CN102964443A - Construction and production methods of recombinant vector of recombinant chicken gamma interferon - Google Patents
Construction and production methods of recombinant vector of recombinant chicken gamma interferon Download PDFInfo
- Publication number
- CN102964443A CN102964443A CN2012105365915A CN201210536591A CN102964443A CN 102964443 A CN102964443 A CN 102964443A CN 2012105365915 A CN2012105365915 A CN 2012105365915A CN 201210536591 A CN201210536591 A CN 201210536591A CN 102964443 A CN102964443 A CN 102964443A
- Authority
- CN
- China
- Prior art keywords
- recombinant
- gamma interferon
- chicken
- construction
- chicken gamma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to techniques of gene clone, recombinant vector construction, recombinant plasmid expression and purification and the like in the technical field of genetic engineering, and particularly relates to construction and production methods of recombinant vector of recombinant chicken gamma interferon. The construction method mainly comprises the following steps of: acquiring target genes containing complete open reading frames of the chicken gamma interferon or segments desired to be improved by an RT-PCR (reverse transcription-polymerase chain reaction) technique, constructing expression vectors containing the target genes, and meanwhile, constructing the processes of inducible expression and separation and purification of target proteins. According to the construction and production methods of the recombinant vector of the recombinant chicken gamma interferon, the chicken gamma interferon is enabled to be efficiently expressed in escherichia coli, a fast, high-efficient, safe and low-cost production manner is provided for the production of the chicken gamma interferon, and the construction and production methods of the recombinant vector of the recombinant chicken gamma interferon are suitable for large-scale production. The recombinant chicken gamma interferon produced according to the invention can be widely applied to immunological enhancement of poultries and prevention and cure of plague.
Description
Technical field
The present invention relates to the technology, the particularly construction of recombinant vector of recombination chicken gamma Interferon, rabbit and production method thereof such as gene clone, construction of recombinant vector, expression of recombinant plasmid and purifying in the gene engineering technology field.
Background technology
In recent years, people mainly adopt the method for targetedly vaccine inoculation to prevent to the viral blight of animal, but along with the variation of virus and the inoculation of traditional dosage vaccine, cause the incidence of animal mild viral blight more and more high.Recently the virus diseases such as the bird flu of outburst, infectious bronchitis, infectious bursal disease, atypical newcastle disease are brought huge financial loss to poultry cultivation, become the most serious class disease of harm poultry cultivation industry, this has also brought new challenge also for the viral animal epidemic of control.
Interferon, rabbit (Interferon) is that a class is by the small molecule albumen that viral interference is copied in infection and non-infected tissue that has of virus induction body generation.Interferon, rabbit is divided into I type and II type two large classes, and wherein the Main Function of I type Interferon, rabbit (IFN α and IFN β) is that viral interference is copied in vivo, protects non-infected tissue to avoid viral invasion ability.II type Interferon, rabbit (IFN γ) not only can suppress copying of virus, and has very strong immunoregulation capability, can activating B cell, strengthen the immune protective efficiency of antibody; Stimulate the relevant cytokine of T cells produce, the immune process of regulating body; Induce phagocytic activity and the chemotactic ability of scavenger cell.It all is better than I type Interferon, rabbit to the protection of body with to the prevention effect of virus.
Summary of the invention
The object of the invention is to: utilize gene recombination technology to realize the vivoexpression of chicken IFN-γ, and by improvement goal gene fragment, production technique etc. adapting to the scale operation of chicken IFN-γ, and significantly improve product performance.
Recombination chicken gamma Interferon, rabbit goal gene provided by the present invention obtains by following steps:
Collection is carried out the extraction of total RNA through the chicken Whole blood lymphocyte of ConA inducing culture by the working method of Trizol Reagent specification sheets.Utilize Superscript II reverse transcriptase (Invitrogen) test kit that the total RNA that extracts is carried out the synthetic cDNA of reverse transcription.
The chicken IFN-γ, the cDNA sequence is:
1 CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1 L N L V Q L Q D D I D K L K A D F N S S
61 CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21 H S D V A D G G P I I V E K L K N W T E
121 AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41 R N E K R I I L S Q I V S M Y L E M L E
181 AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61 N T D K S K P H I K H I S E E L Y T L K
241 AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81N N L P D G V K K V K D I M D L A K P P
301 ATGAACGACTTGAGAATCCAGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101 M N D L R I Q R K A A N E L F S I L Q K
361 CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121 L V D P P S F K R K R S Q S Q R R C N C
Above sequence is nucleotide sequence and the aminoacid sequence of chicken IFN-γ, the 1st, 3,5,7,9,11,13 behavior nucleotide sequences wherein, the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
According to chicken IFN-gamma gene sequences, use Primer Premier5.0 software design primer, make the purpose fragment originate in front 6 bases of initiator codon ATG of chicken IFN-γ cDNA gene, end at the terminator codon TAA of chicken IFN-γ gene, comprise a complete open reading frame of chicken IFN-γ gene.
The production method of recombination chicken gamma Interferon, rabbit provided by the present invention is that 16 ℃ in the purpose fragment behind the purifying and pMD18-T carrier is connected 30min, then transforms the bacillus coli DH 5 alpha competent cell, to obtain cloning vector.
The present invention cuts by PCR and EcoR I and Sal I enzyme the screening of positive colony carrier and identifies and realize.Concrete operations are: the recombinant plasmid dna that takes a morsel carries out PCR to be identified, and carries out enzyme with EcoR I and Sal I and cut evaluation (single endonuclease digestion band: 3193bp, double digestion band: 541bp, 2652bp).
Positive recombinant plasmid send by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd and carries out sequencing.With analysis software DNAStar measurement result and known array are compared, and with positive plasmid called after pMD18-IFN-γ.
Positive expression Vector construction of the present invention is realized by following steps:
With EcoR I and the positive recombinant plasmid pMD18-IFN-of Sal I double digestion γ, goal gene is downcut, gel reclaims for subsequent use.Equally with prokaryotic expression carrier pET-32a (+) with EcoR I and Sal I double digestion, pET-32a (+) gel after enzyme cut reclaims for subsequent use.Use the T4 ligase enzyme to be connected with pET-32a (+) plasmid that enzyme is cut rear recovery the IFN-γ fragment that reclaims, 16 ℃ of connections are spent the night.And the carrier that builds is converted into E.coli BL21 competent cell, coat LB solid medium (containing 30 μ g/mL kantlex), 37 ℃ of overnight incubation.Ordinary method is extracted recombinant plasmid, carries out enzyme and cuts evaluation and PCR evaluation (single endonuclease digestion band: 6428bp, double digestion band: 541bp, 5887bp), positive recombinant plasmid called after pET32a-IFN-γ, i.e. engineering strain.
The abduction delivering that is expressed as of the present invention namely uses IPTG, induces 6h for 42 ℃.
The application carries out partial sequence to above-mentioned chicken IFN-γ simultaneously and suddenlys change the chicken IFN-γ fragment that obtains improveing, and the concrete 105-107 amino acids with the original acid sequence sports DNL by RIQ, and is as follows through the chicken IFN-γ sequence of improvement:
1 CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1 L N L V Q L Q D D I D K L K A D F N S S
61 CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21 H S D V A D G G P I I V E K L K N W T E
121 AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41 R N E K R I I L S Q I V S M Y L E M L E
181 AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61 N T D K S K P H I K H I S E E L Y T L K
241 AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81 N N L P D G V K K V K D I M D L A K P P
301 ATGAACGACTTGGACAACCTGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101 M N D L D N L R K A A N E L F S I L Q K
361 CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121 L V D P P S F K R K R S Q S Q R R C N C
Above sequence is nucleotide sequence and the aminoacid sequence of chicken IFN-γ, the 1st, 3,5,7,9,11,13 behavior nucleotide sequences wherein, the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
And by the engineering bacteria of synthetic above-mentioned sequence according to the chicken IFN-γ of the described improvement of above-mentioned similar approach construction expression.
Embodiment
Construction of recombinant vector and the production method thereof of 1 one kinds of recombination chicken gamma Interferon, rabbit of embodiment
1 collects the chicken Whole blood lymphocyte through the ConA inducing culture, carries out the extraction of total RNA by the working method of Trizol Reagent specification sheets.
2 utilize Superscript II reverse transcriptase (Invitrogen) test kit that the total RNA that extracts is carried out the synthetic cDNA of reverse transcription, and concrete operations are as follows.
RT reaction system: 5 * RT buffer, 4 μ l; DNTPs, 2 μ l; RNase lnbibitor, 1 μ l; Oligo (dT) 20,1 μ l; RNA liquid, 11 μ l; Rever TraAce, 1 μ l; Amount to: 20 μ l.
The RT reaction conditions: 30 ℃, 10min; 42 ℃, 20min; 99 ℃, 5min; 4 ℃, 5min.
3 according to chicken IFN-gamma gene sequences, uses Primer Premier5.0 software design primer:
F：5’---AAGAAGATGACT TGG CAGAC---3’
R：5’---TTAGCAATT GCATCT CCT TTGA---3’
The purpose fragment is 501bp altogether, originates in front 6 bases of initiator codon ATG of chicken IFN-γ cDNA gene, ends at the terminator codon TAA of chicken IFN-γ gene, has comprised a complete open reading frame of chicken IFN-γ gene.Primer is given birth to worker bio-engineering corporation by Shanghai and is synthesized.
4 take the synthetic cDNA of reverse transcription as template, carries out pcr amplification reaction.
Reaction system: TaKaRa Taq HS (5U/ μ l), 0.125 μ l; 10 * PCR Buffer (Mg
2+Plus), 2.5 μ l; DNTP Mixture (each 2.5mM), 2 μ l; Forward Primer (20 μ M), 1.25 μ l; ReversePrimer (20 μ M), 1.25 μ l; DdH
2O, 16 μ l; The cDNA template, 2 μ l; Amount to 25 μ l.
Reaction conditions: 95 ℃, 2min; 95 ℃, 30sec, 61 ℃, 30sec, 72 ℃, 30sec, 30cyc; 72 ℃, 10min
Detect product with agarose gel electrophoresis.Reclaim the test kit specification sheets according to DNA the PCR product is carried out the purifying recovery.The rear gained DNA of recovery puts-20 ℃ and saves backup.
5 are connected 30min with 16 ℃ in the purpose fragment behind the purifying and pMD18-T carrier, then transform the bacillus coli DH 5 alpha competent cell.The recombinant plasmid dna that takes a morsel carries out PCR to be identified, and carries out enzyme with EcoR I and Sal I and cut evaluation (single endonuclease digestion band: 3193bp, double digestion band: 541bp, 2652bp).
Enzyme tangent condition and system: plasmid DNA, 0.15 μ g; 10 * Buffer, 2 μ l; Restriction enzyme EcoR I, 1 μ l; Restriction enzyme Sal I, 1 μ l; Add water to 20 μ l, hatch 3h for 37 ℃.
6 recombinant plasmids that will be accredited as the positive are served sea living worker's biotechnology Services Co., Ltd and are carried out sequencing.Measurement result and known array are compared positive plasmid called after pMD18-IFN-γ with analysis software DNAStar.
The positive recombinant plasmid pMD18-IFN-of 7 usefulness EcoR I and SalI double digestion γ downcuts goal gene, and gel reclaims for subsequent use.Equally with prokaryotic expression carrier pET-32a (+) with EcoR I and Sal I double digestion, pET-32a (+) gel after enzyme cut reclaims for subsequent use.Use the T4 ligase enzyme to be connected with pET-32a (+) plasmid that enzyme is cut rear recovery the IFN-γ fragment that reclaims, 16 ℃ of connections are spent the night.And the carrier that builds is converted into E.coli BL21 competent cell, coat LB solid medium (containing 30 μ g/mL kantlex), 37 ℃ of overnight incubation.Ordinary method is extracted recombinant plasmid, carries out enzyme and cuts evaluation and PCR evaluation (single endonuclease digestion band: 6428bp, double digestion band: 541bp, 5887bp), positive recombinant plasmid called after pET32a-IFN-γ, i.e. engineering strain.
8 recombinant plasmid Expression in Escherichia colis are got positive strain and are inoculated in the fresh LB substratum that contains penbritin, and 37 ℃ of vibrations are cultivated, and work as OD
600When value reaches 1 left and right sides, collect the part thalline, another part adds IPTG, and to make its final concentration be 0.6mmol/L, induces behind the 6h centrifugally for 42 ℃, collects thalline.Get without the thalline of inducing and induce rear thalline to carry out the SDS-PAGE electrophoresis detection.
The purifying of 9 expression products
9.1 it is 50mmol/L TrisCl damping fluid that the extraction of cells inclusions is dissolved in 250mL concentration with the bacterial sediment of gathering in the crops, and adds 0.025g N,O-Diacetylmuramidase and 25mL 1%Triton-X-100,30 ℃ of temperature are bathed 15min; Then ice-bath ultrasonic break process, 4 ℃, the centrifugal 10min of 12000r/min; Collecting precipitation is with 2mol/L urea washing 1 time, at 4 ℃, the centrifugal 10min of 12000 r/min; Collecting precipitation respectively washs 1 time with 1mol/LNaCl, 0.5%Triton-X-100 again, makes the inclusion body preliminary purification, collecting precipitation.
9.2 the purifying of inclusion body adds 30mL TNMFX damping fluid (the pH value is 8.0 20mmol/L TrisCl, 150mmol/LNaCl, 1mmol/L EDTA and 0.1%Triton-100), supersound process 30s (5 times, interval 1min) in throw out; Add 30mL TNMFX damping fluid to 250mL, 4 ℃, the centrifugal 10min of 12000r/min; Collecting precipitation carries out 2～3 times with the redistilled water washing precipitation; 4 ℃, the centrifugal 15min of 15000r/min, collecting precipitation.
9.3 the sex change of inclusion body is with sex change liquid [8mol/L urea, 20mmol/L TrisCl (the pH value is 8.0), 2mmol/L beta-mercaptoethanol] dissolution precipitation, until solution becomes get limpid transparent till, show that inclusion body is dissolved fully.
9.4 the purifying of metaprotein utilizes affinity chromatography to install on the pillar with the mixture of the well-bound metaprotein of Ni post and column material, [(the pH value is 8.5 to 20mmol/L TrisCl with the 10mL buffer A, 4 ℃), 10mmol/LKCl, 5mmol/L beta-mercaptoethanol, 10% glycerine, 10mmol/L imidazoles] the balance pillar, the maintenance flow velocity is 0.5mL/min.[(the pH value is 8.5 to 20mmol/L TrisCl to use respectively the 2mL buffer B, 4 ℃), 1mol/LKCl, 5mmol/L beta-mercaptoethanol, 10% glycerine] and 2mL buffer A wash-out pillar, then (the pH value is 8.5 to use 0.5mL damping fluid C[20mmol/L TrisCl, 4 ℃), 100mmol/L KCl, 5mmol/L beta-mercaptoethanol, 10% glycerine, 10mmol/L imidazoles) continuous wash-out 4 times, collect and merge the target protein that this washing liq is purifying.
9.5 the dialysis renaturation of albumen is with renaturation solution [20mmol/L TrisCl (the pH value is 8.0), 2mmol/L EDTA, 50 μ mol/L CuCl
2, 1mmol/L GSH, 0.1mmol/L GSSG, 1mol/L urea] add in the metaprotein of purifying, making the metaprotein final concentration is 100 μ g/mL, and makes that urea concentration remains on 1mol/L in the renaturation solution, after bleeding under 4 ℃ of conditions continuously stirring 20h; Under condition of ice bath, constantly stir 20min, during this period, constantly add (NH
4)
2SO
4Protein precipitation makes (NH
4)
2SO
4Final concentration is 55%, continues to stir 40min, fully protein precipitation again; In 4 ℃, the centrifugal 1h of 12000r/min; Collecting precipitation is used the heavy molten precipitation of 50mmol/L TrisCl (the pH value is 8.0), 0.5mmol/L EDTA, again in 4 ℃, the centrifugal 15min of 13000r/min; Collect supernatant liquor, with 50mmol/L TrisCl (the pH value is 8.0) dialysis 48h, every 6h changes liquid 1 time, obtains recombinant protein.
Embodiment 2 is through construction of recombinant vector and the production method thereof of the chicken IFN-γ of improvement
Chicken IFN-γ sequence after the synthetic improvement, and the engineering bacteria of the chicken IFN-γ that identical carrier, restriction enzyme site and Host Strains construction expression improved among the use embodiment, and identical method is carried out expression and purification among the use embodiment.
The comparison of the chicken IFN-γ sequence before and after embodiment 3 improvement
Experiment 1 is by after improveing the purpose fragment, and it obviously improves at colibacillary expression amount, comparative test result (all adopting the 20L fermentation system, the term harmonizations such as temperature, dissolved oxygen amount) as shown in table 1 below
Table 1 chicken IFN-γ is on the impact of performance in layers and safety
The result shows that the fragment expression amount obviously promotes after the improvement, and anti-VSV virus titer does not have to change substantially.
The safety experiment of product before product and the improvement after experiment 2 improvement
Table 2 chicken IFN-γ is on the impact of performance in layers and safety
The result shows, uses this product that chicken is not had the toxic side effect impact.
Product is on the lymphopoietic impact of broiler chicken before the rear product of experiment 3 improvement and the improvement
1 group is control group, and 2 groups are product before the improvement, and 3 groups are product after the improvement, and 4 groups is the product of other market sales.The result shows that the 3rd group of tested chicken 14d, 21d lymphocyte transformation rate behind the Interferon, rabbit after the injection improvement are significantly higher than control group (P＜0.05), and 28d is significantly higher than all the other each groups (P＜0.05).See Table 3.
Table 3 chicken IFN-γ is on the impact of broiler chicken lymphopoiesis SI
Annotate: each is organized numerical value and all uses
Expression.The colleague upper right corner indicates different lowercase alphabet differentials different significantly (P＜0.05), and an identical lowercase alphabet differential different not remarkable (P＞0.05) is arranged, and is as follows.
Claims (8)
1. the recombination chicken gamma Interferon, rabbit is characterized in that its aminoacid sequence is shown in SEQ ID NO:3 or 5.
2. the nucleotide sequence of coding claim 1 described recombination chicken gamma Interferon, rabbit.
3. nucleotide sequence as claimed in claim 2, its sequence has the sequence shown in SEQ ID NO:4 or 6.
4. the recombinant vectors that comprises the nucleotide sequence of claim 2 or 3.
5. the Host Strains that comprises the described recombinant vectors of claim 4.
6. express the construction process of the engineering bacteria of claim 1 described chicken IFN-γ, it is characterized in that collecting the chicken Whole blood lymphocyte through the ConA inducing culture, extract total RNA, and the purpose fragment that therefrom increases, be connected with the pMD18-T carrier behind the purpose fragment purification that amplification is obtained, the conversion bacillus coli DH 5 alpha carries out PCR and EcoR I and Sal I enzyme is cut evaluation; The single endonuclease digestion band is 3193bp, and the double digestion band is 541bp and 2652bp, then is accredited as positive plasmid, called after pMD18-IFN-γ; And positive plasmid checked order; Then use EcoR I and Sal I double digestion pMD18-IFN-γ, reclaim the purpose fragment, this fragment is 541bp, contains the partial sequence of restriction enzyme site and pMD18-T carrier; And with EcoR I and Sal I double digestion prokaryotic expression carrier pET-32a (+), reclaim the pET-32a (+) after enzyme is cut; PET-32a (+) after cutting the purpose fragment of rear recovery and enzyme and cut with T4 ligase enzyme ligase enzyme obtains recombinant vectors; With the carrier Transformed E .coli BL21 competent cell that builds; Extracting according to a conventional method recombinant plasmid, carry out PCR and enzyme and cut evaluation, is 6428bp such as the single endonuclease digestion band, and the double digestion band is 541bp and 5887bp, then is accredited as positive recombinant plasmid, called after pET32a-IFN-γ, the engineering bacteria that namely makes up.
7. expression method claimed in claim 6, the phase is characterised in that the primer that amplification purpose fragment uses is as follows:
F：5’---AAGAAGATGACT TGG CAGAC---3’
R：5’---TTAGCAATT GCATCT CCT TTGA---3’。
8. right 1 described recombination chicken gamma Interferon, rabbit or the claim 2-3 nucleotide sequence shown in each improves purposes in the preparation of immunity of layer chicken in preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210536591.5A CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210536591.5A CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102964443A true CN102964443A (en) | 2013-03-13 |
| CN102964443B CN102964443B (en) | 2014-10-08 |
Family
ID=47794900
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210536591.5A Expired - Fee Related CN102964443B (en) | 2012-12-13 | 2012-12-13 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102964443B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106892976A (en) * | 2017-02-14 | 2017-06-27 | 华南农业大学 | A kind of recombination chicken interferon lambda（rChIFN‑λ）Clonal expression of gene and its preparation method and application |
| CN109776669A (en) * | 2018-12-29 | 2019-05-21 | 广州动物园 | Brave interferon and its expressing gene, preparation method and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1752210A (en) * | 2005-07-22 | 2006-03-29 | 蔡中华 | Chicken interferon gamma, preparing process and use thereof |
| CN101221176A (en) * | 2007-01-12 | 2008-07-16 | 天津瑞普生物技术集团有限公司 | Expression of chicken interferon-gamma in regrouped bacilliform virus and its measurement of antivirus activity |
| CN101209345B (en) * | 2006-12-26 | 2012-02-01 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method thereof |
-
2012
- 2012-12-13 CN CN201210536591.5A patent/CN102964443B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1752210A (en) * | 2005-07-22 | 2006-03-29 | 蔡中华 | Chicken interferon gamma, preparing process and use thereof |
| CN101209345B (en) * | 2006-12-26 | 2012-02-01 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method thereof |
| CN101221176A (en) * | 2007-01-12 | 2008-07-16 | 天津瑞普生物技术集团有限公司 | Expression of chicken interferon-gamma in regrouped bacilliform virus and its measurement of antivirus activity |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106892976A (en) * | 2017-02-14 | 2017-06-27 | 华南农业大学 | A kind of recombination chicken interferon lambda（rChIFN‑λ）Clonal expression of gene and its preparation method and application |
| CN109776669A (en) * | 2018-12-29 | 2019-05-21 | 广州动物园 | Brave interferon and its expressing gene, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102964443B (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106674354A (en) | Fusion protein of chicken interferon IFN-lambda and IFN-alpha | |
| CN102964443B (en) | Construction and production methods of recombinant vector of recombinant chicken gamma interferon | |
| CN102286490B (en) | Preparation and renaturation method of chicken interferon gamma | |
| CN105647945A (en) | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof | |
| Jacob et al. | 3′-Terminal sequence analysis of the RNA genome of the Indian isolate of Cardamom mosaic virus: a new member of genus Macluravirus of Potyviridae | |
| CN105039191A (en) | Surface display method and application of trehalose synthase and trehalose-hydrolysing | |
| US20230303651A1 (en) | Method for preparing a porcine-derived interferon-delta 5 and application of porcine-derived interferon-delta 5 | |
| CN107266587A (en) | A kind of recombinant bovine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN106906234A (en) | One can prokaryotic expression WYMV Huangchuan separator NIb albumen plasmid vector | |
| CN1611604A (en) | Swine alpha-interferon gene synthesis, expression vector establishment and product preparing method | |
| CN102993278A (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN108079287B (en) | Subunit vaccine of grouper iridovirus as well as preparation method and application thereof | |
| CN101434965A (en) | Construction method of soluble expression vector pBPE172-alpha 2b of recombinant human interferon alpha 2b gene | |
| CN112402598A (en) | General subunit vaccine for riemerella anatipestifer infection | |
| CN103613668B (en) | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof | |
| CN113121672B (en) | Soluble prokaryotic expression and purification method of cat interferon gamma and application | |
| CN100379863C (en) | Method of preparing natural human thymosin a1 using series expression mode | |
| CN108273053A (en) | A kind of recombinant envelope protein vaccine of grouper irido virus and its application | |
| CN103215274A (en) | Epinephelus coioides interferon IFNgamma2 and preparation method and application thereof | |
| CN109517775B (en) | Preparation method and application of large yellow croaker IFNc gene escherichia coli expression product | |
| CN109385436B (en) | Scylla paramamosain C-type lysozyme gene and application thereof | |
| CN103509099B (en) | Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof | |
| CN103243106B (en) | Epinephelus coioides interferon IFNgamma1 and preparation method and application thereof | |
| CN102180962A (en) | Tetraodon nigroviridis interferon IFNgamma1 and preparation method and application thereof | |
| CN107253997A (en) | A kind of recombinant bovine long-acting interferon and prepare fusion protein of this long-acting interferon and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20171213 |