CN102964443B - Construction and production methods of recombinant vector of recombinant chicken gamma interferon - Google Patents
Construction and production methods of recombinant vector of recombinant chicken gamma interferon Download PDFInfo
- Publication number
- CN102964443B CN102964443B CN201210536591.5A CN201210536591A CN102964443B CN 102964443 B CN102964443 B CN 102964443B CN 201210536591 A CN201210536591 A CN 201210536591A CN 102964443 B CN102964443 B CN 102964443B
- Authority
- CN
- China
- Prior art keywords
- recombinant
- gamma interferon
- construction
- chicken gamma
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to techniques of gene clone, recombinant vector construction, recombinant plasmid expression and purification and the like in the technical field of genetic engineering, and particularly relates to construction and production methods of recombinant vector of recombinant chicken gamma interferon. The construction method mainly comprises the following steps of: acquiring target genes containing complete open reading frames of the chicken gamma interferon or segments desired to be improved by an RT-PCR (reverse transcription-polymerase chain reaction) technique, constructing expression vectors containing the target genes, and meanwhile, constructing the processes of inducible expression and separation and purification of target proteins. According to the construction and production methods of the recombinant vector of the recombinant chicken gamma interferon, the chicken gamma interferon is enabled to be efficiently expressed in escherichia coli, a fast, high-efficient, safe and low-cost production manner is provided for the production of the chicken gamma interferon, and the construction and production methods of the recombinant vector of the recombinant chicken gamma interferon are suitable for large-scale production. The recombinant chicken gamma interferon produced according to the invention can be widely applied to immunological enhancement of poultries and prevention and cure of plague.
Description
Technical field
The present invention relates to the technology, the particularly construction of recombinant vector of recombination chicken gamma Interferon, rabbit and production method thereof such as gene clone, construction of recombinant vector, expression of recombinant plasmid and purifying in gene engineering technology field.
Background technology
In recent years, people mainly adopt the method for vaccine inoculation targetedly to prevent to the viral blight of animal, but along with the inoculation of viral variation and traditional dosage vaccine, cause the incidence of animal mild viral blight more and more high.The virus diseases such as the recent bird flu breaking out, infectious bronchitis, infectious bursal disease, atypical newcastle disease are brought huge financial loss to poultry cultivation, become the most serious class disease of harm poultry cultivation industry, this has also brought new challenge also to the viral animal epidemic of control.
Interferon, rabbit (Interferon) be a class produced by virus induction body have viral interference infect and non-infected tissue in the small molecule albumen that copies.Interferon, rabbit is divided into I type and the large class of II type two, and wherein the Main Function of I type Interferon, rabbit (IFN α and IFN β) is that viral interference is copied in vivo, protects non-infected tissue to avoid viral invasion ability.II type Interferon, rabbit (IFN γ) not only can suppress copying of virus, and has very strong immunoregulation capability, can activating B cell, strengthen the immune protective efficiency of antibody; Stimulate the relevant cytokine of T cells produce, regulate the immune process of body; Phagocytic activity and the chemotactic ability of induction scavenger cell.Its protection to body and viral prevention effect is all better than to I type Interferon, rabbit.
Summary of the invention
The object of the invention is to: utilize gene recombination technology to realize the vivoexpression of chicken IFN-γ, and pass through improvement goal gene fragment, production technique etc., to adapt to the scale operation of chicken IFN-γ, and significantly improve product performance.
Recombination chicken gamma Interferon, rabbit goal gene provided by the present invention obtains by following steps:
Collect the chicken Whole blood lymphocyte through ConA inducing culture, carry out the extraction of total RNA by the working method of Trizol Reagent specification sheets.Utilize Superscript II reverse transcriptase (Invitrogen) test kit to carry out the synthetic cDNA of reverse transcription to the total RNA extracting.
Chicken IFN-γ, cDNA sequence is:
1 CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1 L N L V Q L Q D D I D K L K A D F N S S
61 CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21 H S D V A D G G P I I V E K L K N W T E
121 AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41 R N E K R I I L S Q I V S M Y L E M L E
181 AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61 N T D K S K P H I K H I S E E L Y T L K
241 AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81N N L P D G V K K V K D I M D L A K P P
301 ATGAACGACTTGAGAATCCAGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101 M N D L R I Q R K A A N E L F S I L Q K
361 CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121 L V D P P S F K R K R S Q S Q R R C N C
Above sequence is nucleotide sequence and the aminoacid sequence of chicken IFN-γ, wherein the the the the 1st, 3,5,7,9,11,13 behavior nucleotide sequences, the the the the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
According to chicken IFN-gamma gene sequences, application Primer Premier5.0 software design primer, make object fragment originate in front 6 bases of initiator codon ATG of chicken IFN-γ cDNA gene, end at the terminator codon TAA of chicken IFN-γ gene, a complete open reading frame that comprises chicken IFN-γ gene.
The production method of recombination chicken gamma Interferon, rabbit provided by the present invention is that 16 DEG C, the object fragment after purifying and pMD18-T carrier is connected to 30min, then transforms bacillus coli DH 5 alpha competent cell, to obtain cloning vector.
The present invention cuts qualification to the screening of positive colony carrier by PCR and EcoR I and Sal I enzyme and realizes.Concrete operations are: the recombinant plasmid dna that takes a morsel carries out PCR qualification, and carry out enzyme with EcoR I and Sal I and cut qualification (single endonuclease digestion band: 3193bp, double digestion band: 541bp, 2652bp).
Positive recombinant plasmid send by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and carries out sequencing.Measurement result and known array are compared with analysis software DNAStar, and by positive plasmid called after pMD18-IFN-γ.
The structure of positive expression carrier of the present invention is realized by following steps:
With EcoR I and the positive recombinant plasmid pMD18-IFN-of Sal I double digestion γ, goal gene is cut, gel reclaims for subsequent use.By EcoR I and Sal I double digestion for prokaryotic expression carrier pET-32a (+), pET-32a (+) gel after enzyme is cut reclaims for subsequent use equally.PET-32a (+) plasmid of the IFN-γ fragment of recovery and enzyme being cut to rear recovery uses T4 ligase enzyme to be connected, and 16 DEG C of connections are spent the night.And the carrier building is converted into E.coli BL21 competent cell, coat LB solid medium (containing 30 μ g/mL kantlex), 37 DEG C of overnight incubation.Ordinary method is extracted recombinant plasmid, carries out enzyme and cuts qualification and PCR qualification (single endonuclease digestion band: 6428bp, double digestion band: 541bp, 5887bp), positive recombinant plasmid called after pET32a-IFN-γ, i.e. engineering strain.
The abduction delivering that is expressed as of the present invention, uses IPTG, 42 DEG C of induction 6h.
The application carries out partial sequence sudden change to obtain the chicken IFN-γ fragment of improvement to above-mentioned chicken IFN-γ simultaneously, and the concrete 105-107 amino acids by original acid sequence sports DNL by RIQ, as follows through the chicken IFN-γ sequence of improvement:
1 CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1 L N L V Q L Q D D I D K L K A D F N S S
61 CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21 H S D V A D G G P I I V E K L K N W T E
121 AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41 R N E K R I I L S Q I V S M Y L E M L E
181 AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61 N T D K S K P H I K H I S E E L Y T L K
241 AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81 N N L P D G V K K V K D I M D L A K P P
301 ATGAACGACTTGGACAACCTGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101 M N D L D N L R K A A N E L F S I L Q K
361 CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121 L V D P P S F K R K R S Q S Q R R C N C
Above sequence is nucleotide sequence and the aminoacid sequence of chicken IFN-γ, wherein the the the the 1st, 3,5,7,9,11,13 behavior nucleotide sequences, the the the the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
And by synthesizing above-mentioned sequence according to the engineering bacteria of the chicken IFN-γ improveing described in above-mentioned similar approach construction expression.
Embodiment
Construction of recombinant vector and the production method thereof of 1 one kinds of recombination chicken gamma Interferon, rabbit of embodiment
1 collects the chicken Whole blood lymphocyte through ConA inducing culture, carries out the extraction of total RNA by the working method of Trizol Reagent specification sheets.
2 utilize Superscript II reverse transcriptase (Invitrogen) test kit to carry out the synthetic cDNA of reverse transcription to the total RNA extracting, and concrete operations are as follows.
RT reaction system: 5 × RT buffer, 4 μ l; DNTPs, 2 μ l; RNase lnbibitor, 1 μ l; Oligo (dT) 20,1 μ l; RNA liquid, 11 μ l; Rever TraAce, 1 μ l; Amount to: 20 μ l.
RT reaction conditions: 30 DEG C, 10min; 42 DEG C, 20min; 99 DEG C, 5min; 4 DEG C, 5min.
3 according to chicken IFN-gamma gene sequences, application Primer Premier5.0 software design primer:
F:5’---AAGAAGATGACT TGG CAGAC---3’
R:5’---TTAGCAATT GCATCT CCT TTGA---3’
Object fragment is 501bp altogether, originates in front 6 bases of initiator codon ATG of chicken IFN-γ cDNA gene, ends at the terminator codon TAA of chicken IFN-γ gene, a complete open reading frame that has comprised chicken IFN-γ gene.Primer is synthetic by Shanghai Sheng Gong bio-engineering corporation.
4 taking the synthetic cDNA of reverse transcription as template, carries out pcr amplification reaction.
Reaction system: TaKaRa Taq HS (5U/ μ l), 0.125 μ l; 10 × PCR Buffer (Mg
2+plus), 2.5 μ l; DNTP Mixture (each 2.5mM), 2 μ l; Forward Primer (20 μ M), 1.25 μ l; ReversePrimer (20 μ M), 1.25 μ l; ddH
2o, 16 μ l; CDNA template, 2 μ l; Amount to 25 μ l.
Reaction conditions: 95 DEG C, 2min; 95 DEG C, 30sec, 61 DEG C, 30sec, 72 DEG C, 30sec, 30cyc; 72 DEG C, 10min
Detect product with agarose gel electrophoresis.Reclaim test kit specification sheets according to DNA PCR product is carried out to purifying recovery.The rear gained DNA of recovery puts-20 DEG C and saves backup.
16 DEG C, the object fragment after purifying and pMD18-T carrier is connected 30min by 5, then transforms bacillus coli DH 5 alpha competent cell.The recombinant plasmid dna that takes a morsel carries out PCR qualification, and carries out enzyme with EcoR I and Sal I and cut qualification (single endonuclease digestion band: 3193bp, double digestion band: 541bp, 2652bp).
Enzyme tangent condition and system: plasmid DNA, 0.15 μ g; 10 × Buffer, 2 μ l; Restriction enzyme EcoR I, 1 μ l; Restriction enzyme Sal I, 1 μ l; Add water to 20 μ l, hatch 3h for 37 DEG C.
6 serve Hai Shenggong biotechnology Services Co., Ltd and carry out sequencing being accredited as positive recombinant plasmid.Measurement result and known array are compared with analysis software DNAStar, positive plasmid called after pMD18-IFN-γ.
The positive recombinant plasmid pMD18-IFN-of 7 use EcoR I and SalI double digestion γ, cuts goal gene, and gel reclaims for subsequent use.By EcoR I and Sal I double digestion for prokaryotic expression carrier pET-32a (+), pET-32a (+) gel after enzyme is cut reclaims for subsequent use equally.PET-32a (+) plasmid of the IFN-γ fragment of recovery and enzyme being cut to rear recovery uses T4 ligase enzyme to be connected, and 16 DEG C of connections are spent the night.And the carrier building is converted into E.coli BL21 competent cell, coat LB solid medium (containing 30 μ g/mL kantlex), 37 DEG C of overnight incubation.Ordinary method is extracted recombinant plasmid, carries out enzyme and cuts qualification and PCR qualification (single endonuclease digestion band: 6428bp, double digestion band: 541bp, 5887bp), positive recombinant plasmid called after pET32a-IFN-γ, i.e. engineering strain.
The expression of 8 recombinant plasmids in intestinal bacteria got positive strain and is inoculated in the fresh LB substratum containing penbritin, and 37 DEG C of vibrations are cultivated, and work as OD
600when value reaches 1 left and right, collect part thalline, another part adds IPTG, and to make its final concentration be 0.6mmol/L, centrifugal after 42 DEG C of induction 6h, collects thalline.Get without thalline and the rear thalline of induction of induction and carry out SDS-PAGE electrophoresis detection.
The purifying of 9 expression products
It is 50mmol/L TrisCl damping fluid that the bacterial sediment of results is dissolved in 250mL concentration by the extraction of 9.1 cells inclusionses, adds 0.025g N,O-Diacetylmuramidase and 25mL 1%Triton-X-100, and 30 DEG C of temperature are bathed 15min; Then ice-bath ultrasonic break process, 4 DEG C, the centrifugal 10min of 12000r/min; Collecting precipitation, with 2mol/L urea washing 1 time, at 4 DEG C, the centrifugal 10min of 12000 r/min; Collecting precipitation, respectively wash 1 time with 1mol/LNaCl, 0.5%Triton-X-100, make inclusion body preliminary purification, collecting precipitation.
The purifying of 9.2 inclusion bodys adds 30mL TNMFX damping fluid (20mmol/L TrisCl, 150mmol/LNaCl, 1mmol/L EDTA and 0.1%Triton-100 that pH value is 8.0) in throw out, supersound process 30s (5 times, interval 1min); Add 30mL TNMFX damping fluid to 250mL, 4 DEG C, the centrifugal 10min of 12000r/min; Collecting precipitation, carries out 2~3 times with redistilled water washing precipitation; 4 DEG C, the centrifugal 15min of 15000r/min, collecting precipitation.
Sex change liquid for the sex change of 9.3 inclusion bodys [8mol/L urea, 20mmol/L TrisCl (pH value is 8.0), 2mmol/L beta-mercaptoethanol] dissolution precipitation, until solution becomes limpid transparent, shows that inclusion body is dissolved completely.
The purifying of 9.4 metaproteins utilizes affinity chromatography to install on pillar with the mixture of the well-bound metaprotein of Ni post and column material, by 10mL buffer A, [(pH value is 8.5 to 20mmol/L TrisCl, 4 DEG C), 10mmol/LKCl, 5mmol/L beta-mercaptoethanol, 10% glycerine, 10mmol/L imidazoles] balance pillar, maintenance flow velocity is 0.5mL/min.[(pH value is 8.5 to 20mmol/L TrisCl to use respectively 2mL buffer B, 4 DEG C), 1mol/LKCl, 5mmol/L beta-mercaptoethanol, 10% glycerine] and 2mL buffer A wash-out pillar, then (pH value is 8.5 to use 0.5mL damping fluid C[20mmol/L TrisCl, 4 DEG C), 100mmol/L KCl, 5mmol/L beta-mercaptoethanol, 10% glycerine, 10mmol/L imidazoles) wash-out 4 times continuously, collect the target protein that merges this washing liq and be purifying.
The dialysis renaturation of 9.5 albumen is by renaturation solution [20mmol/L TrisCl (pH value is 8.0), 2mmol/L EDTA, 50 μ mol/L CuCl
2, 1mmol/L GSH, 0.1mmol/L GSSG, 1mol/L urea] add in the metaprotein of purifying, making metaprotein final concentration is 100 μ g/mL, and makes urea concentration in renaturation solution remain on 1mol/L, after bleeding under 4 DEG C of conditions continuously stirring 20h; Under condition of ice bath, constantly stir 20min, during this period, constantly add (NH
4)
2sO
4protein precipitation, makes (NH
4)
2sO
4final concentration is 55%, then continues to stir 40min, fully protein precipitation; In 4 DEG C, the centrifugal 1h of 12000r/min; Collecting precipitation, then use the heavy molten precipitation of 50mmol/L TrisCl (pH value is 8.0), 0.5mmol/L EDTA, in 4 DEG C, the centrifugal 15min of 13000r/min; Collect supernatant liquor, with 50mmol/L TrisCl (pH value is 8.0) dialysis 48h, every 6h changes liquid 1 time, obtains recombinant protein.
Embodiment 2 is through construction of recombinant vector and the production method thereof of the chicken IFN-γ of improvement
Synthesize the chicken IFN-γ sequence after improvement, and use the engineering bacteria of the chicken IFN-γ of carrier identical in embodiment, restriction enzyme site and the improvement of Host Strains construction expression, and use method identical in embodiment to carry out expression and purification.
The comparison of the chicken IFN-γ sequence before and after embodiment 3 improvement
Experiment 1 is by after improveing object fragment, and it obviously improves at colibacillary expression amount, comparative test result (all adopting 20L fermentation system, the term harmonizations such as temperature, dissolved oxygen amount) as shown in table 1 below
The impact of table 1 chicken IFN-γ on performance in layers and safety
Result shows, improves rear fragment expression amount and obviously promotes, and anti-VSV virus titer does not change substantially.
The safety experiment of product before product and improvement after experiment 2 improvement
The impact of table 2 chicken IFN-γ on performance in layers and safety
Result shows, uses this product there is no toxic side effect impact to chicken.
Before the experiment rear product of 3 improvement and improvement, product is on the lymphopoietic impact of broiler chicken
1 group is control group, and 2 groups is product before improvement, and 3 groups is product after improvement, 4 groups of products that are other market sales.Result shows, the 3rd group of tested chicken 14d, 21d lymphocyte transformation rate after the Interferon, rabbit of injecting after improvement are significantly higher than control group (P < 0.05), and 28d is significantly higher than all the other each group (P < 0.05).In table 3.
The impact of table 3 chicken IFN-γ on broiler chicken lymphopoiesis SI
Note: respectively organize numerical value and all use
represent.The colleague upper right corner indicates different lowercase alphabets and shows significant difference (P < 0.05), has an identical lowercase alphabet differential different not remarkable (P > 0.05), as follows.
Claims (6)
1. recombination chicken gamma Interferon, rabbit, is characterized in that its aminoacid sequence is as shown in SEQ ID NO:5.
2. the nucleotide sequence of recombination chicken gamma Interferon, rabbit described in coding claim 1.
3. nucleotide sequence as claimed in claim 2, its sequence is as shown in SEQ ID NO:6.
4. comprise the recombinant vectors of the nucleotide sequence of claim 2 or 3.
5. comprise the Host Strains of recombinant vectors described in claim 4.
6. the purposes of the nucleotide sequence shown in the recombination chicken gamma Interferon, rabbit described in right 1 or claim 2-3 any one in the preparation of preparation raising immunity of layer chicken.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210536591.5A CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210536591.5A CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102964443A CN102964443A (en) | 2013-03-13 |
CN102964443B true CN102964443B (en) | 2014-10-08 |
Family
ID=47794900
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210536591.5A Expired - Fee Related CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102964443B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106892976A (en) * | 2017-02-14 | 2017-06-27 | 华南农业大学 | A kind of recombination chicken interferon lambda(rChIFN‑λ)Clonal expression of gene and its preparation method and application |
CN109776669A (en) * | 2018-12-29 | 2019-05-21 | 广州动物园 | Brave interferon and its expressing gene, preparation method and application |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1752210A (en) * | 2005-07-22 | 2006-03-29 | 蔡中华 | Chicken interferon gamma, preparing process and use thereof |
CN101221176A (en) * | 2007-01-12 | 2008-07-16 | 天津瑞普生物技术集团有限公司 | Expression of chicken interferon-gamma in regrouped bacilliform virus and its measurement of antivirus activity |
CN101209345B (en) * | 2006-12-26 | 2012-02-01 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method thereof |
-
2012
- 2012-12-13 CN CN201210536591.5A patent/CN102964443B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1752210A (en) * | 2005-07-22 | 2006-03-29 | 蔡中华 | Chicken interferon gamma, preparing process and use thereof |
CN101209345B (en) * | 2006-12-26 | 2012-02-01 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method thereof |
CN101221176A (en) * | 2007-01-12 | 2008-07-16 | 天津瑞普生物技术集团有限公司 | Expression of chicken interferon-gamma in regrouped bacilliform virus and its measurement of antivirus activity |
Also Published As
Publication number | Publication date |
---|---|
CN102964443A (en) | 2013-03-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Bishop et al. | The complete sequence and coding content of snowshoe hare bunyavirus small (S) viral RNA species | |
Wang et al. | A single ssRNA segment encoding RdRp is sufficient for replication, infection, and transmission of ourmia-like virus in fungi | |
CN106674354A (en) | Fusion protein of chicken interferon IFN-lambda and IFN-alpha | |
CN102964443B (en) | Construction and production methods of recombinant vector of recombinant chicken gamma interferon | |
CN113429465A (en) | Phellinus linteus MADS-box transcription factor PbMADS1 and coding gene and application thereof | |
Jacob et al. | 3′-Terminal sequence analysis of the RNA genome of the Indian isolate of Cardamom mosaic virus: a new member of genus Macluravirus of Potyviridae | |
CN113136372A (en) | Construction method of recombinant phage | |
US20230303651A1 (en) | Method for preparing a porcine-derived interferon-delta 5 and application of porcine-derived interferon-delta 5 | |
CN102993278B (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
CN106906234A (en) | One can prokaryotic expression WYMV Huangchuan separator NIb albumen plasmid vector | |
CN108079287B (en) | Subunit vaccine of grouper iridovirus as well as preparation method and application thereof | |
CN108558994B (en) | Portunus trituberculatus C1q receptor PtgC1qR gene and encoding protein and application thereof | |
CN103215274B (en) | Epinephelus coioide interferon IFNgamma 2 and its preparation method and application | |
CN100379863C (en) | Method of preparing natural human thymosin a1 using series expression mode | |
CN103613668B (en) | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof | |
CN101434965A (en) | Construction method of soluble expression vector pBPE172-alpha 2b of recombinant human interferon alpha 2b gene | |
CN113121672B (en) | Soluble prokaryotic expression and purification method of cat interferon gamma and application | |
CN109517775B (en) | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product | |
CN102277335B (en) | Chinese Baoding isolate of sugarcane mosaic virus and complete sequence of genome thereof | |
CN108273053A (en) | A kind of recombinant envelope protein vaccine of grouper irido virus and its application | |
CN102675445A (en) | Ubiquitin-like modified protein, preparation and application thereof | |
CN103243106B (en) | Epinephelus coioides interferon IFNgamma1 and preparation method and application thereof | |
CN109750021A (en) | A kind of scallop carotenoid oxicracking enzyme gene and its application | |
CN116004640B (en) | Gene, protein and plasmid of trachinotus ovatus B cell lymphoma-2 and application thereof | |
CN110684788B (en) | Goldfish c-type lysozyme subtype and coding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20171213 |
|
CF01 | Termination of patent right due to non-payment of annual fee |