CN112516288B

CN112516288B - Application of N-glycosylation modified ganoderma lucidum immunomodulatory protein

Info

Publication number: CN112516288B
Application number: CN202011523442.6A
Authority: CN
Inventors: 周选围; 胡大卫; 徐伟民; 李奇璋
Original assignee: Tibet Anada Biomedical Technology Co ltd
Current assignee: Tibet Anada Biomedical Technology Co ltd
Priority date: 2020-12-22
Filing date: 2020-12-22
Publication date: 2023-04-18
Anticipated expiration: 2040-12-22
Also published as: CN112516288A

Abstract

The application of the N-glycosylation modified ganoderma lucidum immunomodulatory protein reduces the expression of proinflammatory mediators by inhibiting a p38 MAPK pathway, improves the expression of the anti-inflammatory mediators at the same time, has higher biological activity and lower cytotoxicity and shows more obvious anti-inflammatory activity.

Description

Application of N-glycosylation modified ganoderma lucidum immunomodulatory protein

Technical Field

The invention relates to a technology in the field of biological pharmacy, in particular to an application of an N-glycosylation modified ganoderma lucidum immunomodulatory protein.

Background

Macrophages, as a cell population with plasticity and pluripotency, exhibit significant functional differences under the influence of different microenvironments in vivo and in vitro. At present, macrophages are classified into M1 type, i.e., classically activated macrophages, and M2 type, i.e., alternatively activated macrophages, according to their activation state and function. M1-type macrophages are triggered in response to pro-inflammatory cytokines and pathogen-associated molecular patterns (PAMPs) such as interferon gamma (IFN-gamma) and LPS. This type of macrophage produces cytotoxic and inflammatory molecules such as Nitric Oxide (NO) and Reactive Oxygen Species (ROS), proinflammatory cytokines such as tumor necrosis factor (TNF- α), interleukin (IL) -1 β and IL-6, chemokines such as monocyte chemoattractant protein-1 (MCP-1/CCL-2), and the like. M2-type macrophages are primarily responsible for anti-inflammatory cytokines, parasite infection and injury associated molecular patterns (DAMPs) such as IL-4 and IL-13, and play an important role in inhibiting acute and chronic inflammatory responses and tissue repair. M2-type macrophages are capable of secreting large amounts of anti-inflammatory cytokines such as IL-10 and transforming growth factor-beta (TGF-. Beta.). The Ganoderma lucidum immunomodulatory protein is a bioactive protein existing in Ganoderma lucidum (Ganoderma lucidum), and has immunoregulatory function. It is disclosed in the prior art that ganoderma immunomodulatory protein is capable of activating macrophages while promoting the production of pro-inflammatory and anti-inflammatory mediators. However, proinflammatory mediators tend to be the cause of chronic inflammation.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides the application of the N-glycosylation modified ganoderma lucidum immunomodulatory protein, which can reduce the expression of proinflammatory mediators by inhibiting a p38 MAPK pathway and improve the expression of the proinflammatory mediators at the same time.

The invention is realized by the following technical scheme:

the invention relates to application of N-glycosylation modified ganoderma lucidum immunomodulatory protein in preparation of an anti-inflammatory drug for inhibiting a p38 MAPK pathway in cells and reducing expression of proinflammatory mediators.

The amino acid sequence of the N-glycosylation modified ganoderma lucidum immunomodulatory protein is shown as Seq ID No.1, seq ID No.2 and Seq ID No.3, and preferably: seq ID No.3.

The cells comprise mouse peritoneal macrophage RAW264.7.

The anti-inflammatory drug is a composition, a nutritional supplement, a food additive, a functional food supplement or a functional beverage composition, and comprises the N-glycosylation modified ganoderma lucidum immunomodulatory protein.

