CN1238377C - Acidic antibacterial peptides and gene as well as its application in pharmacy - Google Patents
Acidic antibacterial peptides and gene as well as its application in pharmacy Download PDFInfo
- Publication number
- CN1238377C CN1238377C CN 02113515 CN02113515A CN1238377C CN 1238377 C CN1238377 C CN 1238377C CN 02113515 CN02113515 CN 02113515 CN 02113515 A CN02113515 A CN 02113515A CN 1238377 C CN1238377 C CN 1238377C
- Authority
- CN
- China
- Prior art keywords
- leu
- acidic antibacterial
- gene
- val
- acidic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to acidic antibacterial peptide and genes and pharmaceutical application thereof, which belongs to the technical field of biomedicine. The acidic antibacterial peptide is single-chain polypeptide which is coded by the gene of the Bombina maxima which are amphibian animals in China, the molecular weight is 2021.4, and the isoelectric point is 4.8. A polypeptide amino acid complete sequence comprises a primary structure: Ile Leu Gly Pro Val LeuGly Leu Val Ser Asp The Leu Asp Val Leu Gly Ile Leu-AMIDATION. The gene of the coding acidic antibacterial peptide is formed from 632 nucleotides, wherein the mature coding acidic antibacterial peptide is from the 418th nucleotide to the 477th nucleotide. The manual chemosynthetic acidic antibacterial peptide has the function of obvious bacteria growth inhibition, and can be applied to the preparation of medicines for resisting microbial infection diseases.
Description
Technical field:
The present invention relates to a kind of Bombina maxima (Bombina maxima) acidic antibacterial peptides and gene and the application in pharmacy, belong to biomedical sector.
Background technology:
Since the microbiotic invention, the mankind have obtained bigger achievement in control and treatment infected by microbes disease, but lasting use along with medicine, the microorganism resistance has become the significant problem that Clinical microorganism catches and treats at present, to such an extent as to some pathogenetic bacteria has not had a line medicine of clinical treatment.It all is worldwide clinical difficult problems at present that the staphylococcus of vancomycin resistance, faecalis and other Gram-negatives catch.Three classes cause that mainly strong resistance has also appearred in meningitic bacterium clinically, anti-penicillin, paraxin meningococcus, and (1) also extensively appears in streptococcus pneumoniae, the antibiotic streptococcus pneumoniae of antagonism cephalosporin.Therefore the antibiotic development of new class has become the task of top priority and international focus (2).Compare with present widely used microbiotic, peptide antibiotics has lot of advantages: as when the least action concentration, fast and the killing microorganisms of wide spectrum (comprising clinical anti-medicine bacterium at present), fungi also there is restraining effect, the resistant strain generative nature is little, all effective to local infection and systemic infection, just becoming the new class microbiotic, its development is subjected to extensive attention (3) at present.
A lot of amphibian animals belong to traditional Chinese medicine and national medicine and widespread use in China, as Chinese toad (Bufo gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (pelophylaxnigromaculata), Rana guentheri (Hylarana guentheri) and rana limnocharis (Euphlyctis limnocharis) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy (4) widely.Bombina maxima mainly is distributed in Yunnan, the Sichuan Province of China, is one of characteristic resources animal of China, also is the national folk medicine (5) of characteristic.Abroad, the searching of the specific pharmacology reactive monomer of batrachians skin compound has been the focus (6,7) of new drug invention.According to domestic and foreign literature, separated obtaining different antibacterial peptide (3) from various biogenetic derivations, and some has entered clinical treatment.Antibacterial peptide Magainin tool wide spectrum anti-microbial effect as obtaining from Xenopus laevis (Xenopus laevis) skin juice has anti-tumor activity simultaneously, has got permission as extensive pedigree antibiotic in the U.S., and it is clinical that its gene engineering product entered for three phases; Recently, Magainin drugmaker announces, the Xenopus laevis skin antibacterial peptide Magainin analogue MSI-78 that they produce is used for the treatment of 926 routine diabetic subjects and causes that because of various bacteria infects the III phase clinical effectiveness of foot ulcers shows, MSI-78 and ofloxacin have same effect, but produce littler side effect.The antibacterial peptide IB-367 that Intrabiotics company produces has got permission to be used for the treatment of cancer patient and has infected stomatocace one clinical trial phase that causes because of various bacteria; Applied Microbiology company and the cooperation of Astra company also obtain good curative effect (8) with the clinical trial of antibacterial peptide nisin treatment stomach ulcer.On the other hand, the present antimicrobial proteins polypeptide of report, except that report in 1996 such as Brogden from the isolating SAAP acidic antibacterial peptides of sheep lung (9), the overwhelming majority is basic protein polypeptide (10).Because the particular mechanism of action of acidic antibacterial peptides, thereby acidic antibacterial peptides in the antimicrobial agents development, acquire a special sense (3,9).
The contriver searches comparison with acidic antibacterial peptides complete sequence amino acid structure of the present invention through Protein Data Bank, finds no any phase homopolypeptide.The contriver searches comparison with acidic antibiotic dna encoding peptide of the present invention through gene database, finds no any homologous genes.
Reference
1，Liu?KK，Antibiotic?resistance?in?bacteria.A?current?and?future?problem.Adv.Exp.Med.Biol.，1999；455，387-396.
2，Chopra?I，Research?and?development?of?antibacterial?agents.Curr.Opin.Microbiol.，1998，1，495-501.
3，Zasloff?M，Antimicrobial?peptides?of?multicellular?orgabisms.Nature，2002，415，389-395.
4, the new medical college in Jiangsu, Chinese medicine dictionary, 1997 editions, Shanghai, Shanghai science tech publishing house.
5, Ye Changyuan, Fei Liang, Hu Shuqin, the rare and economic Amphibians of China, 1993, Chengdu, Sichuan science tech publishing house.
6，Lazarus，L.H.，Attila，M.，1993.The?toad，ugly?and?venomous，wearsyet?a?precious?jewel?in?his?skin.Prog.Neurobiol.41，473-507.
7, rely ren, Zhao Yu, Liu Heng, Zhang Yujie, Li Wenhui, Zhang Yun, the strategy that the Chinese batrachians development of resources of opinion is held concurrently in the utilization of amphibian animal skin activity material.Zoological research, 2002,23 (1), 65-70.
8，Jacob?L，Zasloff?M，Potential?therapeutic?applications?of?magaininsand?other?antimicrobial?agents?of?animal?origin.Ciba?Found?Symp.，1994；186，197-216.
9，Brogden?KA，De?Lucca?AJ，Bland?J，Elliott?S，Isolation?of?an?ovinepulmonary?surfactant-associated?anionic?peptide?bactericidal?forPasteurella?haemolytica.Proc.Natl.Acad.Sci.USA，1996，93，412-416.
10，Hancock?RE，Host?defence(cationic)peptides：what?is?their?futureclinical?potential？Drugs?1999，57，469-473.
Summary of the invention:
The objective of the invention is provides a kind of acidic antibacterial peptides and gene thereof and the application in pharmacy based on above-mentioned prior art basis.
In order to realize purpose of the present invention, the invention provides following technical scheme:
Acidic antibacterial peptides, molecular weight 2021.4, iso-electric point 4.8, polypeptide amino acid complete sequence primary structure is: Isoleucine-leucine-glycine-proline(Pro)-Val-Leu-glycine-LEU-VAL-Serine-aspartic acid-Threonine-leucine-aspartic acid-aspartic acid-Val-Leu-glycine-Isoleucine-amidation leucine (Ile Leu Gly Pro Val Leu Gly LeuVal Ser Asp Thr Leu Asp Asp Val Leu Gly Ile Leu-AMIDATION).
The clone of acidic antibacterial peptides gene comprises: the total RNA of Bombina maxima skin extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening acidic antibacterial peptides gene.Amplimer length is 18 Nucleotide, its sequence is 5 ' AGTATCGGNGCNAAAATC3 ', wherein N=A, C, G, T, another amplimer of PCR be positioned at clone's insertion portion 3 ' the carrier S P6 promoter primer of end, its sequence are 5 ' CATACGATTTAGGTGACACTATAG3 '.The positive monoclonal that obtains carries out gene nucleotide series and measures.Gene sequencing result shows that the gene of the acidic antibacterial peptides of encoding is made up of 632 Nucleotide, from 5 ' end to 3 ' terminal sequence is:
atcaagatat?ctgatagcat?ataacaatat?cctgagatcc?tggtaaagat?gaattttaag 60
tacatatttg?cagtgtcctt?tttaatagca?tctgcatatg?cacgaagtgt?acagaatgat?120
gaacagtctc?tgagtcagag?ggatgtttta?gaagaagaat?cactgaggga?aatcagaggt?180
ataggaggaa?aaatcctatc?tggtcttaaa?acagctttaa?aaggtgcagc?caaagagttg?240
gcttctacgt?atctgcatag?gaagagaaca?gctgaagaac?acgaagaaat?gaaaagactg?300
gaagccgtaa?tgcgtgatct?agattccttg?gattatccag?aggaagcttc?tgaaagggaa?360
accagaggct?tcaatcaaga?cgagattgct?aatcttttta?ctaaaaaaga?gaaacgcatt?420
ttggggccag?tactaggttt?ggttagtgat?acacttgacg?atgtacttgg?aattcttgga?480
taattataac?cagtaaaact?ttgctttcat?gaatctttgt?aaaatgatgc?taatcagata?540
acatataata?aagcataaaa?aagctattta?aacaaactgc?atgctctcta?ctctgctatt?600
aaataaaaat?aatttggagc?aaaaaaaaaa?aa 632
The encoding mature acidic antibacterial peptides is a 418-477 position Nucleotide, and its aminoacid sequence is:
Ile?Leu?Gly?Pro?Val?Leu?Gly?Leu?Val?Ser?Asp?Thr?Leu?Asp?Asp?Val
1 5 10 15
Leu?Gly?lle?Leu-AMIDATION
20
The acidic antibacterial peptides gene prepares the application of acidic antibacterial peptides as genetically engineered.
The preparation method of acidic antibacterial peptides: infer according to the gene of coding acidic antibacterial peptides and the aminoacid sequence of acidic antibacterial peptides to synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.Identify its purity with the HPLC method then, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fast atombombardment mass spectrometry, FAB-MS), isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Acidic antibacterial peptides is as the application of preparation antimicrobial drug.
Beneficial effect of the present invention is:
By Bombina maxima antibacterial peptide encoding gene derivation structure, the synthetic acidic antibacterial peptides has the effect of significant bacteria growing inhibiting.Compare with other alkaline antimicrobial polypeptides of originating, that this acidic antibacterial peptides has is simple in structure, synthetic convenient, the beneficial features of specific antibiotic pedigree.
Description of drawings:
Fig. 1 is an acidic antibacterial peptides gene nucleotide series of the present invention.
Fig. 2 is the ripe acidic antibacterial peptides aminoacid sequence of the present invention.
Embodiment:
Embodiment one:
1, the acidic antibacterial peptides gene clone:
1), the total RNA of Bombina maxima skin extracts: live body Bombina maxima water cleans up, and puts into the liquid nitrogen quick-frozen 4 hours, get skin histology, weigh, get the 300mg skin histology, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer, add equal-volume phenol/chloroformic solution,, violent mixing, room temperature was placed 10 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm, the reject precipitation, supernatant adds isopyknic Virahol, room temperature was placed 10 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dry, pipe end throw out is the total RNA of Bombina maxima skin.
2), the purifying of Bombina maxima skin mRNA: the mRNA separation and purification test kit that adopts U.S. PROMEGA company.Get the total RNA500 μ of Bombina maxima skin g and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.The washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.A liquid is added in the B liquid, and room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the Bombina maxima skin mRNA of purifying in the supernatant.Add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume primary isoamyl alcohol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.
3), Bombina maxima skin cDNA library construction: adopt the SuperScript of U.S. GIBCOBRL company
TMThe Construction of Plasmid cDNA Library test kit, but the method operation has improvement.CDNA first chain synthesizes (mRNA reverse transcription), in the 1.5ml test tube, add 2 μ l NotI primers and 7 μ lmRNA, 3 μ l DEPC water, 70 ℃ are incubated 10 minutes, put into the ice bath cooling immediately, add the synthetic damping fluid of 4 μ l 5X, first chain then, 2 μ l 0.1MDTT, 1 μ l 10mM dNTP mixture is adding 1 μ l SuperScript II ThermoScript II, puts into ice bath in 37 ℃ of insulations after 1 hour.CDNA second chain is synthetic, in the synthetic test tube of first chain, add: 95 μ l DEPC water, 30 μ l 5X, second chain synthesizes damping fluid, 3 μ l 10mM dNTP mixtures, 1 μ l e. coli dna ligase, 4 μ l e. coli dna polymerase I, 1 μ l e. coli rna enzyme, reaction cumulative volume 150 μ l are incubated 2 hours in 16 ℃ behind the mixing; Add 2 μ l T4 DNA polymerases and continue insulation 5 minutes.The extracting of DNA and ethanol sedimentation, add equal-volume phenol/chloroform/primary isoamyl alcohol (25/24/1) mixture extracting, centrifugal 5 minutes of 12000rpm, get 140 μ l upper solution and transfer in the clean tube, add 70 μ l 7.5M ammonium acetates, the 0.5ml dehydrated alcohol, centrifugal 20 minutes of 12000rpm, abandon supernatant, precipitation is washed once with 75% ethanol, dries.The connection of SalI adapter, above-mentioned precipitation are dissolved in the 25 μ lDEPC water, add 10 μ l 5XT4 dna ligase damping fluids, 10 μ l SalI adapter, and 5 μ l T4 dna ligases, reaction cumulative volume 50 μ l were in 16 ℃ of insulations 16 hours.Repeat extracting and the ethanol sedimentation process of above-mentioned DNA, resolution of precipitate is in 41 μ lDEPC water.Not I enzymic hydrolysis adds 5 μ l React, 3 damping fluids in cDNA solution, 4 μ l Not I enzymes, and reaction volume 50 μ l were in 37 ℃ of insulations 2 hours.Repeat extracting and the ethanol sedimentation process of above-mentioned DNA, resolution of precipitate is in 100 μ lTEN damping fluids.After the cDNA sample crossed DNA fractional separation post (test kit contains), remove cDNA less than 300bp Nucleotide.CDNA merges greater than the component of 300bp Nucleotide, and volume is 200 μ l, adds 5ml yeast tRNA, 100 μ l 7.5M ammonium acetates, 0.6ml dehydrated alcohol, centrifugal 20 minutes of 12000rpm abandons supernatant, precipitation is washed once with 75% ethanol, dries, and precipitation is dissolved in the 20 μ l TEN damping fluids.Synthetic cDNA is connected to pSPORT 1 plasmid, get 10 μ l and be dissolved in cDNA in the TEN damping fluid, add 4 μ l5XT4 dna ligase damping fluids, 1 μ l pSPORT1 plasmid (Not I-Sal enzymic hydrolysis, 50ng), 4 μ lDEPC water, 1 μ l T4 dna ligase, reaction volume 20 μ l, room temperature 3 hours can be prepared transformed into escherichia coli HB101 competent cell.The preparation of competent cell, the single HB101 bacterium colony of picking is inoculated in 3ml and does not contain in the LB substratum of penbritin 37 ℃ of overnight incubation, get above-mentioned bacterium liquid next day is inoculated in proportion at 1: 100, in the 50ml LB nutrient solution, 37 ℃ vibrated 2 hours, and treated that bacterium liquid 540nm OD value is at 0.4 o'clock, 4 ℃, centrifugal 8 minutes of 2000rpm abandons supernatant, precipitation 0.1M CaCl
2Suspend, 2000rpm is centrifugal 8 minutes again, abandons supernatant, and precipitation is with an amount of 0.1M CaCl
2Resuspended, standby in the rearmounted ice bath of packing.Connect the conversion of product: get above-mentioned connection product 5 μ l and added 100 μ l competent cell ice baths 60 minutes, 42 ℃ of heat-shockeds 60 seconds, put ice bath again 5 minutes, the SOC substratum 0.9ml that adds no penbritin, cultivated 1 hour for 37 ℃, get 200 μ l and coat the LB plate (15cm diameter) that contains penbritin, cultivated 16 hours for 37 ℃, each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 10% glycerine.The cDNA that makes up approximately contains 4 * 10
4Individual independent clone.
4), acidic antibacterial peptides gene clone screening: utilize PCR sieve method screening Bombina maxima negatively charged ion antibacterial peptide gene, used forward primer P1, length is 18 Nucleotide, its sequence is 5 ' AGTATCGGNGCNAAAATC3 ', wherein N=A, C, G, T; Be positioned at clone's insertion portion 3 ' the carrier S P6 promoter primer of end, its sequence are 5 ' CATACGATTTAGGTGACACTATAG3 '.PGR reaction is carried out under the following conditions: 94 ℃ 1 minute, 45 ℃ of 1 minute and 72 ℃ 1 minute, 30 circulations.The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (about 5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), go up by 8 * 8 matrix bed boards (totally 64 holes at 96 well culture plates (Costar), every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
5), acidic antibacterial peptides gene sequencing and result: extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument automatically to examine former times acid sequence determinator as U.S. Applied Biosystems373A, sequencing primer is SP6 and T7 promotor, SP6 promoter sequence: 5 ' CATACGATTTAGGTGACACTATAG3 ', T7 promoter sequence: 5 ' TAATACGACTCACTATAGGGA3 '.Gene sequencing result ' holds to 3 ' end (see figure 1) from 5.The sequence table of Bombina maxima acidic antibacterial peptides gene nucleotide shown in Figure 1 is: sequence length, 632 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: Bombina maxima skin.The encoding mature acidic antibacterial peptides is a 418-477 position Nucleotide, and its aminoacid sequence is seen Fig. 2.
The acidic antibacterial peptides gene prepares the application of acidic antibacterial peptides as genetically engineered.
Embodiment two:
1, the preparation acidic antibacterial peptides:
The preparation method of acidic antibacterial peptides: infer according to the gene of coding Bombina maxima antibacterial peptide and the aminoacid sequence of acidic antibacterial peptides to synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
2, molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and (Fast atom bombardment massspectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is a substrate, Cs
+As projectile, electric current is 1 μ A, and emission voltage is 25Kv.
3, the acidic antibacterial peptides of purifying is identified its purity with the high-efficient liquid phase chromatogram HPLC method, and molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Acidic antibacterial peptides, it is a kind of single chain polypeptide of Chinese amphibian animal Bombina maxima antibacterial peptide gene coding, molecular weight 2021.4, iso-electric point 4.8, polypeptide amino acid complete sequence primary structure is: Isoleucine-leucine-glycine-proline(Pro)-Val-Leu-glycine-LEU-VAL-Serine-aspartic acid-Threonine-leucine-aspartic acid-aspartic acid-Val-Leu-glycine-Isoleucine-amidation leucine (Ile Leu Gly Pro Val Leu Gly Leu Val Ser Asp ThrLeu Asp Asp Val Leu Gly Ile Leu-AMIDATION).
Embodiment three:
The effect of acidic antibacterial peptides bacteria growing inhibiting:
Anti-microbial activity detects, and adopts cylinder plate method, and substratum is the plain agar substratum.The substratum 20ml that injects heating and melting respectively as bottom, makes its even stand cloth at the bottom of the ware, after solidifying in plate, after other gets an amount of heating and melting of substratum, in every ware, add the 5ml bacteria suspension respectively, shake up, make it on bottom, evenly spread out cloth, as the bacterium layer.After the cooling, evenly put into 6 of disinfectant stainless steel cups in the plate moderate distance.First steel bowl adds the testing compound solution 0.1ml of 0.1-0.3mg/ml concentration, and all the other steel bowls adopt doubling dilution to add sample liquid, and the inhibition zone size is observed in 37 ℃ of cultivations.Inhibition zone 10mm above as minimal inhibitory concentration (minimal inhibitory concentration, MIC).Bacterial isolates derives from No.1 Hospital Attached to Kunming Medical College, and this test repeats four times, averages result such as table 1.
Table 1, the effect of acidic antibacterial peptides bacteria growing inhibiting:
Bacterial strain
Minimal inhibitory concentration (μ g/ml)
Acidic antibacterial peptides
Streptococcus aureus ATCC2592 100
(Staphylococcus?auneus?ATCC2592)
Pasteur hemolytic bacteria 50
(Pasteurella?haemolytica)
By table 1 as seen, the synthetic acidic antibacterial peptides has the effect of significant bacteria growing inhibiting, controls application in the infected by microbes disease medicament as antimicrobial material in preparation.
The specification sheets sequence table
＜110〉Kunming Institute of Zoology, Chinese Academy of Sciences
＜120〉acidic antibacterial peptides and gene thereof and the application in pharmacy
<160>3
<210>1
<211>632
<212>DNA
＜213〉Bombina maxima (Bombina maxima)
<220>
<221>CDS
<222>(49)...(483)
<400>1
atcaagatat?ctgatagcat?ataacaatat?cctgagatcc?tggtaaag?atg?aat?ttt?57
Met?Asn?Phe
1
aag?tac?ata?ttt?gca?gtg?tcc?ttt?tta?ata?gca?tct?gca?tat?gca?cga?105
Lys?Tyr?Ile?Phe?Ala?Val?Ser?Phe?Leu?Ile?Ala?Ser?Ala?Tyr?Ala?Arg
5 10 15
agt?gta?cag?aat?gat?gaa?cag?tct?ctg?agt?cag?agg?gat?gtt?tta?gaa?153
Ser?Val?Gln?Asn?Asp?Glu?Gln?Ser?Leu?Ser?Gln?Arg?Asp?Val?Leu?Glu
20 25 30 35
gaa?gaa?tca?ctg?agg?gaa?atc?aga?ggt?ata?gga?gga?aaa?atc?cta?tct?201
Glu?Glu?Ser?Leu?Arg?Glu?Ile?Arg?Gly?Ile?Gly?Gly?Lys?Ile?Leu?Ser
40 45 50
ggt?ctt?aaa?aca?gct?tta?aaa?ggt?gca?gcc?aaa?gag?ttg?gct?tct?acg?249
Gly?Leu?Lys?Thr?Ala?Leu?Lys?Gly?Ala?Ala?Lys?Glu?Leu?Ala?Ser?Thr
55 60 65
tat?ctg?cat?agg?aag?aga?aca?gct?gaa?gaa?cac?gaa?gaa?atg?aaa?aga?297
Tyr?Leu?His?Arg?Lys?Arg?Thr?Ala?Glu?Glu?His?Glu?Glu?Met?Lys?Arg
70 75 80
ctg?gaa?gcc?gta?atg?cgt?gat?cta?gat?tcc?ttg?gat?tat?cca?gag?gaa?345
Leu?Glu?Ala?Val?Met?Arg?Asp?Leu?Asp?Ser?Leu?Asp?Tyr?Pro?Glu?Glu
85 90 95
gct?tct?gaa?agg?gaa?acc?aga?ggc?ttc?aat?caa?gac?gag?att?gct?aat?393
Ala?Ser?Glu?Arg?Glu?Thr?Arg?Gly?Phe?Asn?Gln?Asp?Glu?Ile?Ala?Asn
100 105 110 115
ctt?ttt?act?aaa?aaa?gag?aaa?cgc?att?ttg?ggg?cca?gta?cta?ggt?ttg?441
Leu?Phe?Thr?Lys?Lys?Glu?Lys?Arg?Ile?Leu?Gly?Pro?Val?Leu?Gly?Leu
120 125 130
gtt?agt?gat?aca?ctt?gac?gat?gta?ctt?gga?att?ctt?gga?taa 483
Val?Ser?Asp?Thr?Leu?Asp?Asp?Val?Leu?Gly?Ile?Leu?Gly?*
135 140
ttataaccag?taaaactttg?ctttcatgaa?tctttgtaaa?atgatgctaa?tcagataaca?543
tataataaag?cataaaaaag?ctatttaaac?aaactgcatg?ctctctactc?tgctattaaa?603
taaaaataat?ttggagcaaa?aaaaaaaaa 632
<210>2
<211>144
<212>PRT
＜213〉Bombina maxima (Bombina maxima)
<220>
<221>PEPTIDE
<222>(124)...(143)
<400>2
Met?Asn?Phe?Lys?Tyr?Ile?Phe?Ala?Val?Ser?Phe?Leu?Ile?Ala?Ser?Ala
1 5 10 15
Tyr?Ala?Arg?Ser?Val?Gln?Asn?Asp?Glu?Gln?Ser?Leu?Ser?Gln?Arg?Asp
20 25 30
Val?Leu?Glu?Glu?Glu?Ser?Leu?Arg?Glu?Ile?Arg?Gly?Ile?Gly?Gly?Lys
35 40 45
Ile?Leu?Ser?Gly?Leu?Lys?Thr?Ala?Leu?Lys?Gly?Ala?Ala?Lys?Glu?Leu
50 55 60
Ala?Ser?Thr?Tyr?Leu?His?Arg?Lys?Arg?Thr?Ala?Glu?Glu?His?Glu?Glu
65 70 75 80
Met?Lys?Arg?Leu?Glu?Ala?Val?Met?Arg?Asp?Leu?Asp?Ser?Leu?Asp?Tyr
85 90 95
Pro?Glu?Glu?Ala?Ser?Glu?Arg?Glu?Thr?Arg?Gly?Phe?Asn?Gln?Asp?Glu
100 105 110
Ile?Ala?Asn?Leu?Phe?Thr?Lys?Lys?Glu?Lys?Arg?Ile?Leu?Gly?Pro?Val
115 120 125
Leu?Gly?Leu?Val?Ser?Asp?Thr?Leu?Asp?Asp?Val?Leu?Gly?Ile?Leu?Gly
130 135 140
<210>3
<211>20
<212>PRT
＜213〉Bombina maxima (Bombina maxima)
<220>
<221>AMIDATION
<222>(20)
<400>3
Ile?Leu?Gly?Pro?Val?Leu?Gly?Leu?Val?Ser?Asp?Thr?Leu?Asp?Asp?Val
1 5 10 15
Leu?Gly?Ile?Leu-AMIDATION
20
Claims (2)
1, acidic antibacterial peptides, it is characterized in that a kind of single chain polypeptide, molecular weight 2021.4, iso-electric point 4.8, polypeptide amino acid complete sequence primary structure is: Isoleucine-leucine-glycine-proline(Pro)-Val-Leu-glycine-LEU-VAL-Serine-aspartic acid-Threonine-leucine-aspartic acid-aspartic acid-Val-Leu-glycine-Isoleucine-amidation leucine.
2, the application of the described acidic antibacterial peptides of claim 1 in the preparation antibacterials.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02113515 CN1238377C (en) | 2002-03-25 | 2002-03-25 | Acidic antibacterial peptides and gene as well as its application in pharmacy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 02113515 CN1238377C (en) | 2002-03-25 | 2002-03-25 | Acidic antibacterial peptides and gene as well as its application in pharmacy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1446822A CN1446822A (en) | 2003-10-08 |
| CN1238377C true CN1238377C (en) | 2006-01-25 |
Family
ID=28048586
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 02113515 Expired - Fee Related CN1238377C (en) | 2002-03-25 | 2002-03-25 | Acidic antibacterial peptides and gene as well as its application in pharmacy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1238377C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100372869C (en) * | 2006-04-18 | 2008-03-05 | 河北师范大学 | Antimicrobial polypeptide from Amolops loloensis and its pharmaceutical use |
| CN105837674A (en) * | 2016-03-08 | 2016-08-10 | 无限极（中国）有限公司 | Bombina orientalis polypeptide, and preparation method and application thereof |
-
2002
- 2002-03-25 CN CN 02113515 patent/CN1238377C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1446822A (en) | 2003-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107109373B (en) | Novel bacteriophage and composition comprising the same | |
| KR20080081062A (en) | Cyclic antimicrobial peptides | |
| CN113430174B (en) | High-lytic salmonella bacteriophage RDP-SA-19009 and application thereof | |
| CN100351270C (en) | Antibacterial peptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| JPH0695939B2 (en) | Cloned DNA coding for rabbit cancer necrosis factor | |
| CN1246126A (en) | Antimicrobially active polypeptides | |
| CN1238377C (en) | Acidic antibacterial peptides and gene as well as its application in pharmacy | |
| US7351693B2 (en) | Peptides and nucleic acids of the cathelicidin family, derived from fish, and uses thereof | |
| CN100345865C (en) | Antibiotic dipeptide and its chemical modifier, its preparation method and uses | |
| CN1294258C (en) | Method for separating antibiotic peptide and separated antibiotic peptide | |
| CN100351271C (en) | Active polypeptide of brown-spotted torrential frog, its gene and application in drug preparation | |
| CN1760203A (en) | Antibacterial tripeptides and modified chemicals, and application | |
| KR101121077B1 (en) | Novel genes encoding defensin of olive flounder and uses thereof | |
| CN1170845C (en) | Giant-web bombinator antineoplastic protein and its prepn and gene | |
| CN1883703A (en) | Serine protease inhibitor of Rana grahami, its gene and application | |
| CN1170847C (en) | Giant-web bombinator antimicrobial peptide and its prepn and gene | |
| CN1381587A (en) | Antibacterial peptide gene of Chinese prawn and its colon technique | |
| CN106432459B (en) | Antibacterial peptide of hypsizigus marmoreus, gene thereof and application thereof in pharmacy | |
| CN1244584A (en) | Chemotarix factor with immunocyte chemotaxis and hemopoinesis stimulating activity | |
| CN1810830A (en) | HIV-1 yesisting polypeptide C22, its coding sequence and prepn process | |
| CN1740320A (en) | Fenneropenaeus chinensis Anti-LPS factor gene and cloning process thereof | |
| CN1632120A (en) | Hepcidin antibiotic peptide gene of weever cultured in sea water | |
| CN101012275A (en) | Rana grahami skin peptide, gene thereof and application in pharmacy | |
| CN1194988C (en) | Killer cell antibiosis polypeptide activated by lymphokine and its application | |
| CN1446823A (en) | Overreationg factor as well as its preparation factor and gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |