CN1760203A - Antibacterial tripeptides and modified chemicals, and application - Google Patents
Antibacterial tripeptides and modified chemicals, and application Download PDFInfo
- Publication number
- CN1760203A CN1760203A CN 200510036165 CN200510036165A CN1760203A CN 1760203 A CN1760203 A CN 1760203A CN 200510036165 CN200510036165 CN 200510036165 CN 200510036165 A CN200510036165 A CN 200510036165A CN 1760203 A CN1760203 A CN 1760203A
- Authority
- CN
- China
- Prior art keywords
- tripeptides
- antibiotic
- chemical modification
- modification object
- described antibiotic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
An antibacterial tripeptide with the sequence His Glu Leu and its chemically modified compound are disclosed, which can suppress and kill the Pseudomonas aeruginosa, hydrophilic aeromonad, Pasteur vibrio, etc. It can be used as the pilot compound fore developing antibiotics.
Description
Technical field
The present invention relates to the genetically engineered field, relate to a kind of antibiotic tripeptides and chemically modified product and application specifically.
Background technology
Microbiotic refers to have antipathogen or other an active class material by what bacterium, mould or other microorganism produced in metabolic process, is one of human greatest discovery of 20th century.Since 1940, penicillin begins to be applied to clinical, countless people and benefits from it.Yet the resistance problem also produces thereupon, and resistance has just appearred in bacterium when using first-generation penicillin.Up to now, there be not the bacterium responsive fully to microbiotic.Enjoy the vancomycin of " last line of defense that the mankind tackle the intractable Resistant strain " good reputation in the world, had been found that corresponding drug-resistant bacteria and be faced with the danger of inefficacy.Relevant investigation shows, up to 70%, the resistant rate of Hp then rises to 82% to intestinal bacteria to the resistance of carbostyril family antibacterial drugs.By last century end, the number that bacterial infection is died from the whole world every year has reached 2,000 ten thousand, and this is before 40 years 3 times.The resistance pathogenic agent increases the threat that makes the mankind face drug-fast bacteria infection that increases of multi-drug resistant pathogenic agent particularly.If do not solve antibiotic resistance problem, will cause the mankind itself all microbiotic medicines all to be had resistance some day, and " no medicine can be used ".The effective ways that solve the resistance problem are developing new drugs, and other solutions comprise that old medicine newly uses and improve existing preparation, and new antibacterial therapy method is explored in rational use of drug, the exploitation of anti-bacterial vaccines and application or the like.
Studies show that the antibiotic gene of coding is also arranged in the genome of many biologies.These genes encodings mostly be some small peptides, be called antibacterial peptide.Antibacterial peptide generally carries positive charge, and it has characteristics such as strong, the difficult generation resistance of anti-microbial activity.But the general length of antibacterial peptide is 10 to 40 amino acid, has certain immunogenicity and relatively poor biological accessibility.The good drug molecule amount of general biological accessibility is all hundreds of dalton.If can find the antibiotic oligopeptides of small molecules, then can develop new antibiotic resource.So the separation of antibiotic oligopeptides has great importance.
Summary of the invention
The objective of the invention is to directed toward bacteria and generally antibiosis is have chemical sproof problem, a kind of antibiotic tripeptides that can bacteria growing inhibiting is provided.
Another object of the present invention provides the chemical modification object of above-mentioned antibiotic tripeptides.
Another object of the present invention provides above-mentioned antibiotic tripeptides and the application of chemical modification object in the preparation antibacterials thereof.
Antibiotic tripeptides of the present invention, its dna sequence dna are CACGAATTA, and aminoacid sequence is His Glu Leu.Antibiotic tripeptides of the present invention can adopt engineered method production, also can adopt chemical synthesis synthetic.By this antibiotic tripeptides is carried out chemically modified, its chemical modification object has good antibacterial effect equally.For example, the present invention obtains its chemical modification object Ac-His GluLeu by this antibiotic tripeptides is carried out the acetylize of alpha-amino group end.It is carried out the carboxyl terminal amidated, obtain another kind of chemical modification object His Glu Leu-NH
2
The separation of antibiotic tripeptides His Glu Leu is achieved through the following technical measures among the present invention: make up the yeast α mating factor leading peptide and the fusion dna fragment of peptide at random, be used for the secreting, expressing of peptide at random; Insert the yeast saccharomyces cerevisiae carrier that contains inducible promoter with EcoR I and Xba I double digestion; Recombinate with pastoris genomic dna after conversion for the linear DNA of avoiding not connecting, it is carried out digestion process with exonuclease III and Semen Phaseoli radiati Germinatus nuclease; Electricity swashs transformed saccharomyces cerevisiae behind the purifying; Transformant is forwarded to semi-lactosi abduction delivering flat board, covers the observation inhibition zone after the overnight growth with the upper strata substratum that contains bacteria culture; With surveying bacteriostasis rate behind the liquid nutrient medium abduction delivering; Positive colony is carried out pcr amplification, order-checking; Chemosynthesis part antibacterial peptide is used the agar diffusion method detection of active.
Antibiotic tripeptides of the present invention and chemical modification object thereof have good antibacterial effect, can be used to develop new microbiotic.Antibiotic tripeptides of the present invention and chemical modification object thereof can suppress the growth of Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus or the like bacterium.Antibiotic tripeptides His Glu Leu and chemical modification object His GluLeu-NH thereof
2Can be good at suppressing Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus, kill the growth of p pestic more; Chemical modification object Ac-His Glu Leu can be good at suppressing the growth of Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus.
Beneficial effect of the present invention: antibiotic tripeptides of the present invention and chemical modification object thereof have the good advantage of little, the biological accessibility of molecular weight, and the while is the high immunogenicity of tool not, can be used as the lead compound of microbiotic exploitation.Pseudomonas aeruginosa is more serious infector, is badly in need of the new medicine of exploitation now.And antibiotic tripeptides of the present invention and chemical modification object thereof have the effect of anti Bacillus pyocyaneu Flugge.In addition, because tripeptides of the present invention has antibacterial effect to the aquaculture common bacteria, therefore can be applied in water industry.
Description of drawings
Fig. 1 covers lab diagram for agarose; The positive transformant of Fig. 1 a forms inhibition zone figure as a result to the Pseudomonas aeruginosa on upper strata; Fig. 1 b is the Pseudomonas aeruginosa inhibition design sketch of empty carrier transformant to the upper strata;
Fig. 2 is that full-automatic synthetic, purity are that 99.3% antibiotic tripeptides His Glu Leu (HL3), purity are that 98.5% antibiotic tripeptides Ac-His Glu Leu (ACHL3), purity are 99.1% antibiotic tripeptides His GluLeu-NH2 (HL3NH2) point sample 100 μ g at the formed inhibition zone of the substratum that contains Aeromonas hydrophila figure as a result;
Fig. 3 is that full-automatic synthetic, purity are 99.3% antibiotic tripeptides His Glu Leu (HL3) point sample 100 μ g at the formed inhibition zone of the substratum that contains Pseudomonas aeruginosa figure as a result;
It is that 98.5% antibiotic tripeptides Ac-His Glu Leu (ACHL3), purity are 99.1% antibiotic tripeptides His Glu Leu-NH2 (HL3NH2) point sample 100 μ g at the formed inhibition zone of the substratum that contains Pseudomonas aeruginosa figure as a result that Fig. 4 is respectively full-automatic synthetic, purity;
It is that 99.3% antibiotic tripeptides His Glu Leu (HL3), purity are that 98.5% antibiotic tripeptides Ac-His Glu Leu (ACHL3), purity are that 99.1% antibiotic tripeptides His GluLeu-NH2 (HL3NH2) point sample 100 μ g are at the formed inhibition zone of the substratum that contains vibrio alginolyticus that Fig. 5 is respectively full-automatic synthetic, purity;
It is that 99.3% antibiotic tripeptides His Glu Leu (HL3), purity are that 98.5% antibiotic tripeptides Ac-His Glu Leu (ACHL3), purity are that 99.1% antibiotic tripeptides His GluLeu-NH2 (HL3NH2) point sample 100 μ g are containing the formed inhibition zones of substratum that kill p pestic more that Fig. 6 is respectively full-automatic synthetic, purity; Wherein, in Fig. 2, top be 0.1 μ l 50mg/ml gentamicin over against photograph; In Fig. 4, top be 0.1 μ l 100mg/ml gentamicin over against photograph; In Fig. 5, top be 0.1 μ l 50mg/ml gentamicin over against photograph; In Fig. 6, top be 0.1 μ l 100mg/ml penbritin over against photograph.
Embodiment
Embodiment 1
(1) the structure yeast α mating factor leading peptide and the fusion dna fragment of peptide at random are used for the secreting, expressing of peptide at random.Two primers are respectively＜and 1〉GCGAATTCAAAAATGAGATTTCCTTCAA.<2>CGTCTAGATCA(N)
9TCTTTTCTCGAGAGAT。With having the active PfuDNA polymeric enzymatic amplification of high-fidelity.The amplification template usage quantity is every 1ml PCR reaction solution 50ng plasmid pPICZ α A (the Invitrogen product contains yeast α mating factor leading peptide dna sequence dna).Amplification condition is: 94 ℃ of pre-sex change in 5 minutes; 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 20 seconds, 25 circulations; 72 ℃ of 5 minutes benefits are flat.Amplified production precipitates 7 minutes with 1/10 2.5M NaAc, pH5.2 and 2.5 times of dehydrated alcohols in 13000rpm.Use 70% washing with alcohol, 13000rpm precipitation 3 minutes.Hair dryer dries up.Be suspended in the sterile distilled water.Spend the night with EcoR I and Xba I double digestion, cumulative volume is 30 μ l.70 ℃ of heat inactivations 20 minutes.
(2) 5 μ g pYES2/CT (Invitrogen product) spend the night with EcoR I and Xba I double digestion, and cumulative volume is 30 μ l.70 ℃ of heat inactivations 20 minutes.Get the pYES2/CT of 6.5 μ l double digestions, add the PCR product of 6 μ l double digestions, 1.5 μ l 10X ligase enzyme damping fluids, 1 μ l T4 dna ligase, 16 ℃ of connections are spent the night.
(3) recombinate with pastoris genomic dna after conversion for the linear DNA of avoiding not connecting, need it to be carried out digestion process with nuclease.Connect the PCR purification column purifying (see product description) of product with Qiagen company.With 30 μ l H
2The O wash-out.Add 3.5 μ l 10X exonuclease III damping fluids and 1 μ l (20 unit) exonuclease III, handled 1 hour for 37 ℃.70 ℃ of inactivations 15 minutes.Add 3.5 μ l 10X Semen Phaseoli radiati Germinatus nuclease damping fluids and 30 μ l H
2O adds 1 μ l (20 unit) Semen Phaseoli radiati Germinatus nuclease again, handles 1 hour 20 minutes for 37 ℃.With the PCR purification column purifying of Qiagen company, with 13 μ l H
2The O wash-out.Getting 10 μ l does electric sharp.
(4) at first prepare the yeast competent cell.Yeast saccharomyces cerevisiae bacterial classification INVScl inoculation 200ml YPD with incubated overnight.30 ℃ of shake-flask culture are divided in the 50ml centrifuge tube to OD value 1.3 with culture, 5000rpm, and 4 ℃ are centrifugal 5 minutes.Remove supernatant.Be resuspended in cumulative volume 100ml Lithium Acetate/dithiothreitol (DTT) pretreatment fluid, 25 ℃ are incubated 1 hour.Be resuspended in the sterilized water of cumulative volume 200ml ice precooling.5000rpm, 4 ℃ centrifugal 5 minutes.Remove supernatant.Be resuspended in the sterilized water of cumulative volume 100ml ice precooling.5000rpm, 4 ℃ centrifugal 5 minutes.Remove supernatant.Be resuspended in the 1mol/L sorbyl alcohol of 20ml ice precooling.5000rpm, 4 ℃ centrifugal 5 minutes.Remove supernatant.Be resuspended in the 1mol/L sorbyl alcohol of 0.2ml ice precooling.Ice bath.The DNA (cumulative volume is 10 μ l) and the 20 μ g single stranded DNAs (salmon sperm dna) that add 80 μ l yeast suspensions and 100ng in each sterile tube, mixing gently is transferred to the aseptic electricity of 0.2-cm and swashs cup, 10 ℃ of water-baths 5 minutes.1.8 doing electricity, kilovolt, 25 microfarads, 200 ohm swash.Adding 650 μ l 1mol/L sorbyl alcohols at once swashs in the cup to electricity.Mixing is transferred to culture tube gently, adds 650 μ l 2X YPD/1mol/L sorbyl alcohols, and 30 ℃ of shaking tables were cultivated 1 hour after the mixing.Water is washed the YPD substratum off.
(5) electricity is swashed mixture coating glucose/sorbyl alcohol and select flat board, in 30 ℃ of growths 3 days.Being forwarded to the glucose that does not contain sorbyl alcohol selects dull and stereotyped.
(6) be forwarded to glycerine/semi-lactosi abduction delivering flat board, in 30 ℃ of growths 1 day.Propose inoculation the day before yesterday and be used to detect the active Pseudomonas aeruginosa of antibacterial peptide, in 37 ℃ of overnight growth.The Pseudomonas aeruginosa of 5 μ l overnight growth is added to 0.7% agarose/LB that 50 ℃ of left and right sides autoclavings of 10ml are crossed.Being poured on length gently has on the glycerine/semi-lactosi abduction delivering flat board of yeast transformant.Leave standstill and solidified in 10 minutes.Make a call to an aperture in the place that does not have transformant with rifle head point, add microbiotic, put super clean bench 5 minutes as over against photograph.Be inverted overnight growth at 37 ℃ of incubators.Observe inhibition zone, record is taken pictures.The positive transformant of Fig. 1 a is to the inhibition zone of the Pseudomonas aeruginosa formation on upper strata.
(7) insert fragment from the yeast transformant amplification.Get and grow in the yeast 1.5ml that glucose is selected logarithmic growth late period of substratum, centrifugal 15 seconds of 13000rpm removes supernatant.With the distilled water washing once, centrifugal 15 seconds of 13000rpm.Precipitation is suspended in 30 μ l TE damping fluids.On boiling water, boil 3min.The centrifugal 1min of 13000rpm.Supernatant is stored in-20 ℃.Get 3 μ l and be used for being PCR.According to carrier pYES2/CT sequences Design upstream and downstream primer.<3>CCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCG。<4>GGCGTGAATG?TAAGCGTGACATAACTAATTACATGATGCG。Amplification condition is: 95 ℃ of pre-sex change in 5 minutes; 94 ℃ 30 seconds, 68 ℃ 2 minutes, 72 ℃ 30 seconds, 4 circulations; 94 ℃ 30 seconds, 68 ℃ 40 seconds, 72 ℃ 30 seconds, 41 circulations; 72 ℃ of 5 minutes benefits are flat.Select the Taq archaeal dna polymerase and the Pfu archaeal dna polymerase of Shanghai Bo Ya company for use.100 μ l reaction adds 5 Taq of unit archaeal dna polymerases and 2 Pfu of unit archaeal dna polymerases.Amplified fragments is long to be 570bp, by the Shen, Shanghai technology company limited purifying and full-automatic order-checking is arranged.Sequencing primer is＜5〉TAATACGACTCACTATAGGG;＜6〉TAGGATCAGCGGGTTTAAACTC.1 the antibiotic tripeptide sequence that records is: clone and be that tripeptides, dna sequence dna are CACGAATTA, aminoacid sequence is HisGlu Leu.
Used Lithium Acetate/dithiothreitol (DTT) pretreatment fluid prescription is (every 100ml): 0.1M Lithium Acetate (final concentration), 10mM Tris (final concentration), pH 7.5,1mM EDTA (final concentration) adds the 10ml 0.1M dithiothreitol (DTT) of filtration sterilization to the above-mentioned solution of 90ml (final concentration is 10mM) behind the autoclaving.
Used glucose/sorbyl alcohol select the plate culture medium prescription be (every liter): 1.7gYNB (no amino acid yeast nitrogen, Amresco, Inc.), 1M sorbyl alcohol, 10g glucose, 30mg leucine, 20mg Histidine, 30mg tryptophane, 20g agar.Autoclaving.Fall dull and stereotyped.
The used glucose that does not contain sorbyl alcohol selects dull and stereotyped prescription to be (every liter): and 1.7g YNB (no amino acid yeast nitrogen, Amresco, Inc.), 10g glucose, 30mg leucine, 20mg Histidine, 30mg tryptophane, 20g agar.Autoclaving.Fall dull and stereotyped.
The dull and stereotyped prescription of used glycerine/semi-lactosi abduction delivering is (every liter): (Amresco, Inc.), adjust pH is 4.1 to 1.7g YNB, 30ml glycerine, 30mg leucine, 20mg Histidine, 30mg tryptophane, 20g agar.Autoclaving.The final concentration that adds filtration sterilization is 0.5% semi-lactosi.Fall dull and stereotyped.
Used LB prescription is (500ml): the 5g peptone, and the 2.5g yeast extract, 5g sodium-chlor, distilled water, pH 7.0.
Embodiment 2
Synthesize tripeptides His Glu Leu in Shanghai Bo Ya company with Peptide synthesizer.Utilize Fmoc/tBu solid-phase polypeptide synthesis method synthetic.Take off Fmoc with 20% hexahydropyridine, dimethyl formamide.Dimethyl formamide, methyl alcohol, washed with dichloromethane.Crude product is through preparation HPLC purifying, and is freezing, gets pure product.Take by weighing the tripeptides of suitable weight, add water, boiled 8 minutes.
Embodiment 3
Through the amidated tripeptides His of carboxyl terminal Glu Leu-NH
2Biochemical (Shanghai) Co., Ltd. utilizes Fmoc/tBu solid-phase polypeptide synthesis method synthetic by gill.Use Rink Amide AM resin.Take off Fmoc with 20% hexahydropyridine, dimethyl formamide.Dimethyl formamide, methyl alcohol, washed with dichloromethane.Crude product is through preparation HPLC purifying, and is freezing, gets pure product.Take by weighing the tripeptides of suitable weight, add water, boiled 8 minutes.
Embodiment 4
Utilize Fmoc/tBu solid-phase polypeptide synthesis method synthetic through the acetylizad tripeptides Ac-His of aminoterminal Glu Leu by the biochemical (Shanghai) Co., Ltd. of gill.Use Fmoc-Leu (trt)-Wang resin.Take off Fmoc with 20% hexahydropyridine, dimethyl formamide.Dimethyl formamide, methyl alcohol, washed with dichloromethane.Crude product is through preparation HPLC purifying, and is freezing, gets pure product.Take by weighing the tripeptides of suitable weight, add water, boiled 8 minutes.
Embodiment 5
The bacterial classification of 5 μ l overnight growth (Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus, kill p pestic) is added to 0.7% agarose/LB that 50 ℃ of left and right sides autoclavings of 10ml are crossed respectively more, fall dull and stereotypedly, leave standstill and solidified in 10 minutes.Beat a plurality of apertures with rifle head point, 3 apertures respectively add 100 μ g tripeptides His Glu Leu (HL3), tripeptides Ac-His Glu Leu (ACHL3), His Glu Leu-NH
2(HL3NH
2), aperture adds entry as negative contrast, and a dull and stereotyped aperture of part adds 0.1 μ l 50mg/ml gentamicin or penbritin as over against photograph.Put super clean bench 5 minutes.Be inverted overnight growth at 37 ℃ of incubators.Observe inhibition zone, record is taken pictures.The results are shown in Figure 2,3,4,5,6.
Embodiment 6
The bacterial classification of 5 μ l overnight growth (Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus, kill p pestic, Bacillus subtilus) is added to 0.7% agarose/LB that 50 ℃ of left and right sides autoclavings of 10ml are crossed respectively more, fall dull and stereotypedly, leave standstill and solidified in 10 minutes.Beat a plurality of apertures with rifle head point, 3 apertures respectively add 100 μ g tripeptides His GluLeu (HL3), tripeptides Ac-His Glu Leu (ACHL3), His Glu Leu-NH
2(HL3NH
2), aperture adds entry as negative contrast, and a dull and stereotyped aperture of part adds 0.1 μ l 50mg/ml gentamicin or penbritin as over against photograph.Put super clean bench 5 minutes.Be inverted overnight growth at 37 ℃ of incubators.Observe inhibition zone, survey antibacterial circle diameter, as shown in table 1.
Table 1
Embodiment 7
The bacterial classification of 5 μ l overnight growth (Pseudomonas aeruginosa, Aeromonas hydrophila, vibrio alginolyticus, kill p pestic, Bacillus subtilus) is added to 0.7% agarose/LB that 50 ℃ of left and right sides autoclavings of 10ml are crossed respectively more, fall dull and stereotypedly, leave standstill and solidified in 10 minutes.Beat a plurality of apertures with rifle head point, 3 apertures respectively add 150 μ g tripeptides His GluLeu (HL3), tripeptides Ac-His Glu Leu (ACHL3), His Glu Leu-NH
2(HL3NH
2), aperture adds entry as negative contrast, and a dull and stereotyped aperture of part adds 0.1 μ l 50mg/ml gentamicin or penbritin as over against photograph.Put super clean bench 5 minutes.Be inverted overnight growth at 37 ℃ of incubators.Observe inhibition zone, survey antibacterial circle diameter, the result is as shown in table 2.
Table 2
A kind of antibiotic tripeptides and chemical modification object thereof and application sequence table
SEQUENCE?LISTING
＜110〉Zhongshan University
＜120〉a kind of antibiotic tripeptides and chemical modification object and application
<130>
<160>7
<170>
<210>1
<211>9
<212>DNA
＜213〉artificial sequence
<400>1
CACGAATTA
<210>2
<211>3
<212>PRT
＜213〉artificial sequence
<400>2
His?Glu?Leu
<210>3
<211>3
<212>PRT
＜213〉artificial sequence
<400>3
Ac-His?Glu?Leu
<210>4
<211>3
<212>PRT
＜213〉artificial sequence
<400>4
His?Glu?Leu-NH2
<210>5
<211>
<212>DNA
＜213〉a pair of primer
<400>5
Primer 1:GCGAATTCAAAAATGAGATTTCCTTCAA
Primer 2: CGTCTAGATCA (N) 9TCTTTTCTCGAGAGAT
<210>6
<211>
<212>DNA
＜213〉a pair of primer
<400>6
Primer 1:CCTCTATACTTTAACGTCAAGGAGAAAAAACCCCGGATCG
Primer 2: GGCGTGAATG TAAGCGTGACATAACTAATTACATGATGCG
<210>7
<211>
<212>DNA
＜213〉a pair of primer
<400>7
Primer 1:TAATACGACTCACTATAGGG
A kind of antibiotic tripeptides and chemical modification object thereof and application sequence table
Primer 2: TAGGATCAGCGGGTTTAAACTC
Claims (7)
1, a kind of antibiotic tripeptides, its dna sequence dna is CACGAATTA, aminoacid sequence is His Glu Leu.
2, the chemical modification object of the described antibiotic tripeptides of claim 1.
3, according to the chemical modification object of the described antibiotic tripeptides of claim 2, the chemical modification object that it is characterized in that described antibiotic tripeptides is the acetylizad antibiotic tripeptides of alpha-amino group end, and aminoacid sequence is: Ac-His Glu Leu.
4, according to the chemical modification object of the described antibiotic tripeptides of claim 2, the chemical modification object that it is characterized in that described antibiotic tripeptides is the amidating antibiotic tripeptides of carboxyl terminal, and aminoacid sequence is: His Glu Leu-NH
2
5, the application of the chemical modification object of described antibiotic tripeptides of claim 1 or the described antibiotic tripeptides of claim 2 in the preparation antibacterials.
6, application according to claim 5, the chemical modification object that it is characterized in that described antibiotic tripeptides of claim 1 or the described antibiotic tripeptides of claim 2 preparation anti Bacillus pyocyaneu Flugge, Aeromonas hydrophila, vibrio alginolyticus, kill the application in the medicine of p pestic more.
7, application according to claim 6 is characterized in that the chemical modification object of described antibiotic tripeptides of claim 1 or the described antibiotic tripeptides of claim 4 is preparing anti Bacillus pyocyaneu Flugge, Aeromonas hydrophila, vibrio alginolyticus, killing the application in the p pestic medicine more; Or the application of the chemical modification object of the described antibiotic tripeptides of claim 3 in preparation anti Bacillus pyocyaneu Flugge, Aeromonas hydrophila, vibrio alginolyticus medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100361655A CN100393742C (en) | 2005-07-27 | 2005-07-27 | Antibacterial tripeptides and modified chemicals, and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100361655A CN100393742C (en) | 2005-07-27 | 2005-07-27 | Antibacterial tripeptides and modified chemicals, and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1760203A true CN1760203A (en) | 2006-04-19 |
| CN100393742C CN100393742C (en) | 2008-06-11 |
Family
ID=36706446
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100361655A Expired - Fee Related CN100393742C (en) | 2005-07-27 | 2005-07-27 | Antibacterial tripeptides and modified chemicals, and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100393742C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360467A (en) * | 2013-07-16 | 2013-10-23 | 青岛科技大学 | Preparation method of broad-spectrum antibacterial polypeptide |
| CN104783298A (en) * | 2015-03-24 | 2015-07-22 | 湖州珍贝羊绒制品有限公司 | Preparation and application of biological sterilizing composition and nanoemulsion thereof |
| WO2015113481A1 (en) * | 2014-01-30 | 2015-08-06 | 陈光健 | Oligopeptide molecules, preparation methods therefor and uses thereof |
| CN117384239A (en) * | 2023-12-12 | 2024-01-12 | 深圳保时健生物工程有限公司 | Anti-aging salmon roe tripeptide as well as preparation method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004005892A2 (en) * | 2002-07-10 | 2004-01-15 | The Regents Of The University Of California | Antimicrobial activity of interferon-inducible elr chemokines |
-
2005
- 2005-07-27 CN CNB2005100361655A patent/CN100393742C/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360467A (en) * | 2013-07-16 | 2013-10-23 | 青岛科技大学 | Preparation method of broad-spectrum antibacterial polypeptide |
| CN103360467B (en) * | 2013-07-16 | 2015-06-03 | 青岛科技大学 | Preparation method of broad-spectrum antibacterial polypeptide |
| WO2015113481A1 (en) * | 2014-01-30 | 2015-08-06 | 陈光健 | Oligopeptide molecules, preparation methods therefor and uses thereof |
| CN104783298A (en) * | 2015-03-24 | 2015-07-22 | 湖州珍贝羊绒制品有限公司 | Preparation and application of biological sterilizing composition and nanoemulsion thereof |
| CN117384239A (en) * | 2023-12-12 | 2024-01-12 | 深圳保时健生物工程有限公司 | Anti-aging salmon roe tripeptide as well as preparation method and application thereof |
| CN117384239B (en) * | 2023-12-12 | 2024-02-09 | 深圳保时健生物工程有限公司 | Anti-aging salmon roe tripeptide as well as preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100393742C (en) | 2008-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104497119A (en) | Natural antibacterial peptide and application thereof | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| CN100351270C (en) | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN1654656A (en) | FenneropenaeusChinensis Crustin gene and coded protein and cloning method therefor | |
| CN1641025A (en) | Pagrosomus major antibacterial peptide gene, and recombinant yeast expression vector and its preparing method | |
| CN100345865C (en) | Antibiotic dipeptide and its chemical modifier, its preparation method and uses | |
| CN1294258C (en) | Method for separating antibiotic peptide and separated antibiotic peptide | |
| CN1778920A (en) | Antibiotic peptide gene and its yeast expression carrier | |
| CN1177055C (en) | Antibacterial peptide gene of fly and its cloning process | |
| CN100344758C (en) | Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application | |
| CN112574959B (en) | Bacteriophage for preventing and treating aeromonas disease of aquatic animals and microecological preparation | |
| CN1125081C (en) | Recombined natural and new-type human insulin and its preparation | |
| CN1803846A (en) | Hybrid protein of p53 protein epitope(SQAMDDLMLS) and filobactivirus gene 8 protein and application thereof | |
| CN100351271C (en) | Active polypeptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN1236059C (en) | Grouper insulin-like growth factor II gene, carrier and recombinant strain containing the gene and application thereof | |
| CN1534097A (en) | Chinese prawn heat shock protein 70 gene and its clone method | |
| CN1238377C (en) | Acidic antibacterial peptides and gene as well as its application in pharmacy | |
| CN1170845C (en) | Giant-web bombinator antineoplastic protein and its prepn and gene | |
| CN1740320A (en) | Fenneropenaeus chinensis Anti-LPS factor gene and cloning process thereof | |
| CN1818068A (en) | Construction of recombinant human leucocyte medium-2(125ser) expression carrier | |
| CN1189481C (en) | Human truncated recombination soluble TRAIL-170 protein and application for preparing tumour-curing medicine thereof | |
| CN1800389A (en) | Chlamys Farreri H2A gene clone and N terminal expression technology | |
| CN114774371B (en) | Vibrio phage and application thereof | |
| CN1381587A (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| Li et al. | Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080611 Termination date: 20120727 |