The invention relates to a preparation method of the ganoderma lucidum immunomodulatory protein modified by N-glycosylation, which is characterized in that based on the amino acid sequence of the ganoderma lucidum immunomodulatory protein shown in Seq ID No.17, the gene synthesis is carried out by referring to pichia pastoris (Pichia pastoris) preference codon shown in Seq ID No.18, and the primer shown in Seq ID No. 4-7 is used for obtaining the N31S gene of the ganoderma lucidum immunomodulatory protein modified by N-glycosylation shown in Seq ID No. 19; or obtaining the N-glycosylation modified ganoderma lucidum immunomodulatory protein T36N gene shown in the Seq ID No.20 through primers shown in the Seq ID No.4, seq ID No.8, seq ID No.9 and Seq ID No. 7; or obtaining the N-glycosylation modified ganoderma lucidum immunomodulatory protein N31S/T36N gene shown in the sequence ID No.21 through primers shown in the sequence ID No.4, the sequence ID No.5, the sequence ID No.10 and the sequence ID No. 7. The N31S gene, the T36N gene and the N31S/T36N gene are respectively cloned to a eukaryotic expression vector pPIC 9K: X-His, and then the Pichia pastoris GS115 is respectively transformed to obtain yeast transformants, and finally the recombinant protein is obtained through methanol induction.

The primer is specifically as follows: seq ID No.4:5 'ccgccgccggaaattcatgtctgacacaccgcttttgatctc-3', seq ID No.5:5 'gaagttagatggttaccctttccc-3', seq ID No.6:5 'gggaaggtaacccatctataactttcatcacaaag-3', seq ID No.7:5 'atgatgatgggccgtccattgagcaatgatgaagtcg-3', seq ID No.8:5 'gaagttgtttgggttaccctttccc-3', seq ID No.9:5 'gggaaggtaacccaaacaacttcatcatcgacaacaacgttaccttccccaaag-3', seq ID No.10:5 'gggaaggtaaccctacttcatcatcaacgttaccctcccaaag-3'.

The Ganoderma lucidum immunomodulatory protein is selected from Ganoderma lucidum (Ganoderma lucidum), ganoderma tsugae (Ganoderma tsugae), ganoderma sinense (Ganoderma japonica), ganoderma microsporum (Ganoderma microsporum), ganoderma sinense (Ganoderma sinensis), ganoderma atrum (Ganoderma atrum), ganoderma applanatum (Ganoderma applanatum) and Ganoderma pseudoantler (Ganoderma amboinense), and preferably Ganoderma lucidum (Ganoderma lucidum).

The amino acid sequence of the ganoderma lucidum immunomodulatory protein is preferably Genbank: the sequence shown in LZ8_ GANLU is shown in detail in Seq ID No. 17.

The N-glycosylation modified ganoderma lucidum immunomodulatory protein is derived from a eukaryotic expression system, preferably a pichia pastoris expression system.

Technical effects

The invention obtains the N-glycosylation modified ganoderma lucidum immunomodulatory protein by modifying the ganoderma lucidum immunomodulatory protein; the N-glycosylation modified ganoderma lucidum immunomodulatory protein has an anti-inflammatory effect, and the effect is realized by inhibiting a p38 MAPK pathway. Compared with the prior art, the N-glycosylation modified ganoderma lucidum immunomodulatory protein has higher biological activity, lower cytotoxicity and more obvious anti-inflammatory activity.

Drawings

FIG. 1 is a nucleic acid electrophoresis diagram showing the acquisition of N-glycosylation modified genes of immunomodulatory proteins (N31S, T36N and N31S/T36N) of Ganoderma lucidum;

in FIG. 1A, lane 1 is the fragment N31S _ F1, lane 2 is the fragment N31S _ F2, lane 3 is the fragment T36N _ F1, lane 4 is the fragment T36N _ F2, lane 5 is the fragment N31S/T36N _ F1, lane 6 is the fragment N31S/T36N _ F2, lane M is DNA Marker DL 2, 000 (TaKaRa Biotechnology (Beijing) Ltd.). In FIG. 1B, lane 1 is the N31S gene, lane 2 is the T36N gene, lane 3 is the N31S/T36N gene, lane M is the DNA Marker DL 2, 000;

FIG. 2 is a graph showing the expression of ganoderma lucidum immunomodulatory protein and N-glycosylation modified ganoderma lucidum immunomodulatory protein;

in the figure: a is an SDS-PAGE detection image, and B is a Western Blot detection image. Lane M is the protein standard molecular weight (shanghai bi yunnan biotechnology limited), lane 1 shows ganoderma lucidum immunomodulatory protein WT; lane 2 shows N-glycosylation modified Ganoderma immunomodulatory protein N31S, lane 3 shows N-glycosylation modified Ganoderma immunomodulatory protein T36N, and lane 4 shows N-glycosylation modified Ganoderma immunomodulatory protein N31S/T36N;

FIG. 3 is a graph showing the relative amount of inflammatory mediator gene expression in examples;

the figure shows the effect of N-glycosylation modified ganoderma lucidum immunomodulatory protein on expression of pro-inflammatory mediator genes and anti-inflammatory mediator genes;

FIG. 4 is a schematic of Western Blot of the p38 MAPK pathway;

the anti-inflammatory mechanism of action of the N-glycosylation modified immunomodulatory proteins of Ganoderma lucidum is shown.

