CN107936107B - Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application - Google Patents
Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application Download PDFInfo
- Publication number
- CN107936107B CN107936107B CN201711420022.3A CN201711420022A CN107936107B CN 107936107 B CN107936107 B CN 107936107B CN 201711420022 A CN201711420022 A CN 201711420022A CN 107936107 B CN107936107 B CN 107936107B
- Authority
- CN
- China
- Prior art keywords
- cgirf
- recombinant protein
- interferon
- gene
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The invention discloses a crassostrea gigas interferon regulating factorCgIRF‑1The amino acid sequence of the gene recombinant protein is shown in SEQ ID NO. 1. The preparation method comprises the following steps in sequence: primers P1 and P2 for the Pacific oyster interferon regulatory factorCgIRF‑1Carrying out PCR amplification on the gene coding region segment; the PCR amplification product is mixed with pET-30a vectorNde I、Xho IAfter enzyme digestion, the recombinant is connected through ligase, transformed, sequenced and identified; the recombinant is transferred into an expression strain of escherichia coli BL21 (DE 3) for induction culture, and then purification and renaturation are carried out. The Concha Ostreae interferon regulatory factorCgIRF‑1The gene recombinant protein can be applied to the preparation of immunopotentiators.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a crassostrea gigas interferon regulating factorCgIRF-1A gene recombinant protein, a preparation method and application.
Background
The crassostrea gigas is an important seawater cultured shellfish. Because crassostrea gigas lacks an adaptive immune defense system and mainly depends on an innate immune system to resist the infection of exogenous pathogenic microorganisms, various diseases caused by bacteria, fungi and viruses continuously burst in the breeding population of crassostrea gigas, and huge economic loss is caused.
Interferons (IFNs) are a class of cytokines that are capable of fighting viral infections, inhibiting the cell cycle and performing immunoregulatory functions. Interferon Regulatory Factors (IRFs) are important transcription factors that regulate the expression of Interferon (IFN), interferon-stimulated gene (ISG) and other related genes, and can bind to DNA sequences containing 5 '-GAAA-3' conserved motifs in the upstream promoter region of Interferon (IFN) or interferon-stimulated gene (ISG), and exert various biological effects by regulating the expression of IFN, ISG and other closely related genes. In vertebrates, 11 IRFs, IRF-1 to IRF-11, respectively, have been identified. All IRFs members contain a conserved helix-turn-helix type IRF domain at their N-terminus, also known as the DNA anchoring domain. In this domain, 5 conserved tryptophan residues (Trp) are present, which 5 conserved residues have an important role in the recognition of DNA sequences containing the 5 '-GAAA-3' tetranucleotide. The C ends of IRF-1 and IRF-2, which are IRFs, respectively contain an activation domain and an inhibition domain with low conservation. Research shows that IRF-1 and IRF-2 not only participate in virus defense, but also play an important role in cell reactions such as cell proliferation, differentiation and apoptosis, regulation of many diseases and the like.
However, no factor regulating the interferon of crassostrea gigas has been described so farCgIRF-1Gene recombinant protein, preparation method and related report of application in preparation of immunopotentiator.
Disclosure of Invention
The invention aims to solve the technical problems in the prior art and provides a crassostrea gigas interferon regulating factorCgIRF-1A gene recombinant protein, a preparation method and application.
The technical solution of the invention is as follows: ostrea gigas interferon regulating factorCgIRF-1A recombinant protein characterized by: amino acid sequenceIs shown as SEQ ID NO. 1.
The Concha Ostreae interferon regulating factorCgIRF-1The preparation method of the gene recombinant protein is characterized by comprising the following steps in sequence:
a. primers P1 and P2 for the Pacific oyster interferon regulatory factorCgIRF-1Carrying out PCR amplification on the gene coding region segment;
b. the PCR amplification product is mixed with pET-30a vectorNde I、Xho IAfter enzyme digestion, the recombinant is connected through ligase, transformed, sequenced and identified;
c. the recombinant is transferred into an expression strain of escherichia coli BL21 (DE 3) for induction culture, and then purification and renaturation are carried out, thus obtaining the recombinant protein with the amino acid sequence in the sequence table SEQ ID NO. 1.
The Concha Ostreae interferon regulating factorCgIRF-1Application of the gene recombinant protein in preparing immunopotentiator.
