KR101121077B1 - Novel genes encoding defensin of olive flounder and uses thereof - Google Patents

Abstract

The present invention relates to a novel gene encoding beta-defensin (β-defensin), an antimicrobial peptide derived from olive flounder, Paralichthys olivaceus , and the use thereof, and specifically, a cDNA library for each stage of development of the flounder. The present invention relates to a gene encoding beta defensin, a novel antimicrobial peptide prepared and isolated, and a recombinant protein having antimicrobial activity produced using the gene. Betadifensine, a novel peptide of the present invention, has an important function in the immune response of the olive flounder, and has high antibacterial activity in recombinant betadefensins, and thus may be usefully used for natural antibiotic development.

Description

Novel genes encoding β-defensin of olive flounder and uses about the antibacterial peptide derived from olive flounder.

The present invention relates to a beta-defensin (β-defensin), an antimicrobial peptide derived from the flounder, a gene encoding the same, a recombinant vector comprising the gene, and a recombinant protein having antibacterial activity prepared using the recombinant vector. .

Antimicrobial peptides are the foremost biological defenses of the organism's innate immune system. Antibacterial peptides, unlike acquired immunity, which respond to specific microorganisms or antigens, work very much regardless of the type of microorganism, and the reaction time is very fast or within a few hours. These antimicrobial peptides are called natural antibiotics because they are naturally produced to protect the host from microorganisms in a wide range of biological systems, apart from conventional antibiotics, which always contain the problem of resistant bacteria.

Antimicrobial peptides are primarily based on the homology between the secondary structure and the amino acid sequence, such as alpha-helix structure, cysteine-rich beta-sheet structure, prolin or glycine ( It is classified into three structures with high content of glycine residues, and most of them are bipolar having both hydrophilicity and hydrophobicity, and it is known that cationic hydrophilic sites bind to and dissolve the cell membrane of anionic pathogenic microorganisms. have. Among these, beta defensin (β-defensin) has a high molecular weight of about 4 to 5 kD among natural antibiotics, and has been studied at the center of therapeutic development in mammals.

Defensin has six disulfide bonds (SS) bonds in the molecule, but in the case of alpha defensin, SS bonds are between 1-6, 2-4 and 3-5. In contrast, beta defensin has SS bonds between 1-5, 2-4, and 3-6, and is composed of 41-50 amino acid residues that are slightly longer than alpha defensins. Compared to HNP1-4, a human alpha-defensin released in the 1980s more than 20 years ago, beta-defensin HBD-1 was first isolated from human serum in 1995 and 11 have been identified biochemically. In addition, the completion of the Human Genome Project identified 28 human betadefensins and 43 mouse betadefensins. Fish have been reported in zebra fish ( Danio rerio ), blowfish (Fugu, Takifugu rubripes ), green puffer fish (tetraodron, Tetraodon nigroviridis ), and rainbow trout (rainbow trout, Oncorhynchus mykiss ). It became.

Therefore, the present inventors isolated beta-defensin I (fBDI) having at least five subtypes from the flounder, it was confirmed that the expression at all times in the early stage of the development of the flounder from 1 to 35 days after hatching, pathogens in the fry ( E. tarda ) It was confirmed at the messenger RNA level that expression was induced only in the kidney by infection, and unlike the known cationic betadefensins, the beta-defensin I of olive flounder was 4.1 in the active form (mature form). It was confirmed that the new form of anionic phosphorus, and completed the present invention by confirming the excellent antimicrobial activity.

An object of the present invention is a beta-defensin peptide derived from the flounder ( Paralichthys olivaceus ), a gene encoding the same, genomic DNA including a promoter region, a recombinant expression vector capable of producing the peptide, an antibiotic containing the peptide And to provide a feed additive containing the peptide.