Detailed Description

Specific materials of the following examples include:

1. the strain is as follows: e.coli DH 5. Alpha.; pichia pastoris GS115.

2. Animal cells: mouse abdominal macrophage RAW264.7 purchased from cell bank of Shanghai Life sciences research institute of Chinese academy of sciences. The culture method comprises the following steps: mouse peritoneal macrophage RAW264.7 was washed with PBS, trypsinized, and the cells were suspended in DMEM cell culture medium. Count cells at 2X 10 ⁵ At a concentration of one/mL, cells were inoculated into a new cell culture flask containing DMEM medium and placed in CO ₂ The incubator was incubated at 37 ℃.

3. The kit comprises:

AxyPrep ^TM plasmid Miniprep Kit and @>

AxyPrep ^TM DNA Gel Extraction Kit, available from Kangning Life sciences (Wujiang) Ltd; t4 DNA Ligase, miniBEST Universal RNA Extraction Kit and PrimeScript ^TM RT Master Mix (Perfect Real Time) was purchased from TaKaRa Biotechnology (Beijing) Ltd; aceQ Universal SYBR qPCR Master Mix, available from Sorbon Kinzau Biotech, inc.; the BCA method protein concentration determination kit is purchased from Biotechnology engineering (Shanghai) Co., ltd.

4. Enzymes: 2 × TSINGKE Master Mix (blue), available from seiko biotechnology limited of kyoto; restriction enzymes EcoR I, apa I and Sac I, available from TaKaRa Biotechnology, beijing, inc.

Example 1

The preparation of the N-glycosylation modified ganoderma lucidum immunomodulatory protein specifically comprises the following steps:

1.1 Gene Synthesis

According to the amino acid sequence (Genbank: LZ8_ GANLU) of Ganoderma lucidum immunomodulatory protein from Ganoderma lucidum (Ganoderma lucidum), performing sequence synthesis by referring to Pichia pastoris (Pichia pastoris) preferred codon to obtain a synthetic sequence shown as Seq ID No.35, constructing the synthetic sequence on a cloning vector pUC-57, transforming to Escherichia coli strain DH5 alpha, and extracting plasmid.

This example refers to the Ganoderma lucidum immunomodulatory protein from Ganoderma lucidum (Ganoderma lucidum) as WT, the original Ganoderma lucidum immunomodulatory protein.

1.2 cloning of mutant genes

Carrying out PCR reaction by taking the plasmid in 1.1 as a template, which specifically comprises the following steps: carrying out conventional PCR reaction by respectively taking a primer sequence P1 shown in Seq ID No.4, a primer sequence P2 shown in Seq ID No.5, a primer sequence P3 shown in Seq ID No.6 and a primer sequence P4 shown in Seq ID No.7 as primers to obtain two fragments N31S _ F1 and N31S _ F2 of the N31S gene of the N-glycosylation modified ganoderma lucidum immunomodulatory protein; carrying out conventional PCR reaction by respectively taking a primer sequence P1 shown in Seq ID No.4, a primer sequence P5 shown in Seq ID No.8, a primer sequence P6 shown in Seq ID No.9 and a primer sequence P4 shown in Seq ID No.7 as primers to obtain two fragments T36N _ F1 and T36N _ F2 of the N-glycosylation modified ganoderma lucidum immunomodulatory protein T36N gene; a conventional PCR reaction was carried out using the primer sequences P1 and P2 shown in Seq ID No.4 and P7 shown in Seq ID No.10 and P4 shown in Seq ID No.7 as primers, respectively, to obtain two fragments N31S/T36N _ F1 and N31S/T36N _ F2 of the N31S/T36N gene of N-glycosylation modified Ganoderma lucidum immunomodulatory protein (FIG. 1A).

After purifying the above gene fragments, N31S _ F1 and N31S _ F2, T36N _ F1 and T36N _ F2, and N31S/T36N _ F1 and N31S/T36N _ F2 are used as primers and templates, respectively, to perform conventional PCR reactions, thereby obtaining N31S, T36N, and N31S/T36N genes, respectively (FIG. 1B).

1.3 obtaining of Yeast transformants: the laboratory constructed plasmid pPIC 9K: X-His as well as the WT gene obtained in 1.1 and the N31S, T36N and N31S/T36N genes obtained in 1.2 were digested with the restriction enzymes EcoR I and Apa I at 37 ℃ for 2h according to the following digestion system.

SaidThe enzyme cutting system is as follows: 20 μ L of buffer, 3 μ L of EcoR I, 3 μ LApa I, 20 μ L of DNA (plasmid pPIC 9K: X-His and genes WT, N31S, T36N and N31S/T36N, respectively), 154 μ L of dH ₂ O。

1.4 the digestion products were separated by electrophoresis on a 1% agarose gel in 1 XTAE electrophoresis buffer, stained with ethidium bromide, photographed using a gel imaging system and the linearized vector pPIC 9K: his as well as the WT, N31S, T36N and N31S/T36N gene fragments were recovered. The WT, N31S, T36N, and N31S/T36N gene fragments were ligated with the linearized vector pPIC 9K: his, respectively, according to conventional reaction protocols to construct the recombinant expression plasmids pPIC 9K: WT-His, pPIC 9K: N31S-His, pPIC 9K: T36N-His, and pPIC 9K: N31S/T36N-His.

1.5 the ligation product was transformed into E.coli DH 5. Alpha. The plasmids pPIC 9K: WT-His, pPIC 9K: respectively

N31S-His, pPIC 9K: T36N-His and pPIC 9K: N31S/T36N-His, were digested with the restriction enzyme Sac I for 2h at 37 ℃. And recovering the enzyme digestion product, and then carrying out yeast transformation to obtain a yeast transformant.

The yeast transformation comprises the following steps:

1.5.1 Pichia pastoris monoclonal was picked, cultured in YPD liquid medium at 30 ℃ at 220rpm with shaking to OD ₆₀₀ 0.8 to 1.0;

1.5.2 ) at 1, 500 Xg room temperature for 10min, harvest cells, with 25mL sterile water washing, and the same conditions of centrifugation, abandon the supernatant, with the 1mL 100mM LiCl heavy suspension cells;

1.5.3 Transfer the cell suspension to a 1.5mL centrifuge tube, centrifuge at maximum speed for 15s, remove LiCl;

1.5.4 Resuspend the cells with 400. Mu.L of 100mM LiCl and dispense 50. Mu.L of the cell suspension into 1.5mL centrifuge tubes;

1.5.5 Boiling single-stranded DNA for 5min and then rapidly putting into ice;

1.5.6 ) centrifuging the cell suspension to remove LiCl;

1.5.7 mu.L 50% PEG, 36. Mu.L LiCl at a concentration of 1M, 50. Mu.g of single-stranded DNA, and 10. Mu.g of plasmid DNA were added in this order.

1.5.8 After resuspending the cells, the cells were cultured at room temperature for 30min;

1.5.9 Heat shock at 42 ℃ for 20-25 min;

1.5.10 Centrifuging at 6,000-8,000 rpm, discarding the transformation solution, and resuspending with 1mL of sterile water;

1.5.11 ) applying appropriate amount of suspension to MD ^Kan Culturing on solid culture medium at 30 deg.C for 2-4 days.

1.6 expression and purification of recombinant proteins: selecting yeast transformant to be monoclonal to BMGY liquid culture medium, and carrying out shaking culture at 30 ℃ and 220rpm until OD600 is 2-6; centrifugation at 2, 500 × g for 5min at room temperature to collect cells, supernatant was removed, and cells were resuspended in BMMY liquid medium to an OD600 of 1.0; four days in culture, pure MeOH was added daily to BMMY broth to a final concentration of 1% (V/V).