The invention relates to a crassostrea gigas interferon regulating factorCgIRF-1The gene recombinant protein can be combined with IFN Stimulation Response Elements (ISRE) in vitro, can activate a promoter of interferon-like protein (IFNLP) in oysters, can be used as an immunopotentiator, and has application values in the aspects of preparing antiviral drugs, anticancer agents, anti-inflammatory agents and the like.
Drawings
FIG. 1 shows the interferon regulatory factor of crassostrea gigas according to an embodiment of the present inventionCgIRF-1Electrophoresis chart of induction and purification of gene recombinant protein.
FIG. 2 shows the interferon regulatory factor of crassostrea gigas according to an embodiment of the present inventionCgIRF-1The effect graph of the in vitro binding activity of the gene recombinant protein and ISRE.
FIG. 3 shows the interferon regulatory factor of crassostrea gigas according to an embodiment of the present inventionCgIRF-1Functional effect diagram of activating CgIFNLP promoter region in HEK293T cell by gene recombinant protein.
Detailed Description
The invention relates to a crassostrea gigas interferon regulating factorCgIRF-1The amino acid sequence of the gene recombinant protein is shown in SEQ ID NO. 1.
The above Concha Ostreae interferon regulating factorCgIRF-1The preparation method of the gene recombinant protein is sequentially carried out according to the following steps:
1. construction of recombinant vectors
Primers P1 and P2 for the Pacific oyster interferon regulatory factorCgIRF-1Carrying out PCR amplification on the gene coding region segment;
the PCR reaction conditions are as follows: first, pre-denaturation at 95 ℃ for 5 min, then entering the following cycle: denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 1 min for a total of 30 cycles, and final extension at 72 ℃ for 10 min. The amplified fragment was purified and recovered, and ligated with pMD19-T vector. Screening positive clones after transformation, and extracting plasmids; use ofNde1AndXho1performing enzyme digestion on plasmids by two enzymes, and purifying and recovering a target fragment generated by enzyme digestion by using a glue recovery and purification kit (Dalibao bioengineering Co., Ltd.); recovering the target fragment and channelNde1AndXho1and connecting the two enzyme-digested expression vectors pET-30a to complete the construction of the vector.
2. Expression of recombinant protein rCgIRF-1
Taking escherichia coli BL21 ((DE 3) as a recombinant expression strain, transforming the recombinant vector with the correct reading frame after sequencing into an expression host bacterium, selecting a monoclonal, inoculating the monoclonal into 5 mL of LB liquid culture medium containing the kanamycin antibiotic, performing shake culture in a shaking table at 37 ℃ for 12-16 h, then inoculating into 200 mL of LB liquid culture medium containing the kanamycin antibiotic at the ratio of 1: 100, performing culture at 37 ℃ and 200 rpm until OD is achieved6000.5 to 0.7. IPTG was added to a final concentration of 1 mM mL-1Incubation was continued at 130 rpm for 4 hours at 16 ℃. Centrifuging at 10000 rpm for 10 min at 4 ℃, collecting thalli, and freezing at-20 ℃ for later use. Centrifuging 5 mL of bacterial solution, discarding supernatant, adding 800 μ L TBS for resuspension, ultrasonically crushing, sucking supernatant, adding 80 μ L TBS (20 mmol L) into crushed precipitate-1 Tris-HCl, 150 mmol L-1NaCl, pH 8.0) thoroughly resuspended. 20 mu L of the supernatant of the crushed bacteria liquid and 20 mu L of the 2-fold protein loading buffer solution are respectively added into the resuspended sediment, boiled at 100 ℃ for 10 min, slightly centrifuged, and the expression product is detected by SDS-PAGE.
3. Purification of recombinant protein rCgIRF-1
The soluble recombinant protein rCgIRF-1 is obtained by adopting a nickel sepharose FF column for purification, and the specific operation steps are as follows:
(1) packing the nickel sepharose FF into a column with the volume of 1.6 multiplied by 20cm and the volume of a column bed being 10 mL;
(2) equilibrating 2-5 bed volumes with buffer I, i.e., TBS, at a flow rate of 2 mL min-1；
(3) The cells expressed by IPTG induction are resuspended by buffer I, ultrasonically crushed for 30 minutes at 150 watts, centrifuged for 30 minutes at 12000 rpm at 4 ℃, the supernatant is filtered by a 0.45 mu m filter membrane and then filtered by a column with the flow rate of 1 mL min-1；
(4) Washing with buffer solution 1 for 2-5 bed volumes at a flow rate of 2 mL min-1；
(5) With a solution of 20 mmol L-1The imidazole buffer solution I is washed for 2-5 column bed volumes again, and the flow rate is 2 mL min-1；
(6) Using 300 mmol L-1Eluting the target protein by using the imidazole buffer solution I and collecting.
(7) Detecting the expression of the fusion protein by SDS-PAGE;
(8) washing with pure water for 5 bed volumes, washing with 20% ethanol for 3 bed volumes at flow rate of 2 mL min-1The column was stored at 4 ℃. The purified recombinant protein in the non-denatured state was dialyzed against TBS buffer and purified water 3 times to remove imidazole. Dialyzing at 4 deg.C for 12 hr each time to obtain Concha Ostreae interferon regulating factorCgIRF-1The amino acid sequence of the gene recombinant protein is shown in SEQ ID NO. 1.
Length: 329 amino acids
Type (2): amino acids
Chain type: single strand
The characteristics are as follows: the molecular weight is 38.383 kDa, the isoelectric point is 5.67, and the molecular weight has a conserved IRF domain, namely a DNA anchoring domain.
The invention discloses a crassostrea gigas interferon regulating factorCgIRF-1Electrophoresis of the induction and purification of the recombinant protein is shown in FIG. 1.
Lane M in fig. 1: protein marker; 1: the non-induced recombinant protein rCgIRF-1 bacterial liquid; 2: inducing recombinant protein rCgIRF-1 bacterial liquid, and then crushing and precipitating; 3: inducing recombinant protein rCgIRF-1 bacterial liquid and crushing supernatant; 4: and (3) purifying the recombinant protein rCgIRF-1.
Experimental example 1: the invention relates to a crassostrea gigas interferon regulating factorCgIRF-1In vitro binding activity detection of gene recombinant protein and ISRE
The method comprises the following specific steps:
(1) synthesis without Biotin labelling
ISRE（ISRE-WT (forward)：TGCAGGGAAACTGAAACTAAT；
ISRE-WT(reverse)：ATTAGTTTCAGTTTCCCTGCA），
Biotin-labeled ISRE (ISRE-bio (forward)):
biotin-TGCAGGGAAACTGAAACTAAT；
ISRE-Bio (reverse)：biotin-ATTAGTTTCAGTTTCCCTGCA）；
mutated ISRE without biotin labeling (ISRE-mu (forward)):
TGCAGGCAAACTCAAACTAAT；
ISRE-MU (reverse): ATTAGTTTGAGTTTGCCTGCA) oligonucleotide strands.
(2) The synthetic ISRE without the biotin labeling and the mutant ISRE without the biotin labeling are dissolved and diluted to 100 mu M by using an annealing buffer solution, and the ISRE with the biotin labeling is dissolved and diluted to 10 mu M and then an equal amount of forward and reverse strand probes are taken to anneal (95 ℃ for 5 min and slowly cooled to room temperature) to form a double strand.
(3) Setting 5 experimental groups as a negative control group (the amount of recombinant protein rCgIRF-1 is 0 mug), a positive control group (the amount of recombinant protein CgIRF-1 is 5 mug), a cold competition probe group (adding ISRE-WT competition probe with the final concentration of 20 mug and 5 mug recombinant protein CgIRF-1), a cold competition mutation probe group (adding ISRE-MU competition probe with the final concentration of 20 mug and 5 mug recombinant protein rCgIRF-1) and a super migration group (adding 2 mug CgIRF-1 antibody and 5 mug recombinant protein rCgIRF-1), and carrying out subsequent experiments according to the instruction of a chemiluminescence EMSA kit (Biyun biological technology, Ltd.) to verify the oyster interferon regulator of the inventionCgIRF-1Gene recombinant protein and ISRE binding activity in vitro.
The results of the experiment are shown in FIG. 2. The results show that: when the recombinant protein rCgIRF-1 is not added, no binding band appears; after adding recombinant protein rCgIRF-1, a binding band is formed; when the competition probe ISRE-WT was added, the binding band weakened, whereas when the critical binding site mutated ISRE-MU probe was added, the band did not change with the addition of the mutation probe, which indicates that the recombinant protein rCgIRF-1 is capable of binding to ISRE in vitro.
Experimental example 2: the invention relates to a crassostrea gigas interferon regulating factorCgIRF-1The gene recombinant protein facilitates the transcriptional activity analysis of CgIFNLP promoter region in HEK293T cells.
(1) Taking the gene coding region of the oyster interferon regulatory factor 1 (CgIRF-1) as a template, and adopting primers P3 and P4 for amplification for later use;
(2) and (3) carrying out enzyme digestion on the PCR product and pcDNA3.1(+) plasmid by using Kpn I and Xho I, connecting enzyme digestion fragments by using T4 ligase, transforming, sequencing and identifying the recombinant.
(3) Taking a 1000 bp upstream gene non-coding region of the crassostrea gigas interferon protein (CgIFNLP) as a template, and adopting primers P5 and P6 for amplification for later use;
(4) carrying out enzyme digestion on the PCR product and pGL3 basic by adopting Kpn I and Xho I, connecting enzyme digestion fragments by T4, transforming, sequencing and identifying a recombinant;
(5) extracting all plasmids including pGL3-control, pGL3-Lu, pcDNA3.1(+), pRL-TK, pcDNA3.1/CgIRF-1 and pGL3/CgIFNLP promoter with endotoxin removing plasmid;
(6) human kidney epithelial cells HEK293T were cultured in DMEM medium containing 10% (by volume) fetal bovine serum under the conditions of 37 ℃ and 5% CO2, and logarithmic phase cells were used for the test;
(7) the cells were treated at a ratio of 0.5X 105-2×105The density of each hole is inoculated on a 24-hole cell culture plate, 500 ul/hole is cultured in a 5% CO2 culture box for 24 hours, and after the cells adhere to the wall, respective culture media are replaced;
(8) is provided with threeEach group was a positive control group: co-transfecting pGL3-control + pRL-TK; blank control group: co-transfecting pGL3-Lu + pcDNA3.1(+) + pRL-TK and pGL3-Lu + pcDNA3.1/CgIRF-1 + pRL-TK respectively; experimental groups: pGL3/CgIFNLP promoter + pcDNA3.1(+) + pRL-TK and pGL3/CgIFNLP promoter + pcDNA3.1/rCgIRF-1 + pRL-TK, respectively, were co-transfected. Each group is provided with 6 multiple wells, the total amount of each plasmid in each well is 0.2 ng, and the total amount of the internal reference plasmid pRL-TK is 0.02 ng. When the degree of cell fusion reached 70% -90%, according to the group and according to LipofectamineTM3000 Reagent instructions for transfection experiments;
(8) culturing in 5% CO2 incubator for 48 hr, and detecting the relative fluorescence activity with double fluorescein reporter gene detection kit.
The results are shown in FIG. 3. pGL-control in FIG. 3: co-transfecting pGL-control + pRL-TK; blank: co-transfecting pGL3-Lu + pcDNA3.1(+) + pRL-TK and pGL3-Lu + pcDNA3.1/CgIRF-1 + pRL-TK respectively; pGL3/CgIFNLP promoter: co-transfecting pGL3/CgIFNLP promoter + pcDNA3.1(+) + pRL-TK and pGL3/CgIFNLP promoter + pcDNA3.1/CgIRF-1 + pRL-TK, respectively; wherein pRL-TK serves as an internal reference plasmid.
The results show that: in the positive control group, the relative fluorescence activity was higher by about 37.59. In the blank control group, when the blank reporter gene plasmid pGL3-Lu was transferred and the blank expression gene plasmid pcDNA3.1(+) and the recombinant expression gene plasmid pcDNA3.1/CgIRF-1 were transferred, the relative fluorescence activities were 0.26 and 0.21, respectively. In the experimental group, when the recombinant reporter gene plasmid is transferred and the blank expression gene plasmid pcDNA3.1(+) and the recombinant expression gene plasmid pcDNA3.1/CgIRF-1 are respectively transferred, the relative fluorescence activity is respectively 3.12 and 6.62, and the relative fluorescence activity is increased by 2.12 times after the pcDNA3.1/CgIRF-1 is transferred. Thus, CgIRF-1 was able to induce CgIFNLP gene expression in HEK291T cells.
Sequence listing
<110> university of Dalian ocean
<120> oyster interferon regulatory factor CgIRF-1 gene recombinant protein
<160>1
<170>SIP0SequenceListing 1.0
<210>1
<211>329
<212>PRT
<213> Crassostrea gigas (Crassostra gigas)
<400>1
Met Gly Ser Asp Lys Met Lys Arg Ser Asp Glu Lys Met Thr Lys Lys
Arg Pro Val Glu Arg Gln Lys Met Arg Pro Trp Leu Met Asp Met Leu
Lys Gln Gly Ala Thr Gln Gly Leu Glu Trp Phe Asp Glu Thr Gln Lys
Leu Phe Lys Ile Asn Trp Lys His Gly Ser Arg His Gly Phe Asn Thr
Met Lys Asp Ala Ser Leu Phe Glu Lys Tyr Ala Gln His Thr Gly Arg
Trp Asp Pro Asp Asp Pro Ser Pro Lys Arg Trp Lys Ala Asn Phe Arg
Cys Ala Leu Asn Ser Leu Gln Asn Val Met Glu Ile Lys Lys Leu Gly
Glu Ser Lys Gly Val His Ala Phe Arg Val Tyr Gln Phe Leu Glu Glu
Asp Asp Thr Lys Pro Lys Glu Gly Asn Ala Arg Lys Ser Asn Lys His
Lys Ser Asn Gln Lys Ser Thr Arg Lys Val Asn Ala Lys Phe Val Glu
Arg Glu Arg Glu Glu Ser Asp Lys Glu Asp Cys Pro Leu Asp Asp His
Glu Arg Glu Ile Pro Thr Ser Thr Ser Gly Glu Gly Glu Glu Val Ser
Glu Asn Pro Pro Gln Cys Thr Lys Pro Glu Ile Arg Val Phe Thr Phe
Pro Thr His Met Ala Gly Cys Val Val Arg Met Ala Pro Arg Lys Arg
Leu Ala Pro Tyr Glu Leu Glu Glu Glu Asp Lys Glu Asp Gln Val Glu
Met Thr Ser Gln Glu Thr Ile Gln His Ile Gln Tyr Thr Thr Lys Arg
Arg Arg Arg Asp Thr Asp Asp Glu Ser Met Met Ser Tyr Thr Gln Pro
Ser Ile Thr Thr Asp Glu Ser Ser Asn Asp Ser Asn Ser Ser Val Ser
Ser Ser Ser Val Glu Glu Glu Ile Pro Asn Thr Pro Tyr Phe Ser Ser
Leu Leu Thr Asn Ile Leu Asp Asp Asp Trp Thr Val Glu Lys Glu Glu
Thr Val Thr Thr Thr Gln Gln Tyr Val 329
Claims (1)
1. Ostrea gigas interferon regulating factorCgIRF-1The application of the gene recombinant protein in the preparation of the drug for inducing CgIFNLP gene expression is characterized in that: the Concha Ostreae interferon regulatory factorCgIRF-1The amino acid sequence of the gene recombinant protein is shown in SEQ ID NO. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711420022.3A CN107936107B (en) | 2017-12-25 | 2017-12-25 | Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711420022.3A CN107936107B (en) | 2017-12-25 | 2017-12-25 | Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107936107A CN107936107A (en) | 2018-04-20 |
| CN107936107B true CN107936107B (en) | 2021-05-11 |
Family
ID=61938914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711420022.3A Active CN107936107B (en) | 2017-12-25 | 2017-12-25 | Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107936107B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109705204A (en) * | 2019-01-25 | 2019-05-03 | 广东省生物资源应用研究所 | A kind of Penaeus Vannmei interferon regulatory factor and its encoding gene |
| CN114044816B (en) * | 2021-11-10 | 2023-06-16 | 大连海洋大学 | Recombinant crassostrea gigas Jiao Kongsu protein rCgGSDME-N, preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104086643A (en) * | 2014-06-25 | 2014-10-08 | 中国科学院海洋研究所 | Crassostrea gigas interferoid (CgIFN-like) gene recombinant protein, and preparation and application thereof |
-
2017
- 2017-12-25 CN CN201711420022.3A patent/CN107936107B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104086643A (en) * | 2014-06-25 | 2014-10-08 | 中国科学院海洋研究所 | Crassostrea gigas interferoid (CgIFN-like) gene recombinant protein, and preparation and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| A conserved interferon regulation factor 1 (IRF-1) from Pacific oyster Crassostrea gigas functioned as an activator of IFN pathway;Mengmeng Lu等;《Fish and Shellfish Immunology》;20180217;第68-77页 * |
| Genbank Database.PREDICTED: Crassostrea gigas interferon regulatory factor 1 (LOC1 05343805), mRNA.《Genbank Database》.2017,Accession：XM_011451289，version：XM_011451289.2. * |
| Identifi cation and functional analysis of a novel IFN-like protein (CgIFNLP) in Crassostrea gigas;Ran Zhang等;《Fish & Shellfish Immunology》;20150323;第547-554页 * |
| PREDICTED: Crassostrea gigas interferon regulatory factor 1 (LOC1 05343805), mRNA;Genbank Database;《Genbank Database》;20170202;CDS * |
| 干扰素调节因子的研究进展;沈金花 等;《中南民族大学学报（自然科学版）》;20140630;第41页左栏第1段-右栏第3段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107936107A (en) | 2018-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107936107B (en) | Ostrea gigas interferon regulatory factor CgIRF-1 gene recombinant protein, preparation method and application | |
| CN111856006B (en) | Application of mycoplasma bovis secretory protein MbovP274 | |
| CN110982822B (en) | Procambarus clarkii anti-lipopolysaccharide factor gALF1 gene, gALF1 protein coded by same and application thereof | |
| CN111763256A (en) | Cloning of chicken CR2 gene, expression and purification of protein and preparation of polyclonal antibody thereof | |
| KR101026526B1 (en) | Method for the secretory production of heterologous protein in Escherichia coli | |
| CN109369795B (en) | Protein for regulating and controlling macrophage immune function activity and application thereof | |
| CN110616227A (en) | Gene, recombinant expression vector, engineering strain and application of anti-freeze protein from tenebrio molitor | |
| CN107022549B (en) | Pelteobagrus fulvidraco beta defensin gene, beta defensin antibacterial peptide and application thereof | |
| CN108264548B (en) | Mandarin fish gamma interferon related factor, recombinant protein and application thereof | |
| CN110845594A (en) | Recombinant serum amyloid protein A capable of enhancing immune response of crassostrea gigas and preparation method thereof | |
| CN102180961A (en) | Black-blue spotted puffer fish interferon IFN gamma 2 and preparation method and application thereof | |
| RU2020113297A (en) | DNA vaccine against SARS-CoV-2 virus based on gene therapy DNA vector GDTT1.8NAS12, method of its production, strains carrying gene therapy DNA vectors, method of their production, method of industrial-scale production of gene therapy DNA vectors | |
| CN107936106B (en) | Oyster containing DM9 structural domain protein CgDM9CP-4, preparation method and application | |
| CN103397038B (en) | Production method of human interleukin-38 | |
| CN107253988B (en) | Preparation method of human programmed death factor ligand PD-L2 protein | |
| CN103509100B (en) | A kind of IL-1 R antagonist mutant | |
| CN114015696B (en) | Trachinotus ovatus interferon regulatory factor IRF6 gene, protein, preparation method and application | |
| CN102180962B (en) | Tetraodon nigroviridis interferon IFNgamma1 and preparation method and application thereof | |
| CN109517775B (en) | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product | |
| CN108840934B (en) | Recombinant sheep long-acting interferon tau, fusion protein for preparing long-acting interferon tau and preparation method of fusion protein | |
| CN109369794B (en) | Protein with function of regulating and controlling macrophage immune function activity | |
| CN108048475B (en) | Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria | |
| RU2441072C1 (en) | FUSION PROTEIN, ESCHERICHIA COLI STRAIN BEING FUSION PROTEIN PRODUCER AND METHOD FOR PRODUCING METHIONINE-FREE HUMAN INTERFERON ALPHA-2b OF SUCH FUSION PROTEIN | |
| CN107245105B (en) | HN-VP233-221aa fusion protein and preparation method and application thereof | |
| RU2453604C1 (en) | Hybrid protein (versions), bacterial strain escherichia coli - hybrid protein producer (versions) and method for producing methionine-free human interferon alpha-2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |