CN1752210A - Chicken interferon gamma, preparing process and use thereof - Google Patents
Chicken interferon gamma, preparing process and use thereof Download PDFInfo
- Publication number
- CN1752210A CN1752210A CN 200510012701 CN200510012701A CN1752210A CN 1752210 A CN1752210 A CN 1752210A CN 200510012701 CN200510012701 CN 200510012701 CN 200510012701 A CN200510012701 A CN 200510012701A CN 1752210 A CN1752210 A CN 1752210A
- Authority
- CN
- China
- Prior art keywords
- reaction
- chicken interferon
- interferon gamma
- primer
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
A chicken interferon gamma used for preparing medicines, immunopctentiator, feed additive, etc is prepared through configuiring the recombinant carrier of the recombinant chicken interferon, screening, and separating and purifying the expression product. Its advantages are high purity and low cost.
Description
Technical field
The present invention relates to technology, particularly chicken interferon gamma and its production and use such as the clone of functional gene in the gene engineering technology field, recombinant expressed and purifying.
Background technology
At present, bird is cultured had become the largest industrial sector that China's livestock industry is cultured already, breeding way from traditional extensive operation to high-density, intensive culture high speed development.But follow the high speed development of breed expensive, intensification, the disease problem inevitably becomes the first bottleneck of restriction livestock and poultry industry fast development and impassable obstacle.According to incompletely statistics, the mortality ratio that China every year causes because of all kinds of poultry dieases is up to 15-20%, and financial loss reaches billions of units.Simultaneously, after the China joined WTO, market also turns to mass type from scalar type gradually to the demand of animal products, specification of quality to animal products has reached unprecedented degree, because of bird disease, drug residue and the bird food that do not meet hygienic standard not only influence the foreign exchange earning of China's bird aquaculture industry development, product, even threatened the healthy of people.Recently the bird flu of outburst, atypical newcastle disease and other relevant disease almost make bird culture and suffer extinction.
To bird culture harm maximum be transmissible disease, especially virus disease accounts for 70% of disease total amount.Prevention and treatment approach to the bird transmissible disease are mainly vaccine and microbiotic.But, because breeding environment is abominable, the cause of disease variation, degradation reason under the residual and Abwehrkraft des Koepers of medicine makes traditional immunity and prevention approach be subjected to huge challenge.Most of antibiotics and traditional oral chemical drug, because the drug residue problem, to the negative impact that HUMAN HEALTH is brought, the danger that has faced comprehensive drug withdrawal and be about to step down from the stage of history; And traditional vaccine, because its high specific can't keep out the variation of cause of disease and the appearance of novel disease to bring new impact for the bird aquaculture, bird is cultured and is about to face isolated awkward situation.
Interferon, rabbit (Interferon) is that a class is produced by the virus induction body, has the small molecule albumen that viral interference is duplicated in infection and non-infected tissue.Interferon, rabbit is divided into I type and II type Interferon, rabbit two big classes, and wherein the viral interference that mainly act as of I type Interferon, rabbit (IFN α and IFN β) is duplicated in vivo, protects non-infected tissue to avoid the ability that virus is invaded and harassed.II type Interferon, rabbit is called interferon-gamma (IFN γ) again, and it suppresses to have more very strong immunoregulation capability the self-replacation of virus except that can be used for, and comprises activating B cell, strengthens the immune protective efficiency of antibody; Stimulate the T cell to produce relevant cytokine, regulate the immune process of body; Induce engulfing and the chemotactic ability of scavenger cell; Promote phagocytic cell to take off particle, induce the respiratory metabolism outburst and repair multiple function such as damage that it obviously is better than I type Interferon, rabbit to the immunoprotection of body with to the prevention effect of virus disease.