1.7 at room temperature with 2, 500 Xg centrifugal 5min to collect the supernatant, and the supernatant through 3.5kD dialysis bag dialysis, dialysis bag fluid freeze drying and Lysis Buffer dissolved; his60 Ni Superflow Resin column was equilibrated with 5 volumes of lysine Buffer; loading Lysis Buffer solution; washing with 10 times volume of Wash Buffer; eluting with 2 times volume of Elution Buffer and collecting the eluent; dialyzing the eluate through 3.5kD dialysis bag, freeze-drying the dialysate in the dialysis bag, and dissolving in PBS to obtain PBS solution containing recombinant WT, N31S, T36N and N31S/T36N proteins. The obtained protein solution was subjected to SDS-PAGE and Western Blot detection. The results showed that the resulting protein was the protein of interest (FIG. 2).

Example 2

The anti-inflammatory application of the N-glycosylation modified ganoderma lucidum immunomodulatory protein specifically comprises the following steps:

at 2X 10 ⁵ Cell/well concentration cells were seeded into 24 well cell culture plates and cultured for 24h. The medium was discarded, and medium containing 10. Mu.g/mL of Ganoderma lucidum immunomodulatory protein (WT) and N-glycosylation-modified Ganoderma lucidum immunomodulatory protein (N31S, T36N and N31S/T36N) was added, respectively, and the culture was continued for 6 hours. Total RNA was extracted using the MiniBEST Universal RNA Extraction Kit. Using PrimeScript ^TM RT Master Mix (Perfect read Time), reverse transcribing the extracted RNA into cDNA according to the following system and procedure:

reverse rotationThe recording system is specifically as follows: 4 μ L of 5 XPrimeScript RT Master Mix, 1 μ g RNA, up to 20 μ L dH ₂ O。

The reaction was carried out at 37 ℃ for 15 minutes, at 85 ℃ for 5 seconds, and then stored at 4 ℃.

After diluting the cDNA by 50 times, real-time fluorescent quantitative PCR reaction was performed using the following primers, reaction system, program and calculation method.

The primer sequence comprises: the IL-6 primer sequence pair shown as Seq ID No.11 and Seq ID No. 12; a pair of TGF-. Beta.1 primer sequences as shown in Seq ID No.13 and Seq ID No. 14; the primer sequence pairs for beta-actin as shown in Seq ID No.15 and Seq ID No. 16.

The reaction system is as follows: mu.L of 5 × AceQ Universal SYBR qPCR Master Mix, 0.2. Mu.L Primer F, 0.2. Mu.L Primer R, 2. Mu.L cDNA and 2.6. Mu.L dH ₂ O。

The amplification procedure was followed 5 minutes at 95 ℃ and 40 cycles at 10 seconds at 95 ℃ and 30 seconds at 60 ℃ and finally 5 seconds at 65 ℃ after 10 minutes at 95 ℃.

Data processing: use 2 ^-ΔΔCt The method of (4) calculating the expression amount. Namely, Δ Ct = Ct _{Target gene} －Ct _{Reference gene} ；ΔΔCt＝ΔCt _{Experimental group} －ΔCt _{Control group} (ii) a Fold change =2 ^-ΔΔCt 。

As shown in FIG. 1, the N-glycosylation modified Ganoderma lucidum immunomodulatory proteins (N31S, T36N and N31S/T36N) significantly inhibited the expression of the proinflammatory mediator IL-6 gene and promoted the expression of the anti-inflammatory mediator TGF-. Beta.1, as compared to Ganoderma lucidum immunomodulatory protein (WT). Meanwhile, the result also shows that the effect of N31S/T36N is more obvious.

Example 3

Analysis of anti-inflammatory mechanism of N-glycosylation modified ganoderma lucidum immunomodulatory protein:

at 2X 10 ⁵ Cell/well concentration cells were seeded into 24 well cell culture plates and cultured for 24h. The medium was discarded, and the medium containing the Ganoderma lucidum immunomodulatory protein and the N-glycosylation-modified Ganoderma lucidum immunomodulatory protein at a concentration of 10. Mu.g/mL were added, respectively, and the culture was continued for 24 hours. Wash cells with PBSAfter that, an appropriate amount of RIPA (Shanghai Biyuntian Biotechnology Co., ltd.) was added, and after whipping, it was centrifuged at 12,000 rpm for 10min at 4 ℃. The supernatant was collected, and the protein concentration was measured using the BCA method protein concentration measurement kit. Western Blot detection was performed using β -actin, p38 and phosphorylated p38 (p-p 38) antibodies (Abcam) as primary antibodies and goat anti-mouse and goat anti-rabbit IgG labeled with horseradish peroxidase (HRP) (Biotechnology engineering (Shanghai) Co., ltd.) as secondary antibodies. The results are shown in fig. 2, compared with ganoderma lucidum immunomodulatory protein (WT), N-glycosylation modified ganoderma lucidum immunomodulatory protein (N31S, T36N and N31S/T36N) can significantly interfere with phosphorylation of p38, thereby inhibiting p38 MAPK signaling pathway. Meanwhile, the effect of N31S/T36N is more obvious.

The invention transforms the ganoderma lucidum immunomodulatory protein through an in vitro mutation technology to obtain the N-glycosylation modified ganoderma lucidum immunomodulatory protein, and compared with the ganoderma lucidum immunomodulatory protein, the N-glycosylation modified ganoderma lucidum immunomodulatory protein has more remarkable biological activity, more excellent anti-inflammatory effect and lower cytotoxicity.

The foregoing embodiments may be modified in many different ways by one skilled in the art without departing from the spirit and scope of the invention, which is defined by the appended claims and not by the preceding embodiments, and all embodiments within their scope are intended to be limited by the scope of the invention.

Sequence listing

<110> Tibet ananda biopharmaceutical science, limited liability company

Application of <120> N-glycosylation modified ganoderma lucidum immunomodulatory protein

<130> fnc283e

<141> 2020-12-16

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 111

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Ser Asp Thr Ala Leu Ile Phe Arg Leu Ala Trp Asp Val Lys Lys

1 5 10 15

Leu Ser Phe Asp Tyr Thr Pro Asn Trp Gly Arg Gly Asn Pro Ser Asn

20 25 30

Phe Ile Asp Thr Val Thr Phe Pro Lys Val Leu Thr Asp Lys Ala Tyr

35 40 45

Thr Tyr Arg Val Ala Val Ser Gly Arg Asn Leu Gly Val Lys Pro Ser

50 55 60

Tyr Ala Val Glu Ser Asp Gly Ser Gln Lys Val Asn Phe Leu Glu Tyr

65 70 75 80

Asn Ser Gly Tyr Gly Ile Ala Asp Thr Asn Thr Ile Gln Val Phe Val

85 90 95

Val Asp Pro Asp Thr Asn Asn Asp Phe Ile Ile Ala Gln Trp Asn

100 105 110

<210> 2

<211> 111

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ser Asp Thr Ala Leu Ile Phe Arg Leu Ala Trp Asp Val Lys Lys

1 5 10 15

Leu Ser Phe Asp Tyr Thr Pro Asn Trp Gly Arg Gly Asn Pro Asn Asn

20 25 30

Phe Ile Asp Asn Val Thr Phe Pro Lys Val Leu Thr Asp Lys Ala Tyr

35 40 45

Thr Tyr Arg Val Ala Val Ser Gly Arg Asn Leu Gly Val Lys Pro Ser

50 55 60

Tyr Ala Val Glu Ser Asp Gly Ser Gln Lys Val Asn Phe Leu Glu Tyr

65 70 75 80

Asn Ser Gly Tyr Gly Ile Ala Asp Thr Asn Thr Ile Gln Val Phe Val

85 90 95

Val Asp Pro Asp Thr Asn Asn Asp Phe Ile Ile Ala Gln Trp Asn

100 105 110

<210> 3

<211> 111

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Ser Asp Thr Ala Leu Ile Phe Arg Leu Ala Trp Asp Val Lys Lys

1 5 10 15

Leu Ser Phe Asp Tyr Thr Pro Asn Trp Gly Arg Gly Asn Pro Ser Asn

20 25 30

Phe Ile Asp Asn Val Thr Phe Pro Lys Val Leu Thr Asp Lys Ala Tyr

35 40 45

Thr Tyr Arg Val Ala Val Ser Gly Arg Asn Leu Gly Val Lys Pro Ser

50 55 60

Tyr Ala Val Glu Ser Asp Gly Ser Gln Lys Val Asn Phe Leu Glu Tyr

65 70 75 80

Asn Ser Gly Tyr Gly Ile Ala Asp Thr Asn Thr Ile Gln Val Phe Val

85 90 95

Val Asp Pro Asp Thr Asn Asn Asp Phe Ile Ile Ala Gln Trp Asn

100 105 110

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccgccgccgg aattcatgtc tgacaccgct ttgatcttc 39

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaagttagat gggttacctc ttccc 25

<210> 6

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggaagaggt aacccatcta acttcatcga caccgttacc ttcccaaag 49

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgatgatgg ggcccgttcc attgagcaat gatgaagtcg 40

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaagttgttt gggttacctc ttccc 25

<210> 9

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gggaagaggt aacccaaaca acttcatcga caacgttacc ttcccaaag 49

<210> 10

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gggaagaggt aacccatcta acttcatcga caacgttacc ttcccaaag 49

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

catgttctct gggaaatcgt gg 22

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aacgcactag gtttgccgag ta 22

<210> 13

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acagcaccaa ttgtccaagt ttc 23

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cggtgcatgc atagccttgt 20

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

atcgtgcggg acatcaagg 19

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcgttgccga tggtgatgac 20

<210> 17

<211> 111

<212> PRT

<213> N-glycosylation modified immunomodulatory protein (Artificial Sequence) of Ganoderma lucidum

<400> 17

Met Ser Asp Thr Ala Leu Ile Phe Arg Leu Ala Trp Asp Val Lys Lys

1 5 10 15

Leu Ser Phe Asp Tyr Thr Pro Asn Trp Gly Arg Gly Asn Pro Asn Asn

20 25 30

Phe Ile Asp Thr Val Thr Phe Pro Lys Val Leu Thr Asp Lys Ala Tyr

35 40 45

Thr Tyr Arg Val Ala Val Ser Gly Arg Asn Leu Gly Val Lys Pro Ser

50 55 60

Tyr Ala Val Glu Ser Asp Gly Ser Gln Lys Val Asn Phe Leu Glu Tyr

65 70 75 80

Asn Ser Gly Tyr Gly Ile Ala Asp Thr Asn Thr Ile Gln Val Phe Val

85 90 95

Val Asp Pro Asp Thr Asn Asn Asp Phe Ile Ile Ala Gln Trp Asn

100 105 110

<210> 18

<211> 333

<212> DNA

<213> Pichia pastoris preferred codons (Pichia pastoris Artificial Sequence)

<400> 18

atgtctgaca ccgctttgat cttcagactg gcttgggacg tcaagaagtt gtccttcgac 60

tacaccccaa actggggaag aggtaaccca aacaacttca tcgacaccgt taccttccca 120

aaggtcttga ctgacaaggc ctacacctac agagttgccg tttctggtcg taacctgggt 180

gtcaagccat cctacgctgt tgagtccgac ggttcccaga aggtcaactt cttggagtac 240

aactctggtt acggtatcgc tgacactaac accatccaag ttttcgttgt cgacccagac 300

accaacaacg acttcatcat tgctcaatgg aac 333

<210> 19

<211> 333

<212> DNA

<213> N-glycosylation modified N31S gene (Artificial Sequence) of immunomodulating protein of Ganoderma lucidum

<400> 19

atgtctgaca ccgctttgat cttcagactg gcttgggacg tcaagaagtt gtccttcgac 60

tacaccccaa actggggaag aggtaaccca tctaacttca tcgacaccgt taccttccca 120

aaggtcttga ctgacaaggc ctacacctac agagttgccg tttctggtcg taacctgggt 180

gtcaagccat cctacgctgt tgagtccgac ggttcccaga aggtcaactt cttggagtac 240

aactctggtt acggtatcgc tgacactaac accatccaag ttttcgttgt cgacccagac 300

accaacaacg acttcatcat tgctcaatgg aac 333

<210> 20

<211> 333

<212> DNA

<213> N-glycosylation modified T36N gene (Artificial Sequence)

<400> 20

atgtctgaca ccgctttgat cttcagactg gcttgggacg tcaagaagtt gtccttcgac 60

tacaccccaa actggggaag aggtaaccca aacaacttca tcgacaacgt taccttccca 120

aaggtcttga ctgacaaggc ctacacctac agagttgccg tttctggtcg taacctgggt 180

gtcaagccat cctacgctgt tgagtccgac ggttcccaga aggtcaactt cttggagtac 240

aactctggtt acggtatcgc tgacactaac accatccaag ttttcgttgt cgacccagac 300

accaacaacg acttcatcat tgctcaatgg aac 333

<210> 21

<211> 333

<212> DNA

<213> N-glycosylation modified N31S/T36N gene (Artificial Sequence)

<400> 21

atgtctgaca ccgctttgat cttcagactg gcttgggacg tcaagaagtt gtccttcgac 60

tacaccccaa actggggaag aggtaaccca tctaacttca tcgacaacgt taccttccca 120

aaggtcttga ctgacaaggc ctacacctac agagttgccg tttctggtcg taacctgggt 180

gtcaagccat cctacgctgt tgagtccgac ggttcccaga aggtcaactt cttggagtac 240

aactctggtt acggtatcgc tgacactaac accatccaag ttttcgttgt cgacccagac 300

accaacaacg acttcatcat tgctcaatgg aac 333

Claims

1. A preparation method of ganoderma lucidum immunomodulatory protein based on N-glycosylation modification is characterized in that based on amino acid sequence of ganoderma lucidum immunomodulatory protein shown in Seq ID No.17, gene synthesis is carried out by referring to preferred codon of Pichia pastoris (Pichia pastoris) shown in Seq ID No.18, and the method comprises the following steps:

(1) obtaining the N-glycosylation modified ganoderma lucidum immunomodulatory protein N31S gene shown in Seq ID No.19 by the primers shown in Seq ID No. 4-7; or by

(2) Obtaining the N-glycosylation modified ganoderma lucidum immunomodulatory protein T36N gene shown in Seq ID No.20 by using the primers shown in Seq ID No.4, seq ID No.8, seq ID No.9 and Seq ID No. 7; or by

(3) Obtaining N-glycosylation modified ganoderma lucidum immunomodulatory protein N31S/T36N gene shown in Seq ID No.21 by primers shown in Seq ID No.4, seq ID No.5, seq ID No.10 and Seq ID No. 7;

then cloning the N31S gene, the T36N gene and the N31S/T36N gene to a eukaryotic expression vector pPIC 9K: X-His respectively, then transforming Pichia pastoris GS115 respectively to obtain yeast transformants, and finally obtaining recombinant protein through methanol induction;

the N-glycosylation modified ganoderma lucidum immunomodulatory protein is derived from a pichia pastoris expression system, and the amino acid sequence of the N-glycosylation modified ganoderma lucidum immunomodulatory protein is shown as Seq ID No.1, seq ID No.2 and Seq ID No. 3;

the Ganoderma lucidum immunomodulatory protein is selected from Ganoderma lucidum (Ganoderma lucidum), ganoderma tsugae (Ganoderma tsugae), ganoderma sinense (Ganoderma japonicum), ganoderma japonicum (Ganoderma japonicum), ganoderma microsporum (Ganoderma microsporum), ganoderma sinense (Ganoderma sinense), ganoderma atrum (Ganoderma atrum), ganoderma applanatum (Ganoderma applanatum) or Ganoderma pseudoantler (Ganoderma amboinense).

2. The method of claim 1, wherein the primers are specifically: seq ID No.4:5 'ccgccgccggaaattcatgtctgacacaccgcttttgatctc-3', seq ID No.5:5 'gaagttagatggttacccttcttccc-3', seq ID No.6:5 'gggaaggtaacccatctataactttcaaag-3', seq ID No.7:5 'atgatgatgggccgtccattgagcaatgatgaagtcg-3', seq ID No.8:5 'gaagttgtttgggttacccttcttccc-3', seq ID No.9:5 'gggaaggtaacccaaacaacttcatcatcgacaacacgtacttcccaaag 3', seq ID No.10:5 'gggaaggtaaccctacttcatcatcaacgttaccctcccaaag-3'.

3. Use of an N-glycosylation modified ganoderma lucidum immunomodulatory protein, prepared according to claim 1 or 2, for the preparation of an anti-inflammatory medicament for inhibiting the p38 MAPK pathway in a cell and decreasing expression of pro-inflammatory mediators.

4. The use of claim 3, wherein said cells comprise mouse peritoneal macrophage RAW264.7.