CN109517775B - Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product - Google Patents

Abstract

The invention relates to a preparation method and application of escherichia coli expression products of large yellow croaker IFNc gene, wherein large yellow croaker interferon c (IFNc gene) is cloned and then connected to an escherichia coli expression vector by means of molecular biology, and a recombinant expression product is obtained by transformation and induced expression, and the preparation method specifically comprises the following steps: cloning gene, constructing recombinant expression vector, transforming into colibacillus, inducing IPTG, purifying expression product and other steps. The obtained expression product can induce peripheral blood leukocyte of Pseudosciaena crocea to express antiviral protein genes such as Mx1, PKR and ISG 15.

Description

Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a preparation method and application of escherichia coli expression products of large yellow croaker IFNc genes.

Background

Interferons (IFNs) are a class of induced multigene family cytokines that induce an antiviral state in vertebrate cells and play an important role in antiviral defense (Robertsen B. The Interferon system of viral fish [ J. ]]Fish Shellfish Immunol, 2006, 20(2): 172-. Teleosts also possess a relatively sophisticated interferon system as lower vertebrates. Fish IFNs are divided into two major classes, type I and type II, with type I IFNs being of more interest because of their specific coordination of host antiviral immunity (Zhang YB, Gui JF. Molecular regulation of interferon antiviral response in fish J]Dev Comp Immunol, 2012, 38(2): 193-202.). Fish type I IFNs are classified into group I IFNs (mature peptide contains 2 conserved cysteines) and group II IFNs (mature peptide contains 4 conserved cysteines) according to the number and distribution of cysteines in the mature peptide. Group I IFN includes IFNa, IFNd, IFNe and IFNh 4 subgroups, Group II IFN includes IFNb, IFNc and IFNf 3 subgroups (Ding Y, Ao J, Huang X, Chen X. Identification of two subgroups of type I IFNs in laundry fibrous grate scraperLarimichthys croceaprovides novel insights into function and regulation of fish type I IFNs [J]. Front Immunol, 2016, 7:343.)。

Recent research results show that besides IFNd and IFNh (group I IFN), perciformes such as Artocarpus albiflora, mandarin fish, etc., there is a group II IFN, IFNc (Milne DJ, Camverde C, Andree KB, Chen X, Zou J, Secombes CJ, The discovery and comparative expression analysis of The same type I interferons in The same fish protein fish, megare (IFNh)Argyrosomus regius) [J]. Dev Comp Immunol, 2018, 84:123-132. Laghari ZA, Chen SN, Li L, Huang B, Gan Z, Zhou Y, Huo HJ, Hou J, Nie P. Functional, signalling and transcriptional differences of three distinct type I IFNs in a perciform fish, the mandarin fish Siniperca chuatsiDev Comp Immunol. 2018, 84: 94-108). IFNc is expressed constitutively in each tissue tested, and its expression level is up-regulated significantly after induced stimulation by virus or its analogue poly I: C. The American albiflora IFNc can induce The expression of self and interferon regulatory factors 3 and 7 and show The effect of obviously reducing The virus titer (Milne DJ, Camverde C, Andree KB, Chen X, Zou J, Secombes CJ, The discovery and comparative expression analysis of The same type I interferons in The same virus fish, megare (I)Argyrosomus regius) [J]. Dev Comp Immunol, 2018, 84:123-132.）。

Disclosure of Invention

One of the purposes of the invention is to provide an escherichia coli engineering bacterium capable of efficiently expressing large yellow croaker IFNc gene.

The second purpose of the invention is to provide an escherichia coli expression product of large yellow croaker IFNc gene and a preparation method thereof.

The invention also aims to provide application of the large yellow croaker IFNc recombinant protein.

In order to achieve the purpose, the invention adopts the following technical scheme:

escherichia coli engineering bacteria of large yellow croaker IFNc gene, wherein the engineering bacteria are Escherichia coli (E.coli)Escherichia coli) BL21/pET-43.1a-IFNc, which has been deposited in the China center for type culture Collection in 2018, 10 and 22 months, with the deposition number of CCTCC NO: m2018697; the China center for type culture Collection is addressed to the university of Wuhan, China.

A large yellow croaker IFNc gene colibacillus engineering bacterium recombines and expresses a gene with a nucleotide sequence shown as SEQ ID NO. 1.

The preparation method of the expression product of the large yellow croaker IFNc gene escherichia coli comprises the following steps:

(1) amplifying a large yellow croaker IFNc mature peptide gene fragment encoding amino acids from 28 th to 189 th by using a forward primer IFNc-F and a reverse primer IFNc-R by adopting a PCR (polymerase chain reaction) technology;

(2) cloning the mature peptide gene fragment of the large yellow croaker IFNc obtained in the step (1) to an escherichia coli expression vector pET-43.1a to obtain a recombinant expression vector pET-43.1a-IFNc containing the large yellow croaker IFNc gene fragment;

(3) transforming the recombinant expression vector pET-43.1a-IFNc into an escherichia coli BL21 strain, and obtaining escherichia coli BL21/pET-43.1a-IFNc engineering bacteria containing large yellow croaker IFNc gene fragments after ampicillin screening, sequencing and identification; meanwhile, the expression vector pET-43.1a transforms an escherichia coli BL21 strain, and the obtained escherichia coli BL21/pET-43.1a is used as a control strain;

(4) inducing Escherichia coli pET-43.1a-IFNc engineering bacteria in an LB culture medium by using IPTG (isopropyl-beta-thiogalactoside) with the final concentration of 0.1 mM, carrying out shaking culture at 16 ℃ for 12 hours, centrifuging a culture to collect bacteria, carrying out resuspension by using Buffer A, carrying out ultrasonic crushing, respectively collecting supernatant and precipitate of a bacteria lysate, and analyzing by polyacrylamide gel electrophoresis (SDS-PAGE) to show that the large yellow croaker IFNc recombinant protein is soluble expression;

(5) purifying the recombinant protein by using a nickel ion metal chelating affinity chromatography medium column: and (3) centrifugally collecting thalli in the culture of the engineering bacteria of the escherichia coli BL21/pET-43.1a-IFNc, washing the thalli by using an ice-precooled PBS solution for three times, then re-suspending the thalli by using Buffer A, placing the thalli in an ice-water mixture for carrying out ultrasonic crushing for 15 minutes, centrifugally collecting a supernatant, loading the supernatant to a column, and combining the supernatant with C at 4 ℃ for 30 minutes. And respectively using precooled Buffer B and Buffer C (washing a column, and finally eluting with Buffer D to obtain large yellow croaker IFNc recombinant protein, respectively performing 3-step dialysis on the purified large yellow croaker IFNc recombinant protein through Buffer 1, Buffer 2 and Buffer 3, and finally dialyzing into PBS Buffer solution with the pH value of 7.4.

The Buffer a included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v Triton X-100 and 30 mM imidazole, pH 7.4; the Buffer B included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v Triton X-100, 60 mM imidazole, pH 7.4; the Buffer C included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 60 mM imidazole, pH 7.4; the Buffer D included the following reagents at final concentrations: 20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.4; the Buffer 1 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 7.4; the Buffer 2 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 100 mM imidazole, pH 7.4; the Buffer 3 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, pH 7.4.

The invention has the advantages that:

the escherichia coli expression product of the large yellow croaker IFNc gene obtained by the invention is large yellow croaker IFNc recombinant protein with the molecular weight of about 73 kDa, and when the final concentration of the large yellow croaker IFNc recombinant protein is 10 ng/mL, the expression of the large yellow croaker IFNd and IFNh and the expression of the anti-virus genes Mx1, PKR and ISG15 are obviously up-regulated. In addition, the large yellow croaker IFNc recombinant protein can obviously inhibit the SGIV gene replication of the grouper iridovirus and inhibit the pathogenic effect of grouper spleen cells after SGIV infection, shows good antiviral effect, and has wide application value and market prospect for preventing and treating virus diseases of aquatic animals in China.

Drawings

FIG. 1 is an SDS-PAGE analysis of purified large yellow croaker IFNc recombinant protein, wherein lane M is a protein molecular weight standard; lane 1 is purified pseudosciaena crocea IFNc recombinant protein; the arrow indicates the large yellow croaker IFNc recombinant protein, lane 2 is the purified Nus recombinant protein; kD (kilodalton) stands for kilodalton

FIG. 2 shows the regulation effect of large yellow croaker IFNc recombinant protein on the expression of antiviral protein gene in large yellow croaker peripheral blood leukocytes; after the large yellow croaker IFNc recombinant protein of 10 ng/mL is used for treating the peripheral blood leukocytes of the large yellow croaker for 2, 4 and 8 hours, collecting the treated cells and detecting the gene expression levels of antiviral proteins Mx1, PKR and ISG15 by using Real-time PCR, wherein the control protein is Nus recombinant protein of 10 ng/mL; the relative expression level of the genes is standardized by using large yellow croaker beta-actin as an internal reference, and the fold change of the relative expression level of the genes in the large yellow croaker IFNc recombinant protein treatment group is the fold of the relative expression level of the genes in the Nus recombinant protein treatment group.

FIG. 3 shows the function of large yellow croaker IFNc in resistance to Epinephelus coitus virus in Epinephelus spleen cells; pretreating spleen cells of the grouper with 10 ng/mL of large yellow croaker IFNc recombinant protein for 2 hours, and then inoculating grouper iridovirus; 24 hours after infection, microscopic observation of the morphological changes of spleen cells of grouper; meanwhile, cell cultures were collected 12, 24 and 48 hours after infection, and the expression levels of the grouper iridovirus genes MCP, VP19, VP136 and ICP18 in grouper spleen cells were detected by Real-time PCR; the control protein is Nus recombinant protein with 10 ng/mL; the relative expression level of the genes is standardized by using the garrupa beta-actin as an internal reference, and the fold change of the relative expression level of the genes in the large yellow croaker IFNc recombinant protein treatment group is the fold of the relative expression level of the genes in the Nus recombinant protein treatment group. Each group of experiments was repeated three times, the asterisks represent that statistical analysis has significant differences,^* P < 0.05，^** P< 0.01。

Detailed Description

Example 1 acquisition of Pseudosciaena crocea IFNc Gene cDNA

The IFNc gene sequence of the large yellow croaker is predicted by using the IFNc sequences of other fishes and the large yellow croaker genome (JRPU00000000) after sequence alignment. Designing a primer according to the predicted large yellow croaker IFNc gene coding sequence, and carrying out polymerase chain reaction by using the primer to obtain the coding region sequence of the large yellow croaker IFNc gene. The sequence has a total length of 570 nucleotides and codes a protein consisting of 189 amino acids.

The cDNA sequence of the large yellow croaker IFNc gene is shown in SEQ ID NO. 1; wherein, the 1 st-27 th amino acids coded by the cDNA are predicted large yellow croaker IFNc signal peptide.

Example 2 obtaining of Pseudosciaena crocea IFNc Gene cDNA

1. Construction of recombinant expression vector BL21/pET-43.1a-IFNc containing large yellow croaker IFNc Gene

(1) PCR amplification of large yellow croaker IFNc mature peptide gene fragment: synthesis of forward primer IFNc-F with restriction endonuclease EcoR I site GGAATTCTGTCAGCTGGAAGGAGATC and reverse primer IF with Hind III siteNc-R: CCCAAGCTTTTAGTGGACACCTCTCC; PrimeStar from TAKARA was used^®The HS DNA Polymerase is used for PCR amplification according to the instruction, and the PCR system is as follows:

the PCR procedure was as follows:

and (3) carrying out 1.5% agarose gel electrophoresis on the PCR amplification product, wherein the electrophoresis conditions are as follows: voltage 120 v, time 15 min. A band of 570 nucleotides was observed by using a gel imager, and the PCR amplification product was recovered by using an Omega gel recovery kit, in accordance with the expectation.

(2) And (3) enzyme digestion reaction: the recovered PCR amplification product and the escherichia coli prokaryotic expression vector pET-43.1a are respectively subjected to double enzyme digestion of restriction endonucleases EcoR I and HindIII, and an enzyme digestion reaction system comprises the following steps:

enzyme cutting conditions are as follows: and reacting at 37 ℃ for 3 hours. The enzyme-cleaved products were recovered using an Omega gel recovery kit.

(3) And (3) connection reaction: the PCR amplification product after double digestion was ligated with pET-43.1a vector using T4 DNA ligase from TAKARA in the following manner:

reaction conditions are as follows: and reacting at 16 ℃ for 4 hours.

(4) Transformation of the ligation product into E.coli of InvitrogenE.coliTOP10 competent cells, colony PCR screened positive clones, expanded culture, and small plasmid using OmegaExtracting plasmid with the kit, and sequencing to verify to obtain the recombinant expression vector pET-43.1a-IFNc containing the large yellow croaker IFNc gene fragment.

2. Construction of Escherichia coli BL21/pET-43.1a-IFNc engineering bacterium

And (2) transforming the recombinant expression plasmid pET-43.1a-IFNc containing the large yellow croaker IFNc gene fragment into escherichia coli BL21 competent cells, coating the transformed bacterial liquid on an LB plate containing 100 mu g/mL ampicillin, and carrying out static culture at 37 ℃ for 16 hours to grow a single colony to obtain the escherichia coli BL21/pET-43.1a-IFNc engineering bacteria containing the large yellow croaker IFNc gene.

The formula of the culture medium is as follows:

LB liquid medium: 10 g/L peptone, 5 g/L yeast extract and 10 g/L sodium chloride.

LB plate: 10 g/L peptone, 5 g/L yeast extract, 10 g/L sodium chloride and 15 g/L agar powder.

Example 3 expression of Pseudosciaena crocea IFNc Gene in E.coli and purification of expression product thereof

1. Induced expression and SDS-PAGE analysis of large yellow croaker IFNc recombinant protein

And (3) selecting a single colony of the engineering bacteria BL21/pET-43.1a-IFNc constructed as above, inoculating the single colony to 5 mL LB liquid culture medium containing 100 mu g/mL ampicillin, and carrying out shaking culture at 37 ℃ and 180 r/min overnight. Inoculating the strain in 100 mL LB liquid culture medium containing 100 mug/mL ampicillin in the final concentration on the next day according to the volume ratio of 1:100, and carrying out shaking culture at 37 ℃ and 180 r/min. To-be-cultured object OD₆₀₀When the concentration is 0.4-0.5, IPTG with the final concentration of 0.1 mM is added to induce protein expression, the shaking culture is continued for 4 hours at 37 ℃, the culture is centrifuged, and the thalli are collected.

And (3) resuspending the collected thalli by using 10 mL of Buffer A, carrying out ultrasonic crushing for 10 minutes, centrifuging the lysate at 4 ℃ at 12000 rpm for 20 minutes, collecting the lysate supernatant, and carrying out precipitation by using 10 mL of Buffer A to resuspend the lysate. The thalli lysate, the thalli lysate supernatant and the thalli lysate precipitate are respectively taken by 50 mu L, and are added with equal volume of protein electrophoresis loading buffer solution, boiled in boiling water for 10 minutes, and then subjected to SDS-PAGE electrophoresis with the concentration of 15% (w/v). The result showed that a protein band of about 73 kDa appeared in the lysate of the control strain BL21/pET-43.1a, which is the recombinant protein Nus expressed by the empty vector pET-43.1 a. A protein band of about 100 kDa appears in the lysate of the engineering bacteria of Escherichia coli BL21/pET-43.1a-IFNc, which indicates that the recombinant protein of the large yellow croaker IFNc is expressed in Escherichia coli. Meanwhile, the large yellow croaker IFNc recombinant protein is mainly found in the supernatant of the thallus lysate, which indicates that the large yellow croaker IFNc recombinant protein is mainly soluble expressed in escherichia coli BL21/pET-43.1a-IFNc engineering bacteria. Based on the method, the large yellow croaker IFNc recombinant protein is purified by a soluble protein purification method.

Buffer A: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v Triton X-100 and 30 mM imidazole, pH7.4

2. Affinity chromatography method for purifying large yellow croaker IFNc recombinant protein

Purification of recombinant proteins was carried out with reference to the method recommended by Invitrogen Nickel ion Metal chelate affinity chromatography Medium (Ni-NTA): firstly, centrifuging for 10 minutes at 4 ℃ at 5000 rpm, collecting 100 mL of escherichia coli BL21/pET-43.1a-IFNc engineering bacteria after induction by IPTG, re-suspending the bacteria by l0m LBuffer A, ultrasonically crushing for 15 minutes, then centrifuging for l0 minutes at 4 ℃ at 12000 rpm, and collecting the supernatant of the bacteria lysate.

Loading l mL of nickel ion metal chelating affinity chromatography medium into a column, washing the column with double distilled water with 5 times of column volume, adding a Buffer A balance chromatography column with 5 times of column volume, and after liquid flows out completely, loading the supernatant collected in the step into the column and incubating for 30 minutes at 4 ℃. The column was washed with 10 mL of Buffer B and Buffer C, 5 times in this order, and unbound hetero-proteins were washed away. The target protein was eluted with 1mL Buffer C and collected repeatedly 5 times. Meanwhile, the Nus recombinant protein was purified by the same method.

Buffer B: 20 mM Tris-HCl, 150 mM NaCl, 0.5% Triton X-100 and 60 mM imidazole, pH 7.4.

Buffer C: 20 mM Tris-HCl, 150 mM NaCl and 60 mM imidazole, pH 7.4.

Buffer D: 20 mM Tris-HCl, 500 mM NaCl and 500 mM imidazole, pH 7.4.

3. Dialysis of large yellow croaker IFNc recombinant protein

The purified pseudosciaena crocea IFNc recombinant protein is dialyzed by Buffer 1, Buffer 2 and Buffer 3 for 3 steps respectively, and finally dialyzed into PBS (pH7.4), wherein each step is not less than 4 hours. After dialysis, the Nus recombinant protein was centrifuged at 4 ℃ at 12000 rpm for 30 minutes to remove the precipitate, and dialyzed by the same method. A small amount of the recombinant protein is taken for SDS-PAGE electrophoretic analysis, and the result shows that large yellow croaker IFNc recombinant protein and Nus recombinant protein (figure 1) with higher purity are obtained, and the rest is stored at-70 ℃ for later use.

Buffer 1: 20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 7.4.

Buffer 2: 20 mM Tris-HCl, 150 mM NaCl, 100 mM imidazole, pH 7.4.

Buffer 3：20 mM Tris-HCl、150 mM NaCl，pH 7.4。

Example 4 analysis of the antiviral protein-inducing Activity of recombinant protein IFNc in Large yellow croaker

(1) Mixing peripheral blood leukocyte of Pseudosciaena crocea at a ratio of 1 × 10⁶The cells were plated at a density of 2 mL per well in 6-well cell culture plates in Leibovitz's L15 medium (Gibico Co.) in a biochemical incubator at 25 ℃ overnight.

(2) Large yellow croaker IFNc recombinant protein was added to the cell culture medium to a final concentration of 10 ng/mL, and cell cultures were collected at 2, 4 and 8 hours after the treatment, respectively, and total cellular RNA was extracted using a microRNA extraction kit (SV total RNA Isolation System, Promega corporation), and reverse transcription PCR was performed according to the instructions of reverse transcriptase M-MLV (RNaseH-, Takara corporation). Meanwhile, cells treated with the Nus recombinant protein were set as a negative control group.

(3) The expression level of antiviral protein genes such as Mx1, PKR and ISG15 in the peripheral blood leukocytes of large yellow croakers is detected by Real-time fluorescent quantitative PCR (Real-time PCR). The Real-time PCR was carried out on a Mastercycler ep gradient multiplex 4 fluorescent quantitative PCR instrument (Eppendorf Co.) under the following conditions: performing pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5 s, annealing at 58 ℃ for 15 s, extension at 72 ℃ for 15 s and acquisition of fluorescence, 40 cycles. Beta-actin is used as an internal reference gene. The gene primers are shown in Table 1Shown in the figure. The experimental result adopts 2-^ΔΔCTThe method is used for analysis.

The results showed that the gene expression levels of the antiviral proteins Mx1, PKR and ISG15 of large yellow croaker were significantly up-regulated in the peripheral blood cells of large yellow croaker after the treatment of large yellow croaker IFNc recombinant protein and peaked 4 hours after induction, which were 17.3-fold, 5.4-fold and 7.5-fold, respectively, of the control group (fig. 2).

TABLE 1 real-time fluorescent quantitative PCR Gene primer Table

Example 5 antiviral Activity analysis of Large yellow croaker IFNc recombinant protein

(1) Spleen cells of grouper are cultured at a ratio of 1X 10⁶Cell density per well was seeded in 6-well cell culture plates, 2 mL of Leibovitz's L15 medium per well (Gibico Co.), and cultured in a 28 ℃ Biochemical incubator for 18 hours.

(2) Adding large yellow croaker IFNc recombinant protein into the cell culture medium until the final concentration is 10 ng/mL, and standing and incubating. After 2 hours, grouper iridovirus was inoculated at a multiplicity of infection of 2. The cytopathic effect of spleen cells of grouper was observed microscopically 24 hours after infection. Nus recombinant protein treated cells were set as negative control.

(3) Meanwhile, cell cultures were collected at 12, 24 and 48 hours after infection, and total cellular RNA was extracted using a micro RNA extraction kit (SV total RNA Isolation System, Promega corporation), and reverse transcription PCR was performed according to the instructions of reverse transcriptase M-MLV (RNaseH-, Takara). Nus recombinant protein treated cells were set as negative control.

(4) The expression levels of the grouper iridovirus genes MCP, VP19, VP136, and ICP18 in grouper spleen cells were detected by Real-time fluorescent quantitative PCR (Real-time PCR). The Real-time PCR was carried out on a Mastercycler ep gradient multiplex 4 fluorescent quantitative PCR instrument (Eppendorf Co.) under the following conditions: performing pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5 s, annealing at 58 ℃ for 15 s, and extension at 72 ℃ for 15 sFluorescence was acquired for 40 cycles. The grouper beta-actin is used as an internal reference gene. The fold change is the fold of the relative expression level of the gene in the large yellow croaker IFNc recombinant protein treatment group relative to the relative expression level of the gene in the Nus recombinant protein treatment group. Each group of experiments was repeated three times, the asterisks represent that statistical analysis has significant differences,^* P < 0.05，^** P<0.01. the gene primers are shown in Table 2. The experimental result adopts 2-^ΔΔCTThe method is used for analysis.

TABLE 2 real-time fluorescent quantitative PCR gene primer table

Microscopic observation results show that the large yellow croaker IFNc recombinant protein can protect spleen cells of grouper inoculated with grouper iridovirus. Most cells in the control group expressed as Nus recombinant protein had shrunk and rounded and appeared with obvious cell plaques. The cell morphology of the large yellow croaker IFNc recombinant protein group is relatively complete, and no obvious plaque is generated (FIG. 3A). Real-time PCR results showed that the gene expression levels of grouper iridovirus genes MCP, VP19, VP136, and ICP18 were significantly inhibited in grouper spleen cells after large yellow croaker IFNc recombinant protein treatment (FIG. 3B). The large yellow croaker IFNc recombinant protein has obvious antiviral function.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian agriculture and forestry university

<120> preparation method and application of escherichia coli expression product of pseudosciaena crocea IFNc gene

<130> 21

<160> 21

<170> PatentIn version 3.3

<210> 1

<211> 570

<212> DNA

<213> Artificial sequence

<400> 1

atgacacttc agtcctcttc agtcctcctt gtcctcttgc agttctacag cctcaagctg 60

atggtggctg ccatgccgac ctgtcagctg gaaggagatc tggtccagtc ggcccaccac 120

ctgctcagag acctgggggc agattttcct gaacactgcc tgccgtacaa cgccaacatc 180

tcctttccaa gctctgcctt ccctgctgcc acagccaatc atcctcagtg ccacaaatca 240

ttatgggtgg tgcatgagtc cctgcgggag gcggggctag tattccagga caatgacata 300

cctgtcggag agggcggagt cacctggaac gaccagaaac tcgaagactt ccagaacttg 360

cagtaccgac tggtggagga agggagctgt ctgtccagtg tcaatggttc aggtgttttg 420

tcgtcttact tcagtaacgt gacggcagtt cttcaagagc aggacagtgc tgcctgtggc 480

tggatggctc tgaggagaga tctgctctgg gtcttaaagt ctgccctgca gaaacaccgc 540

acctgcttta cctggagagg tgtccactaa 570

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence

<400> 2

ggaattctgt cagctggaag gagatc 26

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence

<400> 3

cccaagcttt tagtggacac ctctcc 26

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

tgttgcacta gggcagaaga g 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<400> 5

gaagcaggga gttcagcttc t 21

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

gcacagaaga taggctcggt 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

tgtctgacga actggtgtgg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

tgctggatgg aaagacccac 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

atcagcagag agacccgaga 20

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence

<400> 10

gacctgacag actacctcat g 21

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

ctccttcctg acctctccgt 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

gcacgcttct ctcaccttca 20

<210> 13

<211> 19

<212> DNA

<213> Artificial sequence

<400> 13

aacggcaacg ggagcacta 19

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

cttgatgacg gaagcgtggt 20

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence

<400> 15

tgtcagagga cttggagaag gag 23

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence

<400> 16

gatgctgccg tgtgaactg 19

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

gcacatcctt ggtggtgttg 20

<210> 18

<211> 19

<212> DNA

<213> Artificial sequence

<400> 18

atcggatcta cgtggttgg 19

<210> 19

<211> 19

<212> DNA

<213> Artificial sequence

<400> 19

ccgtcgtcgg tgtctattc 19

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

tacgagctgc ctgacggaca 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

ggctgtgatc tccttctgca 20

Claims (3)

1. An engineering bacterium of colibacillus for expressing IFNc gene of large yellow croaker, which is characterized in that the engineering bacterium is colibacillus (Escherichia coli)Escherichia coli) BL21/pET-43.1a-IFNc, which has been deposited in the China center for type culture Collection in 2018, 10 and 22 months, with the deposition number of CCTCC NO: m2018697.

2. An expression product of the large yellow croaker IFNc gene E.coli according to claim 1, which is prepared by the method comprising the steps of:

(1) amplifying a large yellow croaker IFNc mature peptide gene fragment encoding amino acids from 28 th to 189 th by using a forward primer IFNc-F and a reverse primer IFNc-R by adopting a PCR (polymerase chain reaction) technology;

(2) cloning the mature peptide gene fragment of the large yellow croaker IFNc obtained in the step (1) to an escherichia coli expression vector pET-43.1a to obtain a recombinant expression vector pET-43.1a-IFNc containing the large yellow croaker IFNc gene fragment;

(3) transforming the recombinant expression vector pET-43.1a-IFNc into an escherichia coli BL21 strain, and obtaining escherichia coli BL21/pET-43.1a-IFNc engineering bacteria containing large yellow croaker IFNc gene fragments after ampicillin screening, sequencing and identification; meanwhile, the expression vector pET-43.1a transforms an escherichia coli BL21 strain, and the obtained escherichia coli BL21/pET-43.1a is used as a control strain;

(4) inducing Escherichia coli pET-43.1a-IFNc engineering bacteria in an LB culture medium by using IPTG (isopropyl-beta-thiogalactoside) with the final concentration of 0.1 mM, carrying out shaking culture at 16 ℃ for 12 hours, centrifuging a culture to collect bacteria, carrying out resuspension by using Buffer A, carrying out ultrasonic crushing, respectively collecting supernatant and precipitate of a bacteria lysate, and analyzing by polyacrylamide gel electrophoresis (SDS-PAGE) to show that the large yellow croaker IFNc recombinant protein is soluble expression;

(5) purifying the recombinant protein by using a nickel ion metal chelating affinity chromatography medium column: centrifugally collecting thalli in an escherichia coli BL21/pET-43.1a-IFNc engineering bacteria culture, washing the thalli with ice-precooled PBS solution for three times, then re-suspending the thalli with Buffer A, placing the thalli in an ice-water mixture for ultrasonic crushing for 15 minutes, centrifugally collecting supernatant, loading the supernatant into a column, and combining 4 ℃ for 30 minutes;

washing the column with precooled Buffer B and Buffer C respectively, and finally eluting with Buffer D to obtain large yellow croaker IFNc recombinant protein, wherein the purified large yellow croaker IFNc recombinant protein is dialyzed for 3 steps through Buffer 1, Buffer 2 and Buffer 3 respectively, and finally dialyzed into PBS Buffer solution with pH 7.4;

the nucleotide sequence of the large yellow croaker IFNc mature peptide gene fragment encoding amino acids from position 28 to position 189 in the step (1) is from position 82 to position 567 of SEQ ID NO. 1;

the Buffer a included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v Triton X-100 and 30 mM imidazole, pH 7.4; the Buffer B included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 0.5% v/v Triton X-100, 60 mM imidazole, pH 7.4; the Buffer C included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 60 mM imidazole, pH 7.4; the Buffer D included the following reagents at final concentrations: 20 mM Tris-HCl, 500 mM NaCl, 500 mM imidazole, pH 7.4; the Buffer 1 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 7.4; the Buffer 2 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, 100 mM imidazole, pH 7.4; the Buffer 3 included the following reagents at final concentrations: 20 mM Tris-HCl, 150 mM NaCl, pH 7.4.

3. Use of an expression product of E.coli of the large yellow croaker IFNc gene of claim 2 for inhibiting the iridovirus of grouper.

Images