But Interferon, rabbit is the same with other cytokine, and expression amount in vivo is low, concentration in vivo about 10
-12Mol/L; Transformation period is short, and about 6h peaks the promptly remarkable decline of concentration behind the 24h through virus infection or inducing after.Therefore, adopt biochemical isolating method, the Interferon, rabbit cost that is directly obtained by cell or body is extremely expensive, has greatly limited its exploitation and application clinically.
Summary of the invention
The objective of the invention is to: adopt gene recombination technology, the chicken interferon gamma gene is cloned, the gene that obtains is recombinated and expressed external, the IFN γ that realizes chicken is in external batch process and purifying preparation, to overcome the shortcoming of Interferon, rabbit production cost costliness in the prior art, make full use of the reorganization chicken interferon gamma and be the industry service.
General idea of the present invention is:
The cDNA sequence of chicken interferon gamma is:
1?CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1?L N L V Q L Q D D I D K L K A D F N S S
61?CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21?H S D V A D G G P I I V E K L K N W T E
121?AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41?R N E K R I I L S Q I V S M Y L E M L E
181?AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61?N T D K S K P H I K H I S E E L Y T L K
241?AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81?N N L P D G V K K V K D I M D L A K P P
301?ATGAACGACTTGAGAATCCAGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101?M N D L R I Q R K A A N E L F S I L Q K
361?CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121?L V D P P S F K R K R S Q S Q R R C N C
Above sequence is the nucleotide sequence and the aminoacid sequence of chicken interferon gamma, the 1st, 3,5,7,9,11,13 behavior nucleotide sequences wherein, the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
The preparation method of chicken interferon gamma is made up of following processing step:
The construction of recombinant vector of A, chicken recombinant interferon, conversion and screening, comprising:
A, the structure of recombinant vectors: according to the cDNA sequence of chicken interferon gene mature peptide, utilize a pair of Auele Specific Primer rCIFF 5 ' CAG CAT GCC TAA ATC TTG TTC AAC TTC 3 ' and rCIFR 5 ' CCA AGC TTA GCA ATT GCA TCT CCT CT 3 ', introduce two different restriction endonuclease sites such as SphI and HindIII at these two ends to primer, in the chicken organ cDNA library of Polyinosinic-polycytidylic acid (polyI:C) or virus infection, carrying out pcr amplification reaction, amplified production is after two different restriction enzyme SphI and HindIII digestion, subclone is to the expression plasmid carrier that contains 6 Histidines (6His) mark, and the expression plasmid carrier is selected pQE series (Qiagen) for use, pET series or pMET series;
B, conversion and screening
The method of utilizing chemical conversion or electricity to transform, with the expression vector that has made up in a step, conversion or transfection are carried out the PCR bidirectional screening with carrier primer and gene-specific primer respectively in protokaryon or eucaryon host body; The positive colony that obtains carries out plasmid purification, the digestion with restriction enzyme checking; And after sequencing etc. is identified, the positive colony that obtains of screening as engineering strain;
The abduction delivering of B, expression product and separation and purification, wherein:
Adopting reagent such as isopropyl-(IPTG) or methyl alcohol is that inductor is induced the engineering strain that is obtained in the b step and expressed, after the lysate cracking with metal affinity chromatography and monoclonal antibody purifying;
C, termination and preservation.
The purposes of 1 chicken interferon gamma is immunostimulant, disease control medicine, fodder additives, the pharmaceutical preparation of preparation vaccine.
Concrete processing condition and processing step are among the preparation method of the present invention:
The reaction solution of pcr amplification reaction should comprise the component of following unit volume:
cDNA 1-5ul
10x?PCR?buffer 2.5ul
25mM?Mg
2+ 1.5ul
2.5mM?DNTP 1ul
10pM?rCIFF/rCIFR 1ul
Taq?polymerase?5u/ul 0.2ul
Add water to 25ul
Pcr amplification reaction comprises 25-35 circulation, and each circulation comprises the cDNA sex change, anneal and extend three reaction process, wherein:
The reaction conditions of cDNA sex change is: temperature of reaction 92-98 ℃, and incubation time 0.5-1 minute;
Annealing: reduce temperature, primer is combined with template annealing, temperature of reaction is that 55-64 ℃, reaction times are 0.5-1 minute;
Extend: behind template and primer annealing, improve temperature and make annealing primer prolong the extension of template direction, goal gene is fully increased, temperature of reaction is 68 ℃-72 ℃, and the reaction times is 45 seconds-3 minutes;
Stop and preserve in the step, termination is after reaction is finished, and new synthetic sample temporarily is stored under 4-10 ℃ the low temperature environment; Prolonged preservation is amplified production to be stored in-20 ℃--80 ℃ are standby.
Subclone is with restriction enzyme SphI and HindIII the PCR product of acquisition or clone's plasmid and expression vector to be carried out restrictive diges-tion, with the postdigestive gene amplification product that contains the specificity restriction endonuclease sites and expression vector purified after, connect with the T4DNA ligase enzyme, and be transformed in protokaryon or the carrier for expression of eukaryon.
Amplified production is in two different restriction enzyme SphI and HindIII digestion reaction, and reaction solution comprises following component:
PCR product or plasmid DNA 0.1ug-2ug
10X?buffer 2ul
Restriction enzyme Sph I 1ul
Restriction enzyme Hind III 1ul
Above-mentioned component is added water to 20ul, hatched 0.5-6 hour in 37 ℃.
Connection is with behind postdigestive goal gene and the expression vector purifying, according to the mixed of 1-8 to 8-1, adds the T4DNA ligase enzyme, is that 4-16 ℃, time are to connect in 0.5-24 hour in temperature, and the consumption of each component is in the ligation:
2X contains the T4DNA ligase enzyme and connects damping fluid 5 μ l fast
Through postdigestive expression vector 150ng
Through postdigestive goal gene segment 50ng
Above-mentioned component is added water to 10 μ l
Metal affinity chromatography is selected Ni-NTA (Qiagen) metal affinity purification colloid for use in the B step, and monoclonal antibody is selected the monoclonal antibody of chicken interferon behind 6His monoclonal antibody or the purifying for use.
Substantive distinguishing features that the present invention obtains and significant technical progress are:
The present invention arrives prokaryotic expression carrier with the chicken interferon gamma gene clone, and at the external purifying that carries out, this technology comprises the structure of recombinant expression vector, the sport technique segments such as separation and purification of expression product, can obtain the chicken interferon gamma gene of high purity vivoexpression; Adopt the product of this method preparation to can be used for preparing disease control medicine, immunostimulant, additive of bait etc., also can be used for the bird immunity theoretical research of mechanism.
Embodiment
Below in conjunction with embodiment the present invention is described further:
The cDNA sequence of chicken interferon gamma as described above.
The preparation method of chicken interferon gamma is made up of following processing step:
The construction of recombinant vector of A, chicken recombinant interferon, conversion and screening, comprising:
A, the structure of recombinant vectors: according to the cDNA sequence of chicken interferon gene mature peptide, utilize a pair of Auele Specific Primer rCIFF 5 ' CAG CAT GCC TAA ATC TTG TTC AAC TTC 3 ' and rCIFR 5 ' CCA AGC TTA GCA ATT GCA TCT CCT CT 3 ', introduce two different restriction endonuclease sites SphI and HindIII at these two ends to primer, carrying out pcr amplification reaction through Polyinosinic-polycytidylic acid (polyI:C), amplified production is after two different restriction enzyme SphI and HindIII digestion, subclone is to the expression plasmid carrier that contains 6 Histidines (6His) mark, and the expression plasmid carrier is selected pQE series (Qiagen) for use, pET series or pMET series;
B, conversion and screening
Utilize traditional Calcium Chloride Method, with the expression vector that has made up in a step, be transformed in the prokaryotic hosts body, prokaryotic hosts is selected intestinal bacteria for use, carries out the PCR bidirectional screening with carrier primer and gene-specific primer respectively; The positive colony that obtains carries out plasmid purification, the digestion with restriction enzyme checking; And after sequencing etc. is identified, the positive colony that obtains of screening as engineering strain;
The separation and purification of B, expression product, wherein:
Employing isopropyl-(IPTG) is induced the engineering strain that is obtained in the b step for inductor and is expressed, and uses metal affinity chromatography and monoclonal antibody purifying after the lysate cracking;
C, termination and preservation.
Wherein, the reaction solution of pcr amplification reaction should comprise the component of following unit volume:
cDNA 1-5ul
10x?PCR?buffer 2.5ul
25mM?Mg
2+ 1.5ul
2.5mM?DNTP 1ul
10pM?rCIFF/rCIFR 1ul
Taq?polymerase?5u/ul 0.2ul
Add water to 25ul
Pcr amplification reaction comprises 30 circulations, and each circulation comprises the cDNA sex change, anneal and extend three reaction process, wherein:
The reaction conditions of cDNA sex change is: 94 ℃ of temperature of reaction, incubation time 0.5 minute;
Annealing: reduce temperature, primer is combined with template annealing, temperature of reaction is that 60 ℃, reaction times are 30 seconds;
Extend: behind template and primer annealing, improve temperature and make annealing primer prolong the extension of template direction, goal gene is fully increased, temperature of reaction is 70 ℃, and the reaction times is 60 seconds;
Stop and preserve in the step, termination is after reaction is finished, and new synthetic sample is stored under 4 ℃ the low temperature environment; Preservation be amplified production is stored in-20 ℃ standby.
Subclone is with restriction enzyme SphI and HindIII the PCR product of acquisition or clone's plasmid and expression vector to be carried out restrictive diges-tion, with the postdigestive gene amplification product that contains the specificity restriction endonuclease sites and expression vector purified after, connect with the T4DNA ligase enzyme, and be transformed in the prokaryotic expression carrier.
Amplified production is in two different restriction enzyme SphI and HindIII digestion reaction, and reaction solution comprises following component:
PCR product or plasmid DNA 0.15ug
10X?buffer 2ul
Restriction enzyme Sph I 1ul
Restriction enzyme Hind III 1ul
Above-mentioned component is added water to 20ul, hatch in 37 ℃ and digested in 3 hours.。
Connection is with behind postdigestive goal gene and the expression vector purifying, adds the T4DNA ligase enzyme, according to following requirement preparation, is 16 ℃, connects and spend the night that in temperature the consumption of each component is in the ligation:
Contain the T4DNA ligase enzyme and connect damping fluid 2X 5 μ l fast
Through postdigestive expression vector 150ng
Through postdigestive goal gene segment 50ng
Above-mentioned component is added water to 10 μ l
Metal affinity chromatography is selected Ni-NTA (Qiagen) metal affinity purification colloid for use in the B step, and monoclonal antibody is selected the monoclonal antibody of chicken interferon behind 6His monoclonal antibody or the purifying for use.
Chicken interferon gamma is used to prepare the immunostimulant of vaccine.
Claims (10)
1, chicken interferon gamma is characterized in that its cDNA sequence is:
1?CTAAATCTTGTTCAACTTCAAGATGATATAGACAAACTGAAAGCTGACTTTAACTCAAGT
1?L N L V Q L Q D D I D K L K A D F N S S
61?CATTCAGATGTAGCTGACGGTGGACCTATTATTGTAGAGAAACTGAAGAACTGGACAGAG
21?H S D V A D G G P I I V E K L K N W T E
121?AGAAATGAGAAAAGGATCATACTGAGCCAGATTGTTTCGATGTACTTGGAAATGCTTGAA
41?R N E K R I I L S Q I V S M Y L E M L E
181?AACACTGACAAGTCAAAGCCGCACATCAAACACATATCTGAGGAGCTCTATACTCTGAAA
61?N T D K S K P H I K H I S E E L Y T L K
241?AACAACCTTCCTGATGGCGTGAAGAAGGTGAAAGATATCATGGACCTGGCCAAGCCCCCG
81?N N L P D G V K K V K D I M D L A K P P
301?ATGAACGACTTGAGAATCCAGCGCAAAGCCGCGAATGAACTCTTCAGCATCTTACAGAAG
101?M N D L R I Q R K A A N E L F S I L Q K
361?CTGGTGGATCCTCCGAGTTTCAAAAGGAAAAGGAGCCAGTCTCAGAGGAGATGCAATTGC
121?L V D P P S F K R K R S Q S Q R R C N C
Above sequence is the nucleotide sequence and the aminoacid sequence of chicken interferon gamma, the 1st, 3,5,7,9,11,13 behavior nucleotide sequences wherein, the 2nd, 4,6,8,10,12,14 behavior aminoacid sequences.
2, the preparation method of chicken interferon gamma according to claim 1 is characterized in that it is made up of following processing step:
The construction of recombinant vector of A, chicken recombinant interferon, conversion and screening, comprising:
A, the structure of recombinant vectors: according to the cDNA sequence of chicken interferon gene mature peptide, utilize a pair of Auele Specific Primer, and two different restriction endonuclease sites are introduced as (SphI in two ends of primer at this, KpnI, PstI, XhoI) and (KpnI, PstI, HindIII), below be that example describes with SphI and HindIII, SphI is contained at the two ends of primer rCIFF 5 '-CAG CAT GCC TAA ATC TTG TTC AAC TTC-3 ' and primer rCIFR 5 '-CCA AGC TTA GCA ATT GCA TCT CCT CT-3 ' respectively and HindIII restriction enzyme enzyme recognition site is G CAT GC and A AGC TT, in the chicken organ cDNA library of Polyinosinic-polycytidylic acid (polyI:C) or virus infection, carrying out pcr amplification reaction, amplified production is after two different restriction enzyme SphI and HindIII digestion, subclone is to the expression plasmid carrier that contains 6 Histidines (6His) mark, and the expression plasmid carrier is selected pQE series (Qiagen) for use, pET series or pMET series etc.;
B, conversion and screening
The method of utilizing chemical conversion or electricity to transform, with protokaryon or the carrier for expression of eukaryon that has made up in a step, conversion or transfection are carried out the PCR bidirectional screening with carrier primer and gene-specific primer respectively in protokaryon or eucaryon host body; The positive colony that obtains carries out plasmid purification, the digestion with restriction enzyme checking; And after sequencing etc. is identified, the positive colony that obtains of screening as engineering strain;
The separation and purification of B, expression product, wherein:
Adopting isopropyl-(IPTG) or methyl alcohol is that inductor is induced the engineering strain that is obtained in the b step and expressed, after the lysate cracking with metal affinity chromatography and monoclonal antibody purifying;
C, termination and preservation.
3, the preparation method of chicken interferon gamma according to claim 2, the reaction solution that it is characterized in that pcr amplification reaction should comprise the component of following unit volume:
cDNA 1-5ul
10×PCR?buffer 2.5ul
25mM?Mg
2+ 1.5ul
2.5mM?DNTP 1ul
Each 1ul of 10pM rCIFF/rCIFR
Taq?polymerase?5u/ul 0.2ul
Add water to 25ul
4, according to the preparation method of claim 2 or 3 described chicken interferon gammas, it is characterized in that pcr amplification reaction comprises 25-35 circulation, each circulation comprises the cDNA sex change, anneals and extends three reaction process, wherein:
The reaction conditions of cDNA sex change is: temperature of reaction 92-98 ℃, and incubation time 0.5-1 minute;
Annealing: reduce temperature, primer is combined with template annealing, temperature of reaction is that 55-64 ℃, reaction times are 0.5-1 minute;
Extend: behind template and primer annealing, improve temperature and make annealing primer prolong the extension of template direction, goal gene is fully increased, temperature of reaction is 68 ℃-72 ℃, and the reaction times is 45 seconds-3 minutes.
5, the preparation method of chicken interferon gamma according to claim 2 is characterized in that described termination and preserves in the step that termination is after reaction is finished, and new synthetic sample temporarily is stored under 4-10 ℃ the low temperature environment; Prolonged preservation is amplified production to be stored in-20 ℃--80 ℃ are standby.
6, the preparation method of chicken interferon gamma according to claim 2, it is characterized in that described subclone is with restriction enzyme SphI and HindIII the PCR product of acquisition or clone's plasmid and expression vector to be carried out restrictive diges-tion, with the postdigestive gene amplification product that contains the specificity restriction endonuclease sites and expression vector purified after, connect with the T4 dna ligase, and be transformed in protokaryon or the carrier for expression of eukaryon.
7, according to the preparation method of claim 2 or 6 described chicken interferon gammas, it is characterized in that described amplified production in two specific restriction enzyme SphI and HindIII digestion reaction, reaction solution comprises following component:
PCR product or plasmid DNA 0.1ug-2ug
10X?buffer 2ul
Restriction enzyme Sph I 1ul
Restriction enzyme Hind III 1ul
Above-mentioned component is added water to 20ul, hatched 0.5-6 hour in 37 ℃.
8, the preparation method of chicken interferon gamma according to claim 6, it is characterized in that described connection is with behind postdigestive goal gene and the expression vector purifying, mixed according to 1-8: 1-8, add the T4 dna ligase, in temperature is that 4-16 ℃, time are to connect in 0.5-24 hour, and the consumption of each component is in the ligation:
2X contains the T4 dna ligase and connects damping fluid 5 μ l fast
Through postdigestive expression vector 150ng
Through postdigestive goal gene segment 50ng
Above-mentioned component is added water to 10 μ l
9, the preparation method of chicken interferon gamma according to claim 2, it is characterized in that metal affinity chromatography is selected Ni-NTA (Qiagen) metal affinity purification colloid for use in the described B step, monoclonal antibody is selected the monoclonal antibody of chicken interferon behind 6His monoclonal antibody or the purifying for use.
10, the purposes of chicken interferon gamma according to claim 1 is characterized in that it is used to prepare the immunostimulant of vaccine, disease control medicine, fodder additives, pharmaceutical preparation etc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510012701 CN1752210A (en) | 2005-07-22 | 2005-07-22 | Chicken interferon gamma, preparing process and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510012701 CN1752210A (en) | 2005-07-22 | 2005-07-22 | Chicken interferon gamma, preparing process and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1752210A true CN1752210A (en) | 2006-03-29 |
Family
ID=36679215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510012701 Pending CN1752210A (en) | 2005-07-22 | 2005-07-22 | Chicken interferon gamma, preparing process and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1752210A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101851628A (en) * | 2010-04-28 | 2010-10-06 | 东北农业大学 | Method for cloning and expressing recombinant chicken interferon (IFN)-gamma genes and detecting activity of recombinant chicken IFN-gamma genes |
| CN101948845A (en) * | 2010-09-01 | 2011-01-19 | 中国科学院微生物研究所 | Optimization gene for coding chicken interferon alpha and application thereof in preparing chicken interferon alpha |
| CN102286490A (en) * | 2011-07-25 | 2011-12-21 | 鼎正动物药业（天津）有限公司 | Preparation and renaturation method of chicken interferon gamma |
| CN102964443A (en) * | 2012-12-13 | 2013-03-13 | 黑龙江省汇丰动物保健品有限公司 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
-
2005
- 2005-07-22 CN CN 200510012701 patent/CN1752210A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101851628A (en) * | 2010-04-28 | 2010-10-06 | 东北农业大学 | Method for cloning and expressing recombinant chicken interferon (IFN)-gamma genes and detecting activity of recombinant chicken IFN-gamma genes |
| CN101948845A (en) * | 2010-09-01 | 2011-01-19 | 中国科学院微生物研究所 | Optimization gene for coding chicken interferon alpha and application thereof in preparing chicken interferon alpha |
| CN101948845B (en) * | 2010-09-01 | 2012-08-08 | 中国科学院微生物研究所 | Optimization gene for coding chicken interferon alpha and application thereof in preparing chicken interferon alpha |
| CN102286490A (en) * | 2011-07-25 | 2011-12-21 | 鼎正动物药业（天津）有限公司 | Preparation and renaturation method of chicken interferon gamma |
| WO2013013602A1 (en) * | 2011-07-25 | 2013-01-31 | 鼎正动物药业（天津）有限公司 | Method for preparing and renaturing chicken interferon γ |
| CN102286490B (en) * | 2011-07-25 | 2013-03-20 | 鼎正动物药业（天津）有限公司 | Preparation and renaturation method of chicken interferon gamma |
| CN102964443A (en) * | 2012-12-13 | 2013-03-13 | 黑龙江省汇丰动物保健品有限公司 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
| CN102964443B (en) * | 2012-12-13 | 2014-10-08 | 黑龙江省汇丰动物保健品有限公司 | Construction and production methods of recombinant vector of recombinant chicken gamma interferon |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | The bioactivity of teleost IL-6: IL-6 protein in orange-spotted grouper (Epinephelus coioides) induces Th2 cell differentiation pathway and antibody production | |
| Peng et al. | Molecular characterization and expression of interleukin-10 and interleukin-22 in golden pompano (Trachinotus ovatus) in response to Streptococcus agalactiae stimulus | |
| CN1974775A (en) | Recombinant plasmid and engineering bacterium containing grass carp interferon gene and their application | |
| CN1896107A (en) | Cecropin A-magainin hybrid gene engineering bactericidal peptide | |
| CN1752210A (en) | Chicken interferon gamma, preparing process and use thereof | |
| CN1654656A (en) | FenneropenaeusChinensis Crustin gene and coded protein and cloning method therefor | |
| Li et al. | Characterization of snakehead (Channa argus) interleukin-21: Involvement in immune defense against two pathogenic bacteria, in leukocyte proliferation, and in activation of JAK–STAT signaling pathway | |
| CN1766109A (en) | Chinese prawn C-type agglutinin gene and its coded C-type agglutinin peptide and uses | |
| CN1821397A (en) | Method for preparing recombinant goose interferon I and II | |
| CN100344758C (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
| CN1238378C (en) | An antibiotic peptide and its coded sequence and use | |
| CN1171998C (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| CN1772298A (en) | The pIL-6 gene adjuvant for pig vaccine and its prepn process | |
| CN1262559C (en) | Housefly phylaxin gene, and its cloning method and recombinant application | |
| CN1236059C (en) | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof | |
| CN1247794C (en) | Production process of human horny cell growth factor-2 | |
| CN1632120A (en) | Hepcidin antibiotic peptide gene of weever cultured in sea water | |
| CN1887344A (en) | Animal interferon compound and its prepn and application | |
| CN1818068A (en) | Construction of recombinant human leucocyte medium-2(125ser) expression carrier | |
| CN1467291A (en) | Avian interleukin-2 (IL-2) gene and eukaryon expressing plasmid and immunity reinforcing agent of bird vaccine | |
| CN101050448A (en) | Oral recombined DNA vaccine for accelerating growth of animal, and application | |
| CN1624127A (en) | Hepcidin antibacterial peptide gene of genuine porgy cultured in sea water | |
| CN101063132A (en) | Lateolabrax interleukins 8 gene order | |
| CN100344763C (en) | G-type lysozyme gene of Argopecten irradians and encoded protein and cloning method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |