, Aro7 G141S having the nucleotide sequence shown in SEQ ID NO: 45, Aro7 ^G141S having the nucleotide sequence shown in SEQ ID NO: 46 EcAROL with the nucleotide sequence shown, ARO1 with the nucleotide sequence shown in SEQ ID NO: 47, ARO2 with the nucleotide sequence shown in SEQ ID NO: 48, ARO2 with the nucleotide sequence shown in SEQ ID NO: 49 ARO3 having a nucleotide sequence, PHA2 having a nucleotide sequence shown in SEQ ID NO: 50, MtPDH1 having a nucleotide sequence shown in SEQ ID NO: 51, having a nucleotide sequence shown in SEQ ID NO: 52 FjTAL of the acid sequence, SbPAL1 ^H123F having the nucleotide sequence shown in SEQ ID NO: 53, AtCPR1 having the nucleotide sequence shown in SEQ ID NO: 54, having the nucleotide sequence shown in SEQ ID NO: 55 PtrC4H1 of sequence, PtrC4H2 having the nucleotide sequence shown in SEQ ID NO: 56, PtrC3H having the nucleotide sequence shown in SEQ ID NO: 57, PtrC3H having the nucleotide sequence shown in SEQ ID NO: 58 At least one of PaHPAB and SeHPAC having the nucleotide sequence shown in SEQ ID NO: 59;

Optionally, the introduction site of ARO7 ^G141S , ARO4 ^K229L and EcAROL is ARO10.

The import site of FjTAL, SbPAL1 ^H123F and AtCPR1 is PDC5;

The import site of PtrC4H2, PtrC4H1 and PtrC3H is XII4;

The import site of ARO1, ARO2, and ARO3 is XII1;

The import site of PahpaB and SehpaC is X2;

The import site of PHA2 and MtPDH1 is XI8.

Alternatively, a DNA fragment containing _THIS3 -ARO7 ^G141S -P _GAL10/1 -ARO4 ^K229L -T _ENO2 -P _GAL7 -EcAROL-T _ADH1 is integrated into the ARO10 site of the starting strain;

Integrate the DNA fragment containing T _CYC1 -FjTAL-Sc ^OPT1 -P _GAL10/1 -SbPAL1 ^H123F -Sc ^OPT1 -T _TDH2 -T _FBA1 -AtCPR1-Sc ^OPT1 -P _GAL7 into the PDC5 site of the starting strain;

Integrate the DNA fragment containing T _PRM9t -PtrC4H2-Sc ^OPT1 -P _GAL10/1 -PtrC4H1-Sc ^OPT1 -T _PYK1 -P _GAL7 -PtrC3H-Sc ^OPT1 -T _DIT1 into the XII4 site of the starting strain;

Integrate the DNA fragment containing P _GAL7 -ARO1-T _ENO2 -T _CPS1 -ARO2-P _GAL10/1 -ARO3-T _HIS5 into the XII1 site of the starting strain;

Integrate the DNA fragment containing T _PRM9 -PahpaB-Sc ^OPT1 -P _GAL10/1 -SehpaC-Sc ^OPT1 -T _HIS3 into the X2 site of the starting strain;

A DNA fragment containing T _CPS1 -PHA2-P _GAL10/1 -MtPDH1-Sc ^OPT1 -T _HIS5 was integrated into the XI8 site of the starting strain.

Optionally, the LmXFPK gene, CkPTA gene, TAL1 gene and TKL1 gene were also introduced into the starting strain of Saccharomyces cerevisiae.

Optionally, the nucleotide sequence of the TKL1 gene is shown in SEQ ID NO: 40;

The nucleotide sequence of the TAL1 gene is shown in SEQ ID NO: 41;

The nucleotide sequence of the LmXFPK gene is shown in SEQ ID NO: 42;

The nucleotide sequence of the CkPTA gene is shown in SEQ ID NO: 43.

Optionally, the GAL80 gene of the starting strain of S. cerevisiae was also knocked out.

According to one aspect of the present application, the engineering bacteria obtained by the method is provided.

According to one aspect of the present application, the engineering bacteria obtained by the method and the application of the above-mentioned engineering bacteria in the preparation of SAM-dependent methylation products are provided.

Optionally, the SAM-dependent methylation product includes ferulic acid.

As an embodiment, the present application discloses the construction of a SAM-supplying yeast strain and its application to increase the yield of ferulic acid, which belongs to the application field of microbial genetic engineering and metabolic engineering. The construction method described in this application uses the strain RB197 as the starting chassis cell, overexpresses the caffeic acid oxymethyltransferase gene NtCOMT1, and obtains the strain RB202. The present invention uses the SAM yeast strain to make the ferulic acid yield reach 184.2mg/L, and the conversion efficiency of the substrate caffeic acid to synthesize ferulic acid is increased from 46% to 64%, and at the same time, the batch-type fed-batch fermentation reaches the highest yield so far of 3.8g/L , proving the application potential of this cell line in the industrialization of cell factories.

As an embodiment, the purpose of this application is to provide the construction of yeast strains that supply SAM, so as to solve the difficulty of insufficient supply of endogenous SAM during the synthesis of methylated products such as ferulic acid, thereby improving the synthesis efficiency of yeast cell factories. On the one hand, it fills the technical gap in this field, and on the other hand, it explores the application potential and prospect of SAM cofactor engineering as the target of cell factory engineering.

As an embodiment, the present application provides a construction method of strain RB202. The construction method uses the previously constructed high-caffeic acid-producing strain RB197 as a starting chassis cell, and overexpresses the caffeic acid oxymethyltransferase gene NtCOMT1 to obtain strain RB202. , to realize the synthesis of ferulic acid from caffeic acid.

Optionally, the nucleotide sequence of the oxygen methyltransferase gene NtCOMT1 is shown in SEQ ID NO:1.

As an embodiment, the present application provides the strain RB202 constructed by the method for constructing the strain RB202.

As an embodiment, the present application provides a construction method of recombinant yeast RB210, the construction method comprising: overexpressing MET6, cMTFHR and LiMETK1 in Saccharomyces cerevisiae strain RB197 to obtain strain RB210, thereby increasing the metabolic flux of SAM in the engineering strain and synthetic levels.

Optionally, the nucleotide sequence of the MET6 is shown in SEQ ID NO: 2, the nucleotide sequence of the cMTFHR is shown in SEQ ID NO: 3, and the nucleotide sequence of the LiMETK1 is shown in SEQ ID NO :4.

As an embodiment, the present application provides the strain RB210 constructed by the method for constructing the recombinant yeast RB210.

As an embodiment, the present application provides a construction method of recombinant yeast RB218, the construction method comprising: expressing Saccharomyces cerevisiae-derived genes ADO1 and SAH1 in RB210 to obtain recombinant yeast RB218.

Optionally, the nucleotide sequence of the ADO1 is shown in SEQ ID NO: 5, and the nucleotide sequence of the SAH11 is shown in SEQ ID NO: 6.

As an embodiment, the present application provides the strain RB218 constructed by the method for constructing the recombinant yeast RB218.

As an embodiment, the present application provides the use of protected yeast in the production of natural products.

Optionally, the natural product is ferulic acid.

As an embodiment, the present application provides an adenosylmethionine (SAM) cofactor engineering strategy and a method for improving the synthesis efficiency of yeast ferulic acid, belonging to the field of microbial technology. SAM often participates in cell life activities as a methyl donor, and plays an important role in the synthesis of various natural products such as ferulic acid. Therefore, the present invention designs a SAM cofactor metabolic engineering strategy, which can accelerate the methyl cycle in Saccharomyces cerevisiae cells, continuously supply the cofactor SAM, and improve the synthesis efficiency of the target product. This strategy can avoid the exogenous addition of expensive, low transmembrane efficiency and photolabile cofactors or their precursors, while significantly improving the synthesis efficiency of ferulic acid. The SAM cofactor engineering used in the present invention makes the ferulic acid output increase 39% in the shake flask fermentation, reaches 184.2mg/L, and the transformation efficiency of substrate caffeic acid synthetic ferulic acid is improved to 64% by 46%, simultaneously batch formula replenishes Feed fermentation reached the highest yield so far of 3.8g/L. This strategy has the characteristics of high transformation efficiency, low production cost, and broad prospects for industrial application, which proves that SAM cofactor engineering has important potential and application value in the synthesis of ferulic acid and other SAM-dependent natural products in Saccharomyces cerevisiae.

As an embodiment, the present application provides a method for improving yeast ferulic acid synthesis efficiency through a SAM cofactor engineering strategy, which is characterized in that it mainly includes the following steps:

(1) Express the caffeic acid oxymethyltransferase NtCOMT1 derived from tobacco (Nicotiana tabacum) in the previously constructed caffeic acid yeast chassis cells, and obtain the ferulic acid-synthesizing Saccharomyces cerevisiae strain RB202;

(2) Express three key genes in the SAM synthesis pathway, including Saccharomyces cerevisiae endogenous MET6, artificially modified cMTFHR and LiMETK1 from the bacterium Leishmania infantum, to obtain recombinant yeast RB210, which can improve the synthesis level of SAM and realize ferulic acid synthesis;

(3) Further, by expressing the Saccharomyces cerevisiae-derived genes ADO1 and SAH1, the recombinant yeast RB218 was obtained, which increased the turnover rate of SAM, realized the efficient cycle of methyl groups, and enhanced the synthesis of ferulic acid.

Optionally, the NtCOMT1 gene after codon optimization has the nucleotide sequence shown in SEQ ID NO: 1, the MET6 gene after codon optimization has the nucleotide sequence shown in SEQ ID NO: 2, the codon The optimized cMTFHR gene has the nucleotide sequence shown in SEQ ID NO: 3, the codon-optimized LiMETK1 gene has the nucleotide sequence shown in SEQ ID NO: 4, and the ADO1 gene has the nucleotide sequence shown in SEQ ID NO: The nucleotide sequence shown in 5; SAH1 gene has the nucleotide sequence shown in SEQ ID NO: 6.

Optionally, the method also includes step (4) using 20g/L glucose as a substrate in a basal salt medium to inoculate engineered yeast strains for fermentation, the initial inoculation _OD600 is 0.1, and the fermentation condition is a liquid loading capacity of 20 /100mL, 30°C, 220rpm, fermentation time is 96h.

The expressed gene for enhanced cofactor supply may come from the coding gene of isozyme of other species or its codon-optimized gene.

Application of any of the above-mentioned engineered yeasts in the production of ferulic acid or similar SAM-dependent methylation products.

The invention belongs to the application field of microbial genetic engineering and metabolic engineering, and specifically relates to a yeast SAM cofactor regulation strategy for improving the synthesis of ferulic acid and other SAM-dependent methylation products.

The purpose of the present invention is to provide a cofactor SAM engineering strategy to solve the difficulty of insufficient supply of endogenous SAM during the synthesis of ferulic acid and other methylated products, thereby improving the synthesis efficiency of yeast cell factories.

The method for constructing a Saccharomyces cerevisiae strain producing ferulic acid provided by the application. The high caffeic acid-producing strain RB197 constructed earlier was used as the starting chassis cell, and the caffeic acid oxymethyltransferase gene NtCOMT1 (optimized nucleotide sequence shown in SEQ ID NO: 1) was overexpressed to obtain strain RB202. Acid synthesis of ferulic acid.

The present application provides a SAM cofactor engineering strategy, which can significantly increase the yield of ferulic acid.

The method of the above technical solution is to overexpress three key enzyme genes of the SAM synthesis pathway in Saccharomyces cerevisiae strain RB197 to obtain strain RB210, thereby improving the metabolic flow and synthesis level of SAM in the engineering strain. Specifically include overexpressing MET6 (the optimized nucleotide sequence is shown in SEQ ID NO: 2), cMTFHR (the optimized nucleotide sequence is shown in SEQ ID NO: 3) and LiMETK1 (the optimized nucleotide sequence is shown in SEQ ID NO: 3) and LiMETK1 (the optimized nucleotide sequence is shown in SEQ ID NO: 3) ID NO: 4).

Further, by expressing Saccharomyces cerevisiae endogenous genes ADO1 (nucleotide sequence shown in SEQ ID NO: 5) and SAH1 (nucleotide sequence shown in SEQ ID NO: 6), recombinant yeast RB218 was obtained to achieve efficient Methyl cycle and SAM turnover, supporting high-level synthesis of ferulic acid.

Further, RB218 yeast strain was inoculated to carry out ferulic acid synthesis fermentation.

Alternatively, shake flask fermentation is carried out in a basal salt medium with 20g/L glucose as the substrate, the initial inoculation _OD600 is 0.1, the fermentation conditions are liquid volume 20/100mL, 30°C, 220rpm, and the fermentation time is 96h .

Alternatively, batch fed-batch fermentation was carried out in a 1L fermenter, and the fermentation was started on a basal salt medium with 20g/L glucose as the substrate, with an initial inoculum volume of 0.25L and an _OD600 of 0.2. Dissolved oxygen is controlled to be 40% by the stirring paddle speed (800-1200rpm), and the fermentation temperature is 30°C. The pH was maintained at 5.6 using 4M KOH and 2M HCl. During the fed-batch phase, additional 200 g/L glucose solution was added, and the feed rate was coupled to growth and increased exponentially (set μ to 0.05 h-1) to maintain a constant biomass-to-glucose consumption rate.

Further, the fermentation product is extracted and detected. The results demonstrate that the SAM cofactor engineering strategy can significantly increase the production of ferulic acid.

Beneficial effect:

The present invention provides a SAM cofactor engineering strategy to solve the difficulty of insufficient supply of endogenous cofactors during the synthesis of ferulic acid and other methylated products, thereby improving their synthesis efficiency.

The cofactor regulation method of the present invention involves SAM synthesis and SAM cycle, which can realize high-speed turnover and high-level supply of endogenous cofactor SAM, avoid the addition of expensive and unstable cofactor or its prerequisites from exogenous sources, and reduce cost consumption.

The invention uses SAM cofactor engineering to make the ferulic acid output reach 184.2mg/L, the conversion efficiency of the substrate caffeic acid to synthesize ferulic acid is increased from 46% to 64%, and at the same time, the batch-type fed-batch fermentation reaches the highest yield so far of 3.8g/L L, demonstrating the potential of this cofactor engineering strategy for the industrialization of cell factories.

Description of drawings

Figure 1 shows a schematic diagram of the pgRNA plasmid construction process in the Saccharomyces cerevisiae CRISPR/Cas9 system. .

Figure 2 shows the yield of ferulic acid synthesized by SAM cofactor engineered yeast in shake flasks.

Figure 3 shows a schematic diagram of the SAM cofactor engineering strategy.

Figure 4 shows the yield of ferulic acid produced by SAM cofactor engineered yeast in bacterial batch fed-batch fermentation.

Detailed ways

The following non-limiting examples can enable those skilled in the art to understand the present invention more fully, but do not limit the present invention in any way. In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials used, reagents, etc. can be purchased from biological or chemical companies, and all technical and scientific terms used are consistent with those of the technical field of the application. The same meaning as commonly understood by those of ordinary skill.

The Saccharomyces cerevisiae strain that synthesizes ferulic acid can use any yeast strain that produces caffeic acid as the starting strain, and the caffeic acid-producing strain RB197 is used in the examples of the present application.

Construction of caffeic acid producing strain RB197:

A recombinant Saccharomyces cerevisiae CEN.PK113-11C-CAS (genotype MATa, SUC2, MAL2-8c, his3Δ, ura3Δ, XI5::(P _TEF1 -CAS9-T _CYC1 )) integrating the CAS9 gene was constructed and used as a host The strains were constructed for cofactor engineering yeast strains. Among them, the construction method of CEN.PK113-11C-CAS is as follows: First, directly chemically synthesize CAS9 and the resistance gene KanMX expression cassette T _AgTEF -KanMX-P _AgTEF -P _TEF1 -CAS9-T _CYC1 , and combine the expression cassette with XI5 by fusion PCR The upstream and downstream 500bp fusions obtained the donor DNA fragment XI5up-T _AgTEF -KanMX-P _AgTEF -P _TEF1 -CAS9-T _CYC1 -XI5dw, transformed Saccharomyces cerevisiae CEN.PK113-11C (available from Euroscarf, Germany), and homologous Recombination was integrated into the XI5 site, and positive strains were screened by geneticin G418 to obtain strain CEN.PK113-11C-CAS+KanMX. To remove the KanMX resistance gene tag from the genome, pgRNA-KanMX was transformed with the donor DNA fragment XI5up- _PTEF1 obtained by fusion PCR. Using the chemical transformation method, about 500ng of pgRNA-KanMX and donor DNA were simultaneously transformed into the yeast strain integrated with the Cas9 protein, and cultured statically at 30°C for 2 days on the SD plate with histidine added; the transformant was added with After cultured in the liquid SD medium of histidine, it was verified correctly by PCR, and spread on the solid medium containing 5-fluoroorotic acid for plasmid loss. After the plasmid loss, the strain CEN.PK113-11C-CAS was obtained, and the strain was preserved for future use. . Further transform pgRNA-GAL80 and donor DNA fragment GAL80up-GAL80dw to complete GAL80 knockout, and obtain strain A0 (MATa, SUC2, MAL2-8c, his3Δ, ura3Δ, gal80Δ, XI5::( _PTEF1 -CAS9-T _CYC1 )), The pathway genes that can realize the expression of _PGAL7 and _PGAL10/1 were highly expressed under the condition of glucose restriction.

Using the gene editing strain A0 constructed above, by transforming pgRNA-GPP1 and GPP1up-T _ENO2 -CkPTA-P _GAL10/1 -LmXFPK-T _ADH1 -GPP1dw to knock out GPP1 while expressing CkPTA and LmXFPK, and further transforming pgRNA-XI7 and XI7up -T _PRM9 -P _GAL10/1 -TAL1-T _PYK1 -XI7dw to express TAL1, then transform pgRNA-XI6 and XI6up-P _GAL7 -TKL1-T _ENO2 -XI6dw to express TKL1, and obtain cofactor NADPH engineering yeast strain A1.

Construction of the phenolic acid pathway on the basis of A1. Sequentially transform pgRNA-ARO10 and ARO10up-T _HIS3 -ARO7 ^G141S -P _GAL10/1 -ARO4 ^K229L -T _ENO2 -P _GAL7 -EcAROL-T _ADH1 -ARO10dw; pgRNA-PDC5 and PDC5up-T _CYC1 -FjTAL-Sc ^OPT1 - P _GAL10/1 -SbPAL1 ^H123F -Sc ^OPT1 -T _TDH2 -T _FBA1 -AtCPR1-Sc ^OPT1 -P _GAL7 -PDC5dw; pgRNA-XII4 and XII4up-T _PRM9t -PtrC4H2-Sc ^OPT1 -P _GAL10/1 -PtrC4H1-Sc ^OPT1 -T _PYK1 -P _GAL7 -PtrC3H3-Sc ^OPT1 -T _DIT1 -XII4dw; pgRNA-XII1 and XII1up-P _GAL7 -ARO1-T _ENO2 -T _CPS1 -ARO2-P _GAL10/1 -ARO3-T _HIS5 -XII1dw; pgRNA- pgRNA-XI8 and XI8up-T ^CPS1 _-PHA2 - _{P GAL10/1 -MtPDH1 -} Sc ^{OPT1 -T} _HIS5 -XI8dw, completed the construction and enhancement of the phenolic acid pathway, and obtained strain RB197.

The sgRNA expression vector construction process of each gene in the caffeic acid production strain RB197 is the same as that in Example 1, and the sgRNA expression vector involved includes pgRNA-GAL80 (target gene GAL80), pgRNA-GPP1 (target gene GPP1), pgRNA-XI7 (target gene To site XI7), pgRNA-XI6 (target site XI6), pgRNA-ARO10 (target gene ARO10), pgRNA-PDC5 (target gene PDC5), pgRNA-XII4 (target site XII4), pgRNA- XII1 (targeting site XII1), pgRNA-X2 (targeting site X2), pgRNA-XI8 (targeting site XI8), and the targeting sequences are shown in Table 1. For the donor DNA, respectively amplify about 500 bp downstream of the target site of the pgRNA vector as homology arms, and then assemble each fragment to be inserted by conventional fusion PCR to obtain a complete donor DNA molecule, and The pgRNAs of the corresponding sites were transformed into yeast together for gene editing and strain transformation. The information of each gene is shown in Table 2.

Table 1

sequence name	M20	N 20
pgRNA-GAL80	SEQ ID NO: 17; TTCCAAGGCACATTGTTAAA	SEQ ID NO: 18; CACAATTTGTAATGCAAGGT
pgRNA-GPP1	SEQ ID NO: 19; GTCTGGAGCGAACTTGGCAA	SEQ ID NO: 20; GAATACGTTAACAAGCTAGA
pgRNA-XI7	SEQ ID NO: 21; GTCAGTAACAGTGATTGCTG	SEQ ID NO: 22; TATGTAGGTTCCGATTAAAG
pgRNA-XI6	SEQ ID NO: 23; CGCTACAATTCGGTAAGTTT	SEQ ID NO: 24; TAGTAAATACAACTATTGGA
pgRNA-ARO10	SEQ ID NO: 25; GAAAACTGATTTCGTATCGA	SEQ ID NO: 26; AATATACGAACGAAACAATG
pgRNA-PDC5	SEQ ID NO: 27; GATAAGCTTTATGAAGTCAA	SEQ ID NO: 28; ATTTGCCTTGCAAAAATTGT
pgRNA-XII4	SEQ ID NO: 29; TAATGGGGAATTGTACAAAT	SEQ ID NO: 30; GTTACCCGCGCTATTTCACA
pgRNA-XII1	SEQ ID NO: 31; CCACTTCTCATGACATATAT	SEQ ID NO: 32; CAATACTAATTAGTCTTTGC
pgRNA-X2	SEQ ID NO: 33; CGGGTCTAGGCCTGCATAAT	SEQ ID NO: 34; GCTCGTTTCTTTTTTTCAGTG
pgRNA-XI8	SEQ ID NO: 35; GATGAAATAGCCTCAGTTAC	SEQ ID NO: 36; TTGTCGTGTTACTGATAGTA

pgRNA-KanMX

SEQ ID NO: 37; GGTTCTAGAAGTGCCCTTTG

SEQ ID NO: 38; ATTCTACCGATTTATCATGC

Table 2 Gene name and sequence number

serial number	gene name	source	serial number
1	GAL80	Saccharomyces cerevisiae	SEQ ID NO: 39
2	TKL1	Saccharomyces cerevisiae	SEQ ID NO: 40
3	TAL1	Saccharomyces cerevisiae	SEQ ID NO: 41
5	LmXFPK-Sc OPT1	Leuconostoc mesenteroides	SEQ ID NO: 42
6	CkPTA-Sc OPT1	Clostridium kluyveri	SEQ ID NO: 43
7	ARO4 K229L	Saccharomyces cerevisiae	SEQ ID NO: 44
8	ARO7 G141S	Saccharomyces cerevisiae	SEQ ID NO: 45
9	ECAROL	Escherichia coli	SEQ ID NO: 46
10	ARO1	Saccharomyces cerevisiae	SEQ ID NO: 47
11	ARO2	Saccharomyces cerevisiae	SEQ ID NO: 48
12	ARO3	Saccharomyces cerevisiae	SEQ ID NO: 49
13	PHA2	Saccharomyces cerevisiae	SEQ ID NO: 50
14	MtPDH1-Sc- OPT1	Medicago truncatula	SEQ ID NO: 51
15	FjTAL-Sc OPT1	Flavobacterium johnsoniae	SEQ ID NO: 52
16	SbPAL1 H123F -Sc OPT1	Sorghum bicolor	SEQ ID NO: 53
17	AtCPR1-Sc OPT1	Arabidopsis thaliana	SEQ ID NO: 54
18	PtrC4H1-Sc OPT1	Populus trichocarpa	SEQ ID NO: 55
19	PtrC4H2-Sc OPT1	Populus trichocarpa	SEQ ID NO: 56
20	PtrC3H-Sc OPT1	Populus trichocarpa	SEQ ID NO: 57
twenty one	PaHPAB-Sc OPT1	Pseudomonas aeruginosa	SEQ ID NO: 58
twenty two	SeHPAC-Sc OPT1	Sulfobacillus acidophilus	SEQ ID NO: 59

Note: Sc ^OPT1 indicates that the gene is codon-optimized according to S. cerevisiae preference.

The medium used in the embodiment is as follows:

YPD medium: 20g/L glucose, 20g/L peptone, 10g/L yeast powder;

SD medium: 20g/L glucose, 6.7g/L YNB, add histidine 0.02g/L when used;

Fermentation medium (basic component medium): (NH ₄ ) ₂ SO ₄ 2.5g/L, KH ₂ PO ₄ 14.4g/L, MgSO ₄ 7H ₂ O 0.5g/L, add about 900mL ddH ₂ O, adjust The pH is 5.6, the volume is adjusted to 950mL, and sterilized at 115°C for 30min. After sterilization, add 1mL vitamin solution (see Table 4 for recipe) and 2mL trace metal solution (see Table 3 for recipe), and add histidine and uracil (40mg/L) as needed. Glucose was added to the fermentation medium to 20g/L for phenolic acid fermentation.

Table 3 Trace metal solution configuration method (1L solution):

serial number	Reagent	Weight [g]
1	FeSO 4 7H 2 O	3.0
2	ZnSO 4 7H 2 O	4.5
3	CaCl 2 2H 2 O	4.5
4	MnCl 2 4H 2 O	1.03
5	CoCl 2 6H 2 O	0.3
6	CuSO 4 5H 2 O	0.3
7	Na 2 MoO 4 2H 2 O	0.4
8	H 3 BO 3	1.0
9	KI	0.1
10	Na 2 EDTA·2H 2 0	19.0

Table 4 Vitamin solution configuration method (1L solution):

serial number	name	Weight [g]
1	D-biotin	0.05
2	Calcium D-pantothenate	1.0
3	Thiamine	1.0
4	Pyridoxine	1.0
5	niacin	1.0
6	p-aminobenzoic acid	0.2
7	Inositol	25.0

Example 1

Construction of a Saccharomyces cerevisiae strain that synthesizes ferulic acid

Ferulic acid is converted from caffeic acid by caffeic acid oxymethyltransferase, which is a one-step methylation reaction. Therefore, NtCOMT1 was overexpressed in the caffeic acid producing strain RB197 constructed above, and it was found that it can synthesize ferulic acid more efficiently.

(1) Overexpression of oxygen methyltransferases including NtCOMT1

The promoter P _GAL10/1 was used to express the exogenous pathway to realize the synthesis of ferulic acid under the condition of sugar restriction and reduce the impact on cell growth.

Using the starting strain RB197, the exogenous gene NtCOMT1 was integrated into the yeast genome by transformation chemical transformation method and CRISPR technology to obtain strain RB202. The specific method is: pick a single clone of the strain and put it in 3 mL of YPD medium, culture it overnight at 220 rpm at 30°C for 16 hours; inoculate it into 20 mL of YPD medium (100 mL shake flask), ensure that the initial _OD600 is 0.1, and cultivate for about After 6 hours, the _OD600 reached 0.6-1.0; centrifuged at 2000g for 5min at room temperature to collect the cells, added 1mL of 0.1M LiAc solution to resuspend the cells, and transferred to a 2mL sterile centrifuge tube; centrifuged at 2000g for 2min to collect the cells, and resuspended in 200uL of 0.1M LiAc, placed on ice to obtain competent cells; add 120μL of PEG3350 solution (50%), 18μL of 1.0M LiAc solution, 5μL of 10mg/mL single-chain Protect ssDNA, add 500ng of donor DNA (XII5up-T _CSP1 -NtCOMT1-Sc ^OPT1 -P _GAL10/1 -NtCOMT1-T _HIS5 -XII5dw) and gRNA expression plasmid containing target gene NtCOMT1 expression cassette after mixing, then add 25μL After mixing the competent cells thoroughly; place the transformation system in a 30°C water bath for 30 minutes; then transfer to a 42°C water bath for heat shock for 15 minutes; immediately place it on ice for 2 minutes; Second, resuspend in 200ul sterilized water and apply SD plate for screening; after culturing at 30°C for 3 days, select a single colony on the plate for gene identification.

The construction process of the above sgRNA expression vectors is shown in Figure 1. All the sgRNA expression vectors used in the present invention are identical except for the 20bp targeting sequence. Briefly, the vector backbone S1 was first amplified from pgRNA (SEQ ID NO: 7) using primer 6005 (SEQ ID NO: 8, GATCATTTATTCTTTCACTGCGGAGAAG); then, sgRNA-1 and sgRNA-2 were amplified for targeting yeast Genomic loci were edited and exogenous gene inserted, wherein sgRNA-1 used primers p1 (SEQ ID NO: 9, GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATC) and pX1 (AAACTTCTCCGCAGTGAAAGATAAATGATC( _M20 )GTTTTGAGCTAGAAATAG, where _M20 is an alternative 20bp targeting sequence), sgRNA -2 Use primers p2 (SEQ ID NO: 10, GATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGC) and pX2 (AAACTTCTCCGCAGTGAAAGATAAATGATC(N ₂₀ )GTTTTAGAGCTAGAAATAG, where N(N ₂₀ ) is an alternative 20bp targeting sequence); finally, sgRNA fragment and vector backbone fragment use The Gibson Assembly method was used for cloning and connection, and the obtained recombinant vector was sequenced and applied. The replacement sequences of _M20 and _N20 in pX1 and pX2 in Examples 1-2 and the corresponding sequence names after replacement are shown in Table 5. The sgRNA expression vectors involved in Examples 1-2 of the present invention include pgRNA-XII5 (targeting site XII5), pgRNA-HO (targeting site HO), pgRNA-V3 (targeting gene V3). For the donor DNA, respectively amplify about 500 bp downstream of the target site of the pgRNA vector as homology arms, and then assemble each fragment to be inserted by conventional fusion PCR to obtain a complete donor DNA molecule, and The pgRNAs of the corresponding sites are transformed into yeast together for gene editing and strain transformation. The information of each gene is shown in Table 6.

table 5

sequence name	MMM	NNN
pgRNA-XII5	SEQ ID NO: 11, CTTATCGATATTTTGTATAT	SEQ ID NO: 12, TGGTACTACTGTCCTGATGT
pgRNA-HO	SEQ ID NO: 13, GTTCGTGAAGCATTCTTAGC	SEQ ID NO: 14, GCTCGCCGTACATAAATTCA
pgRNA-V3	SEQ ID NO: 15, GTGCTCTTAAGTCGTAATGA	SEQ ID NO: 16, CGTCTAGAAGAACAGCACAT

Table 6

serial number	sequence name	source	serial number
1	NtCOMT1-Sc OPT1	Nicotiana tabacum	SEQ ID NO:1
2	MET6-Sc OPT1	Saccharomyces cerevisiae	SEQ ID NO:2
3	cMTFHR-Sc OPT1	artificial design	SEQ ID NO:3
4	LiMETK1-Sc OPT1	Leishmania infantum	SEQ ID NO:4

5	ADO1-Sc OPT1	Saccharomyces cerevisiae	SEQ ID NO:5
6	SAH1-Sc- OPT1	Saccharomyces cerevisiae	SEQ ID NO:6
7	pgRNA	/	SEQ ID NO:7

Note: Sc ^OPT1 indicates that the gene is codon-optimized according to S. cerevisiae preference.

(2) Fermentation strains synthesize ferulic acid

Three positive clones were selected for fermentation. The fermentation experiment of ferulic acid was carried out under the condition of the basal medium containing 20g/L glucose, the initial inoculation _OD600 was 0.1, the fermentation condition was 20/100mL, 30℃, 220rpm, and the fermentation time was 96h.

Ferulic acid was then extracted and detected. Take 50 μL fermentation sample, add 450 μL sterile water, then add 500 μL ethanol, vortex and mix well; centrifuge at 13,000 g for 5 min, take 500 μL supernatant and pass through a 0.22 μm aqueous microporous membrane to obtain the phenolic acid sample. Samples were detected using Shimadzu HPLC, the chromatographic column was 3×100mm 2.7um Poroshell 120 EC-C18 (Agilent), the flow rate was 0.8mL/min, the mobile phase A was H ₂ O+0.05%HCOOH, and the mobile phase B was ACN+0.05 %HCOOH, the detection wavelength of the ultraviolet detector is 280nm or 330nm. The specific mobile phase gradient is 95%-A (0min), 90%-A (3min), 88%-A (4-5min), 85%-A (6-7min), 40%-A (10min), 95 %-A (12-14min).

It was found that overexpression of NtCOMT1 in engineering bacteria can synthesize ferulic acid relatively efficiently. As shown in Figure 2 RB202, ferulic acid reached 132.1 mg/L in shake flask fermentation.

Example 2

SAM cofactor engineering enhances ferulic acid production

The synthesis of ferulic acid requires a large number of SAM cofactors as methyl donors to participate in the reaction. Therefore, on the basis of strengthening the SAM synthesis pathway, further improving the methyl cycle and SAM regeneration speed can provide sufficient cofactors for the efficient synthesis of ferulic acid. Significantly increased the yield of ferulic acid synthesized by yeast (Figure 3).

(1) Strengthen the SAM synthesis pathway

It is still designed to use the GAL system promoter ( _PGAL10/1 or _PGAL7 ) to express the exogenous pathway, so as to realize the expression of exogenous genes under the condition of sugar restriction and reduce the impact on cell growth. Starting with the ferulic acid producing strain RB202, gene editing was performed by the same method as above, using pgRNA-HO and the donor DNA molecule HOup-T _HSP26 -MET6-P _GAL10/1 -cMTFHR-T _PDC6 -P _GAL7 -liMetK1-Sc ^OPT1 -T _UBX6 -HOdw expresses SAM synthesis pathway genes, MET6 (the optimized nucleotide sequence is shown in SEQ ID NO: 2), cMTFHR (the optimized nucleotide sequence is shown in SEQ ID NO: 3) and LiMETK1 ( The optimized nucleotide sequence is shown in SEQ ID NO: 4). The positive strain RB210 was obtained after molecular identification.

(2) Accelerate methyl cycle and SAM regeneration

Sah1 catalyzes a reversible reaction, and the reaction proceeds in the direction of synthesizing adenosylhomocysteine from homocysteine under natural conditions, which is not conducive to the synthesis of ferulic acid. Therefore, by overexpressing S-adenosylhomocysteine hydrolase SAH1 and adenosine kinase ADO1, it is possible to consume the by-product adenosine and change the kinetic direction of the reaction to synthesize homocysteine from adenosylhomocysteine. in the direction of cystine.

It is still designed to use the GAL system promoter ( _PGAL10/1 or _PGAL7 ) to express the exogenous genes SAH1 and ADO1, so that they can be expressed under the condition of sugar restriction. Starting with the ferulic acid producing strain RB210, gene editing was carried out by the same method as above, using pgRNA-V3 and the donor DNA molecule V3up-T _PRM9 -ADO1-P _GAL10/1 -SAH1-T _PYK1 -V3dw to express ADO1 (nucleoside Acid sequence as shown in SEQ ID NO: 5) and SAH1 (nucleotide sequence as shown in SEQ ID NO: 6), to obtain recombinant yeast RB218, to achieve efficient methyl cycle and SAM turnover, support the high ferulic acid horizontal compositing.

(3) Fermentation strains synthesize ferulic acid

Three positive clones of strains RB210 and RB218 were selected, and fermented and compound extracted by the above method. Sample detection was carried out by Shimadzu HPLC, and the detection method was consistent with the above. As a result, it was found that the yield of ferulic acid in the engineered strain RB210 reached 143.7 mg/L, which was 9% higher than that of the control strain RB202 (Fig. 2). The ferulic acid production of engineering strain RB218 was further increased by 28%, reaching 184.2mg/L. By calculating the conversion rate of caffeic acid (caffeic acid conversion rate%=100%×[ferulic acid production/(caffeic acid production+ferulic acid production)]). In particular, the conversion efficiency of caffeic acid into ferulic acid was increased from 46% to 64%, which significantly improved the synthesis efficiency of ferulic acid.

(4) Synthesis of ferulic acid by batch fed-batch fermentation

To verify the potential of SAM cofactor engineering to synthesize ferulic acid, RB218 was subjected to fed-batch fermentation. In a 1L fermenter, start fermentation with basal salt medium with 20g/L glucose as the substrate, the initial inoculum volume is 0.25L, and the OD600 is 0.2. Dissolved oxygen is controlled to be 40% by the stirring paddle speed (800-1200rpm), and the fermentation temperature is 30°C. The pH was maintained at 5.6 using 4M KOH and 2M HCl. During the fed batch phase, 500 g/L glucose solution was added every 24 hours until the glucose concentration reached 20 g/L. After 86 hours of final fermentation, the highest ferulic acid yield so far was 3.8g/L (Fig. 4). This result confirmed the potential and important application value of S. cerevisiae NADPH and FADH ₂ cofactor engineering in phenolic acid synthesis.

The above are only a few embodiments of the application, and do not limit the application in any form. Although the application is disclosed as above with preferred embodiments, it is not intended to limit the application. Any skilled person familiar with this field, Without departing from the scope of the technical solution of the present application, any changes or modifications made using the technical content disclosed above are equivalent to equivalent implementation cases, and all belong to the scope of the technical solution.

Claims (16)

1. A method for improving the supply of saccharomyces cerevisiae SAM cofactor, characterized in that the method comprises:

   MET6 gene, cMTFHR gene, LiMETK1 gene, SAH1 gene and ADO1 gene were introduced into Saccharomyces cerevisiae.
2. The method according to claim 1, characterized in that the method comprises:

   A DNA fragment containing T _HSP26 -MET6-P _GAL10/1 -cMTFHR-T _PDC6 -P _GAL7 -liMetK1-Sc ^OPT1 -T _UBX6 was integrated into the HO site of Saccharomyces cerevisiae;

   A DNA fragment containing T _PRM9 -ADO1-P _GAL10/1 -SAH1-T _PYK1 was integrated into the V3 locus of S. cerevisiae.
3. method according to claim 1, is characterized in that, the nucleotide sequence of MET6 gene is as shown in SEQ ID NO:2;

   The nucleotide sequence of the cMTFHR gene is shown in SEQ ID NO: 3;

   The nucleotide sequence of the LiMETK1 gene is shown in SEQ ID NO: 4;

   The nucleotide sequence of the ADO1 gene is shown in SEQ ID NO: 5;

   The nucleotide sequence of the SAH1 gene is shown in SEQ ID NO:6.
4. The method according to claim 1, wherein said Saccharomyces cerevisiae is a ferulic acid production strain;

   The ferulic acid producing strain is obtained by introducing the NtCOMT1 gene into the caffeic acid producing strain.
5. The method according to claim 4, wherein the nucleotide sequence of the NtCOMT1 gene is as shown in SEQ ID NO: 1.
6. The method according to claim 4, wherein the NtCOMT1 gene is introduced into the caffeic acid-producing bacterial strain as T _CSP1 -NtCOMT1-Sc ^OPT1 -P _GAL10/1 -NtCOMT1-T _HIS5 integrated into the XII5 site of the caffeic acid-producing bacterial strain .
7. The method according to claim 4, wherein the caffeic acid producing strain is obtained by introducing genes related to the phenolic acid synthesis pathway into the starting strain of Saccharomyces cerevisiae:

   The phenolic acid synthesis pathway-related genes include at least one of Aro4 ^K229L , Aro7 ^G141S , EcAROL, ARO1, ARO2, ARO3, PHA2, MtPDH1, FjTAL, SbPAL1 ^H123F , AtCPR1, PtrC4H1, PtrC4H2, PtrC3H, PaHPAB, SeHPAC.
8. The method according to claim 7, wherein the phenolic acid synthesis pathway-related genes include Aro4 K229L having a nucleotide sequence as shown in SEQ ID NO: 44, Aro4 ^K229L having a nucleotide sequence as shown in SEQ ID NO: 45 Aro7 ^G141S of the acid sequence, EcAROL having the nucleotide sequence shown in SEQ ID NO: 46, ARO1 having the nucleotide sequence shown in SEQ ID NO: 47, having the nucleotide shown in SEQ ID NO: 48 ARO2 of the sequence, ARO3 having the nucleotide sequence shown in SEQ ID NO: 49, PHA2 having the nucleotide sequence shown in SEQ ID NO: 50, and PHA having the nucleotide sequence shown in SEQ ID NO: 51 MtPDH1, FjTAL having the nucleotide sequence shown in SEQ ID NO: 52, SbPAL1 ^H123F having the nucleotide sequence shown in SEQ ID NO: 53, AtCPR1 having the nucleotide sequence shown in SEQ ID NO: 54 , PtrC4H1 having the nucleotide sequence shown in SEQ ID NO: 55, PtrC4H2 having the nucleotide sequence shown in SEQ ID NO: 56, PtrC3H having the nucleotide sequence shown in SEQ ID NO: 57, having At least one of PaHPAB having the nucleotide sequence shown in SEQ ID NO:58 and SeHPAC having the nucleotide sequence shown in SEQ ID NO:59.
9. The method according to claim 7, wherein the introduction site of ARO7 ^G141S , ARO4 ^K229L , and EcAROL is ARO10;

   The import site of FjTAL, SbPAL1 ^H123F and AtCPR1 is PDC5;

   The import site of PtrC4H2, PtrC4H1 and PtrC3H is XII4;

   The import site of ARO1, ARO2, and ARO3 is XII1;

   The import site of PahpaB and SehpaC is X2;

   The import site of PHA2 and MtPDH1 is XI8.
10. The method according to claim 7, wherein the DNA fragment containing _THIS3 -ARO7 ^G141S -P _GAL10/1 -ARO4 ^K229L -T _ENO2 -P _GAL7- EcAROL-T _ADH1 is integrated into the ARO10 site of the starting strain ;

    Integrate the DNA fragment containing T _CYC1 -FjTAL-Sc ^OPT1 -P _GAL10/1 -SbPAL1 ^H123F -Sc ^OPT1 -T _TDH2 -T _FBA1 -AtCPR1-Sc ^OPT1 -P _GAL7 into the PDC5 site of the starting strain;

    Integrate the DNA fragment containing T _PRM9t -PtrC4H2-Sc ^OPT1 -P _GAL10/1 -PtrC4H1-Sc ^OPT1 -T _PYK1 -P _GAL7 -PtrC3H-Sc ^OPT1 -T _DIT1 into the XII4 site of the starting strain;

    Integrate the DNA fragment containing P _GAL7 -ARO1-T _ENO2 -T _CPS1 -ARO2-P _GAL10/1 -ARO3-T _HIS5 into the XII1 site of the starting strain;

    Integrate the DNA fragment containing T _PRM9 -PahpaB-Sc ^OPT1 -P _GAL10/1 -SehpaC-Sc ^OPT1 -T _HIS3 into the X2 site of the starting strain;

    Integrate the DNA fragment containing T _CPS1 -PHA2-P _GAL10/1 -MtPDH1-Sc ^OPT1 -T _HIS5 into the XI8 site of the starting strain;
11. The method according to claim 7, characterized in that, the LmXFPK gene, the CkPTA gene, the TAL1 gene and the TKL1 gene are also introduced into the starting strain of Saccharomyces cerevisiae.
12. The method according to claim 11, wherein the nucleotide sequence of the TKL1 gene is as shown in SEQ ID NO: 40;

    The nucleotide sequence of the TAL1 gene is shown in SEQ ID NO: 41;

    The nucleotide sequence of the LmXFPK gene is shown in SEQ ID NO: 42;

    The nucleotide sequence of the CkPTA gene is shown in SEQ ID NO: 43.
13. The method according to claim 7, characterized in that the GAL80 gene of the starting strain of Saccharomyces cerevisiae is also knocked out.
14. The engineering bacterium obtained by the method described in any one of claims 1 to 3.
15. Application of the engineering bacteria obtained by the method according to any one of claims 1 to 3 and the engineering bacteria according to claim 14 in the preparation of SAM-dependent methylation products.
16. The use according to claim 15, characterized in that the SAM-dependent methylation product comprises ferulic acid.

Images