In order to achieve the above object, the present invention provides a polypeptide of any of the following a) to e) or a variant thereof, or an active fragment thereof:

a) a polypeptide encoded by a cDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

b) a polypeptide encoded by a polynucleotide hybridized under stringent conditions with a cDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

c) a polypeptide encoded by gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10;

d) a polypeptide encoded by a polynucleotide hybridized under stringent conditions with a gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10; And

e) a polypeptide having an amino acid sequence of any of the amino acid sequences set forth in SEQ ID NOs: 11-15.

The present invention also provides a polynucleotide of any one of the following a) to d) encoding the polypeptide or variant thereof, or an active fragment thereof:

a) a cDNA having the nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1 to 5;

b) a polynucleotide hybridized under stringent conditions with a cDNA having any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

c) gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10; And

d) a polynucleotide hybridized under stringent conditions with a gDNA having the nucleic acid sequence of any one of the nucleic acids set forth in SEQ ID NOs: 6-10.

The present invention also provides a recombinant expression vector comprising the polynucleotide.

The present invention also provides a transformant in which the recombinant expression vector is transformed into a host cell.

The present invention also provides a method for producing a recombinant protein or variant thereof having antimicrobial activity prepared from the transformant.

The present invention also provides an antibiotic containing the polypeptide or variant thereof, or an active fragment thereof as an active ingredient.

In addition, the present invention provides a feed additive containing the polypeptide or a variant thereof, or an active fragment thereof as an active ingredient.

The present invention isolated beta-defensin (β-defensin), a novel peptide from the cDNA library by the stage of development of the flounder, useful for the development of antibiotics or antimicrobial feed additives by confirming that the peptide has anionic properties and high antimicrobial activity. Can be used.

Hereinafter, the present invention will be described in detail.

The present invention provides a beta-defensin peptide or a variant thereof, or an active fragment thereof having a novel antibacterial activity from the flounder ( Paralichthys olivaceus ).

Specifically, the present invention provides

It has an antimicrobial activity and provides a polypeptide of any of the following a) to e) or a variant thereof, or an active fragment thereof:

a) a polypeptide encoded by a cDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

b) a polypeptide encoded by a polynucleotide hybridized under stringent conditions with a cDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

c) a polypeptide encoded by gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10;

d) a polypeptide encoded by a polynucleotide hybridized under stringent conditions with a gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10; And

e) a polypeptide having an amino acid sequence of any of the amino acid sequences set forth in SEQ ID NOs: 11-15.

The polypeptide or variant thereof, or an active fragment thereof is preferably derived from halibut ( Paralichthys olivaceus , P. olivaceus ), but is not limited thereto.

The variant preferably has at least 80% homology to the amino acid sequence of the polypeptide of the present invention, and more preferably at least 90% homology, but is not limited thereto.

The polypeptide or a variant thereof is preferably induced at all times in the early stages of flounder development, but is not limited thereto.

The polypeptide or variant thereof has a molecular weight of about 3 to 4 kDa in an activated form, preferably anionic having an isoelectric point (pI) of about 4 to 5, but is not limited thereto.

The polypeptide or variant thereof, or active fragment thereof has antimicrobial activity, in particular, it is preferred to have excellent antimicrobial activity against E. coli , but is not limited thereto.

The present invention also provides a polynucleotide of any one of the following a) to d) encoding the polypeptide or variant thereof, or an active fragment thereof:

a) a cDNA having the nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1 to 5;

b) a polynucleotide hybridized under stringent conditions with a cDNA having any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-5;

c) gDNA having a nucleic acid sequence of any one of the nucleic acid sequences set forth in SEQ ID NOs: 6-10; And

d) a polynucleotide hybridized under stringent conditions with a gDNA having the nucleic acid sequence of any one of the nucleic acids set forth in SEQ ID NOs: 6-10.

The polynucleotide is preferably derived from halibut ( Paralichthys olivaceus , P. olivaceus ), but is not limited thereto.

In order to isolate the novel peptides from the flounder, we obtained each flounder larvae ( P. olivaceus larvae) at the developmental stages 1, 3, 7, 14, 21, 28 and 35 days after hatching from the flounder's eggs. After preparing the cDNA library, the cDNA was sequenced. As a result, six clones (FLDS-4-F10, FLDS-4-) containing cDNA sequences homologous to beta-defensin-1 (β-defensin-1) ( O. mykiss ; GenBank accession no. ABR68250) F11, FLDS-4-C12, FLDS-9-13-E02, FLDS-10-72-H09, and FLDS-14-46-F06). FLDS-14-46-F06 had a length of 408 bp (including a 5 'untranslated site [UTR] of 33-bp, an ORF of 204-bp, and a 3' UTR of 171-bp), which was called 'fBDI'. -1 '. FLDS-10-72-H09 had the same open reading frame (ORF) as FLDS-14-46-F06. FLDS-4-F11 had a length of 411 bp (28-bp 5 'UTR, 204-bp ORF, and 179-bp 3' UTR), designated as 'fBDI-2'. FLDS-9-13-E02 had a length of 397 bp (25-bp 5 'UTR, 219-bp ORF, and 153-bp 3' UTR), designated as 'fBDI-3'. FLDS-4-12 had a length of 442 bp (33-bp 5 'UTR, 234-bp ORF, and 175-bp 3' UTR), designated as 'fBDI-4'. FLDS-4-F10 had a length of 460 bp (33-bp 5 'UTR, 234-bp ORF, and 183-bp 3' UTR), designated as 'fBDI-5'. Except for the cDNA of fBDI-4, all cDNA signal peptides and mature defensin peptides had nearly identical sequences (see FIG. 1).

Thus, it can be seen that the peptides are novel peptides derived from flounder (fBDI-1, -2, -3, -4 and -5), and they are beta-defensin-1 (β-defensin-1) like proteins. have.

In addition, we compared amino acid sequences between fBDI and previously known betafensin. As a result, the length of the propis portion of the fBDI propeptide was 5 to 15 amino acid residues. The propis region had an isoelectric point (pI) of 4.55 and 4.94, respectively, of fBDI-1 and -2 having 5 amino acid residues, and the fBDI-3 having 10 amino acid residues of the propis site had an isoelectric point of 4.98, FBDI-4 and -5, whose propis sites had 15 amino acid residues, had isoelectric points of 6.26 and 7.56, respectively (see Figure 2). The molecular weight of mature fBDI was 3.83 kDa and its isoelectric point was 4.1.

Therefore, it can be seen that the novel peptides (fBDI-1, -2, -3, -4 and -5) of the present invention have anionic properties unlike the existing betadefensins.

In addition, the inventors prepared a BAC library and performed Southern blotting analysis to analyze the genomic structure of fBDIs. As a result, all fBDIs had the same genetic structure within the coding regions of three exons and two introns, and were 650 bp (fBDI-3) and 667 bp (fBDI-4) in length. . The signal peptide was located at the first exon. C1, C2, C3 and C4 were located in the second exon and C5 and C6 were located in the third exon (see FIG. 3).

In addition, we analyzed the upstream sequence of the 5 ′ flanking region of the transcription initiation site of fBDI-4 for more specific genomic analysis of fBDI. As a result, the upstream of the 5 'flanking site exhibited a potential cis- acting element, three binding sites for myocyte-specific enhancer factor-2 (MEF-2), CBF (CCAAT- 1 site each for binding factor (IRF) and interferon regulatory factor (IRF), interleukin-6 responsive element-binding protein (IL-6 RE-BP), stimulating protein-1 (Sp-1), and lymphocyte (LEF-1) One site for -enhancer factor-1) and NF-AT (nuclear factor of activated T-cells) was included (see FIG. 4).

In addition, the inventors performed RT-PCR to analyze the transcription pattern of fBDI at various stages of flounder. As a result, fBDI mRNA was expressed on day 1 after hatching and continued to decrease during the observation period. In addition, fBDI mRNA was observed after immunostimulation with E. tarda to determine the induction of the fBDI mRNA by immunostimulation. As a result, induction began 1 hour after the administration of the pathogen, reached a maximum at 3 hours after administration, and gradually decreased after 6 hours after administration (see FIG. 5).

Therefore, the novel peptides of the present invention (fBDI-1, -2, -3, -4 and -5) are constantly expressed in the early stage of flounder development, and in the juvenile, expression is induced only in the kidney by pathogen infection. It can be seen that.

In addition, to prepare a recombinant fBDI protein, the present inventors first prepare pET32a-smfBDI in which a DNA fragment containing a mature fBDI gene is inserted into a pET32a plasmid, and then transform it into Escherichia coli strain BL21 (DE3) to transform it. Sieve was prepared. Then, the recombinant was cultured to express the recombinant fBDI protein, and then the recombinant fBDI protein was purified using chromatography to prepare a recombinant fBDI protein.

In addition, the present inventors evaluated by using agar disc diffusion assay and liquid bacteria killing assays to determine whether the prepared recombinant fBDI protein has antibacterial activity. As a result, the recombinant fBDI protein showed high antimicrobial activity and significantly inhibited the growth of E. coli (see FIG. 6).

Therefore, it can be seen that the novel peptides (fBDI-1, -2, -3, -4 and -5) of the present invention have antimicrobial activity.

The present invention also provides a recombinant expression vector comprising the polynucleotide of the present invention.

The present invention also provides a transformant in which the recombinant expression vector of the present invention is transformed into a host cell.

The expression vector is preferably one using a pET32a plasmid, but is not limited thereto.

The host cell preferably uses Escherichia coli strain BL21 (DE3), but is not limited thereto.

The present invention also provides a method for producing a recombinant protein or variant thereof having antimicrobial activity prepared from the transformant of the present invention.

Specifically, the method is preferably produced by a method including the following steps, but is not limited thereto.

1) preparing a recombinant expression vector by inserting a polynucleotide encoding a polypeptide of the present invention or a variant thereof, or an active fragment thereof into an expression vector:

2) preparing a transformant by transforming the recombinant expression vector into a host cell; And

3) culturing the transformant to express and purify the recombinant polypeptide.

The present inventors prepared pET32a-smfBDI in which a DNA fragment containing a mature fBDI (smfBDI) gene was inserted into a pET32a plasmid, and then transformed into Escherichia coli strain BL21 (DE3) to prepare a transformant. The recombinant fBDI protein was expressed and purified from the sieve.

The present invention also provides an antibiotic containing the polypeptide of the present invention or a variant thereof, or an active fragment thereof as an active ingredient.

The novel antimicrobial peptides of the present invention have an important function in the immune response of the olive flounder and have high antimicrobial activity in recombinant proteins, so it can be seen that they can be usefully used as an active ingredient of natural antibiotics.

The antibiotics of the present invention can be administered parenterally during clinical administration and can be used in the form of general pharmaceutical preparations.

When using the antimicrobial peptide of the present invention as a medicine, it may further contain one or more active ingredients exhibiting the same or similar functions.

That is, the antimicrobial peptide of the present invention can be administered in various parenteral formulations, and when formulated, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc. that are commonly used. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As a suppository base, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

In addition, the antibiotic peptide of the present invention can be used in admixture with a number of carriers (pharmaceutically acceptable) such as physiological saline or organic solvent, carbohydrates such as glucose, sucrose or dextran, to increase the stability or absorption Antioxidants such as ascorbic acid or glutathione, chelating agents, small molecule proteins or other stabilizers can be used as medicaments.

The present invention also provides a method for treating pathogenic bacterial diseases comprising administering a pharmaceutically effective amount of the antibiotic to an individual suffering from pathogenic bacterial diseases.

The present invention also provides a method for preventing pathogenic bacterial diseases comprising administering to the individual a pharmaceutically effective amount of the antibiotic.

The antibiotic may be administered parenterally and may be used in the form of a general pharmaceutical preparation.

The dosage of the antibiotic is 1 to 2 mg / kg, preferably 0.5 to 1 mg / kg, based on the amount of antibiotic peptide, and may be administered 1 to 3 times a day.

The effective dose of the antibiotic may be administered to the patient in a single dose by bolus form or by infusion for a relatively short period of time, where multiple doses are administered for a long time. Administration by a fractionated treatment protocol.

The concentration of the antibiotic is determined by taking into consideration the various factors such as the age and health of the patient as well as the route and frequency of treatment of the drug, so in view of this, those skilled in the art Appropriate effective dosages for the particular use of the peptides of the invention as pharmaceutical compositions may be determined.

In addition, the present invention provides a feed additive containing the polypeptide of the present invention or a variant thereof, or an active fragment thereof as an active ingredient.

The novel antimicrobial peptide of the present invention has an important function in the immune response of the olive flounder and has a high antimicrobial activity in the recombinant protein, it can be seen that it can be usefully used as an active ingredient of feed additives.

Feed additives of the present invention may comprise components of common feed additives known in the art, in addition to the antimicrobial polypeptides of the present invention or variants thereof, or active fragments thereof. For example, it may include grain flour, sugars, vitamins, amino acids, proteins, lipids, minerals and the like.

The feed additive of the present invention may additionally add any pharmaceutical ingredient known in the art, and may include artificial chemicals such as antibiotics, probiotics, sweeteners, antacids, anti-diabetic agents and the like. In addition, the feed additive of the present invention may add shellfish as a calcium source, and a small amount of crab shell, turban shell and the like as mineral sources of iron, manganese, copper, zinc and molybdenum.

Hereinafter, the present invention will be described in detail by way of examples.

only. The following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1 Preparation of Flounder

The inventors of P. olivaceus larvae from eggs of brood stock at the Genetic and Breeding Research Center (GBRC) of the National Fisheries Research & Development Institute (NFRDI) in Korea. Obtained. The larvae were obtained at development stages of 1, 3, 7, 14, 21, 28 and 35 dph (day post-hatch), respectively. The larvae were ingested Brachionus plicatilis on days 3-10, and on days 11-14, rotifer and Artemia nauplii were ingested 15 days. Artemia naupli alone was ingested on ˜19 days, Artemia naupli and commercial diets were taken on days 20-28, and only commercial diets were taken on day 29. 5 g of larval samples collected at each time were washed twice with phosphate-buffered saline (PBS), frozen in liquid nitrogen and kept at -80 ° C until use.

Example 2 Cloning of fBDI cDNA

<2-1> cDNA library preparation

We extracted total RNA from each sample using Trizol reagent according to the manufacturer's protocol (Invitrogen). MRNA was purified from the total RNA according to the manufacturer's protocol (Promega). MRNA using 1 μg pooled samples derived from 1, 3, 7, 14, 21, 28, and 35 dph flounder using ZAP cDNA Synthesis Kit and ZAP-cDNA GigapackIII Gold Cloning Kit (Stratagene) CDNA libraries were prepared from the mixture. Randomly selected cDNA clones were sequenced using T3 primers with ABI Prism 3130XL Genetic Analyzer and ABI sequencing software.

<2-2> EST analysis

For further cloning of the flounder-derived fBDI genes, their BLAST analyzes were performed using randomly selected ESTs from the cDNA library at the early stage of development of the flounder. In addition, for bioinformatics analysis, after performing multiple alignments with ClustalX (Thompson JD, et al., Nucleic Acids Res 1997; 24: 4876-82), GENETYX version 8.0 (SDC Software Development, Japan). Purified using). Predictive signal peptides were predicted using SignalP 3.0 Server ( http://www.cbs.dtu.dk/services/SignalP/ ). The putative cis- element was searched using the Transcription Element Search System (TESS) program ( http://www.cbil.upenn.edu/cgi-bin/tess ). As a result, six EST clones (FLDS-) containing homologous cDNA sequences to beta-defensin-1 (β-defensin-1) ( O. mykiss ; GenBank accession no. ABR68250) of rainbow trout. 4-F10, FLDS-4-F11, FLDS-4-C12, FLDS-9-13-E02, FLDS-10-72-H09, and FLDS-14-46-F06) were selected (FIG. 1).

FLDS-14-46-F06 had a length of 408 bp (including a 5 'untranslated site [UTR] of 33-bp, an ORF of 204-bp, and a 3' UTR of 171-bp), which was called 'fBDI'. -1 '. FLDS-10-72-H09 had the same open reading frame (ORF) as FLDS-14-46-F06. FLDS-4-F11 had a length of 411 bp (28-bp 5 'UTR, 204-bp ORF, and 179-bp 3' UTR), designated as 'fBDI-2'. FLDS-9-13-E02 had a length of 397 bp (25-bp 5 'UTR, 219-bp ORF, and 153-bp 3' UTR), designated as 'fBDI-3'. FLDS-4-12 had a length of 442 bp (33-bp 5 'UTR, 234-bp ORF, and 175-bp 3' UTR), designated as 'fBDI-4'. FLDS-4-F10 had a length of 460 bp (33-bp 5 'UTR, 234-bp ORF, and 183-bp 3' UTR), designated as 'fBDI-5'. Except for the cDNA of fBDI-4, all cDNA signal peptides and mature defensin peptides had almost identical sequences, but the length and sequence of the propiece region of the fBDI propeptide varied ( 1).

The length of the propis portion of the fBDI propeptide was shown to be between 5 and 15 amino acid residues. The isoelectric points (pIs) of fBDI-1 and -2 with five amino acid residues in the propiece site were 4.55 and 4.94, respectively. FBDI-3 with a 10-amino acid residue at the propis site had an isoelectric point of 4.98. FBDI-4 and -5, whose propis sites have 15 amino acid residues, had isoelectric points of 6.26 and 7.56, respectively (FIG. 2). The molecular weight of mature fBDI was 3.83 kDa and its isoelectric point was 4.1.

Example 3 Genomic Structure Determination of fBDI

<3-1> BAC Library Screening

The inventors prepared the flounder BAC library by the method as previously reported (Chae SH, et al., Asian-Aust J Anim Sci 2007; 20: 316-27.). Specifically, high molecular weight DNA was first isolated from the sperm of 10 fry supplied by GBRC of NFRDI. Isolated sperm cells were inserted into agarose, digested with proteinase K, and then partially digested with Eco RI. The resulting fragments were ligation into the pCC1BAC vector (Epicentre). The mean insertion size of the genomic fragments was approximately 100 kb. The BAC library of 76,800 clones was estimated to contain approximately 7.6 Gbp, more than 8.6 times the 880 Mb flounder genome (Katagiri T, et al., Mar Biotechnol 2000: 2; 571-6.). To screen the flounder genomic BAC library, BAC DNA pools were prepared according to the BAC pooling protocol (Chae SH, et al., Asian-Aust J Anim Sci 2007; 20: 316-27.). At this time, the oligonucleotide sequences used were as described in Table 1. The BAC library was screened using PCR by the method as previously reported (Chae SH, et al., Asian-Aust J Anim Sci 2007; 20: 316-27.). Among a total of 17 BAC clones containing fBDI fragments, BAC clone 202-M-05 containing the longest fragment was selected.

Types of Oligonucleotide Primers Name of the primer Sequence (5 '→ 3') purpose fBDI-ORF-F ATGTCTCGTTATCGTGTGGCT (SEQ ID NO: 16) BAC Library Screening fBDI-ORF-R TTGGCTGAATTATGGTTTGGT (SEQ ID NO: 17) BAC Library Screening fBDI-RT-F ACGCAGTTTCAGACCCAACA (SEQ ID NO: 18) RT-PCR fBDI-RT-R CGGAACAGCCAAGAGCTCCA (SEQ ID NO: 19) RT-PCR smfBDI-F ^* gggccatgg CTATGTCTTGTTATCGTGTGGCTG (SEQ ID NO: 20) Recombinant Peptide Expression smfBDI-R ^* gggcagctg TTATGGTTTGGTTACGCAACATAC (SEQ ID NO: 21) Recombinant Peptide Expression 18S rRNA-F ATGGCCGTTCTTAGTTCCTG (SEQ ID NO: 22) RT-PCR of Internal Control 18S rRNA-R CCACGCTGATCCAGTCAGT (SEQ ID NO: 23) RT-PCR of Internal Control

smfBDI-F and -R include sites for the restriction enzymes Nco I and Sal I (underlined sites).

<3-2> Genomic Structure Analysis of fBDI

In order to analyze the genomic structure of the fBDIs, the obtained fBDI genomic BAC clone was purified and subjected to Southern blotting analysis. Specifically, about 5 μg of BAC DNA was digested with restriction enzymes Bam HI, Hind III, Pst I, and Sal I, followed by 1.0% agar by pulsed field electrophoresis using CHEF Mapper (BioRad). Separated from rose gel. 20 × SSC using a standard protocol, the solution to the DNA according to (Sambrook J, Russell DW. Molecular Cloning. 3 rd ed. Cold Spring Harbor Press, New York. 2001) was transferred to a Hybond-N + membrane (Amersham). Movement by capillary action of the DNA to standard protocols (Sambrook J, Russell DW. Molecular Cloning. 3 rd ed. Cold Spring Harbor Press, New York. 2001) Hybond-N + membrane (Amersham) with 20 × SSC using a Was performed. The DNA was crosslinked with UV to the membrane, and then hybridized with DIG Easy Hyb hybridization solution (Roche) containing a DNA probe labeled with digoxigenin (DIG) for 42 hours at 12 ° C. The probe was labeled with a PCR DIG Probes Synthesis kit (Roche) using primers specific for the fBDI gene. Washing of the hybridized membrane and detection of the probe were performed according to the manufacturer's instructions using a DIG Detection kit (Roche). As a result, multiple bands of 2.6 kb or less were produced using Hind III and Pst I as shown in FIG. 3A.

Fragments produced by Hind III and Pst I were subcloned into pUC18 / HindIII and pUC18 / PstI, respectively. After subcloning, various colonies, including 2.6 kb / HindIII and 2.6 kb / PstI, were selected and sequenced. Among these, it was confirmed that two positive clones, 202M05Hind-001 and 202M05Pst-010, respectively contain fBDI-3 and fBDI-4 (FIG. 3B).

All fBDIs had the same gene structure in the coding regions of three exons and two introns, and were 650 bp (fBDI-3) and 667 bp (fBDI-4) in length. The signal peptide was located at the first exon. C1, C2, C3 and C4 were located in the second exon and C5 and C6 were located in the last exon. The clone 202M05Hind-001 contains the complete genomic sequence of fBDI-3, which is a promoter region (about 1.4 kb), a coding region consisting of two introns and three exons (647 bp), and 538 bp 3 'flanking The flanking region was included. The clone 202M05Pst-010 contains two fBDIs, fBDI-4 or -5, and fBDI-4, and the two genes are in head-to-tail form with a 1.961 bp intergenic region interposed therebetween. Located (FIG. 4).

In addition, analysis of the sequence upstream of the 5 'flanking region of the transcription initiation site of fBDI-4 revealed a potential cis- acting element and myocyte-specific enhancer factor-2. 3 binding sites for CCAF-binding factor (CBF) and 1 binding site for interferon regulatory factor (IRF), and IL-6 interleukin-6 responsive element-binding protein (RE-BP), Sp- Each binding site for stimulating protein-1 (LEF-1), lymphocyte-enhancer factor-1 (LEF-1) and nuclear factor of activated T-cells (NF-AT) was included.

Example 4 Expression of fBDI mRNA

The inventors performed RT-PCR to analyze the transcription patterns of fBDI subtypes at various developmental stages after hatching in fertilized eggs of the flounder. mRNA expression of fBDI was determined at 1, 3, 7, 14, 21, 28, and 35 dph. Specifically, RT-PCR was performed as follows: Extracting total RNA from halibut larvae and tissue using Trizol reagent according to the manufacturer's instructions, then contaminating genome by treatment with DNase I (Invitrogen) before conversion to cDNA. DNA was removed. First strand cDNA was synthesized using the RT-PCR kit (BD Biosciences). Gene specific primers for fBDI amplification (fBDI-RT-F and fBDI-RT-R) were designed based on fBDI cDNA sequences. As an internal control, flounder 18S rRNA was amplified using specific primers (18S rRNA-F and 18S rRNA-R). The RT-PCR reaction conditions were followed by a 5 minute step at 95 ° C., followed by 30 cycles at 94 ° C., 30 seconds at 60 ° C., and 30 cycles of 1 minute at 72 ° C., and last 5 minutes at 72 ° C. Configured. As a result, as shown in Figure 5A fBDI mRNA was expressed on day 1 after incubation, and continued to decrease during the observation period (Fig. 5A).

In addition, fBDI mRNA was observed after immunostimulation with E. tarda to determine the induction of the fBDI mRNA by immunostimulation. Specifically, in order to investigate the inducibility of fBDI , after artificial bacterial infection by the pathogen Edwardsiella tarda (E. tarda ) (Floor-derived KFE species in Korea), the head kidney tissue in each The expression level of fBDI mRNA was measured using RT-PCR. For this artificial infection, juvenile flounder (weight: 100 g) provided from GBRC was used. After anesthetizing the immature olive flounder with MS-222 (3-aminobenzoic acid ethyl ester; Sigma), a sub-lethal dose (1.2 × 10) in which Edwardsiella tarda was suspended in PBS buffer was used. ⁶ cells) were infected by intraperitoneal injection, and tissues were collected from three flounder at 0, 1, 3, 6, 12, 24 and 72 hours, respectively, and the expression level of fBDI mRNA was measured. As a result, as shown in Fig. 5B, induction was started at 1 hour after the administration of the pathogen, the maximum was reached at 3 hours after the administration, and gradually decreased after 6 hours after the administration (Fig. 5B).

Example 5 Preparation of Recombinant smfBDI Peptides

<5-1> Preparation of Expression Plasmid

We obtained DNA fragments containing the mature fBDI gene (smfBDI) by PCR with primers smfBDI-F and smfBDI-R (Table 1). The PCR reaction was carried out using 100 ng of template, 10 pmol of forward and reverse primers, and 2.5 U of Taq DNA polymerase to a final volume of 50 μl. The conditions of the PCR amplification were carried out as follows: 5 minutes at 95 ℃; 30 cycles of 30 seconds at 95 ° C., 30 seconds at 55 ° C., and 30 seconds at 72 ° C .; And final hold at 72 ° C. for 5 minutes. The PCR product and vector pET32a were digested with restriction enzymes Nco I and Sal I. After purification by electrophoresis on 1.5% agarose gel, PCR fragments and pET32a were ligated with T4 DNA ligase to prepare the expression plasmid pET32a-smfBDI. The plasmid pET32a-smfBDI was transformed into Escherichia coli strain BL21 (DE3), and then bacteria containing the plasmid were selected using ampicillin. Insertion of the plasmid was determined by agarose gel electrophoresis after cleavage with Nco I and Sal I restriction enzymes. As a result of SDS-PAGE analysis, the target protein (TrxA-smfBDI) was successfully expressed in soluble form after 0.4 mM IPTG induction. Positive clones containing the correct sequence of smfBDI were identified by DNA sequencing.

<5-2> Expression and Purification of Recombinant smfBDI Peptide

One positive clone was used for inoculation of 10 ml of LB-Amp medium (LB medium suspended with ampicillin to a final concentration of 100 μg ml ⁻¹ ). The culture was performed at 37 ° C. with strong shaking. The next morning, 1 mL of cultured cells were added to 200 ml of LB-Amp medium and shaken at 37 ° C. until the OD ₆₀₀ reached 0.6. Induction was initiated by the addition of 0.4 mM IPTG and then shaken at 30 ° C. for 5 hours. After further incubation, cells were harvested by centrifugation at 5,000 rpm for 10 minutes.

To purify the smfBDI peptide, bacterial pellets were dissolved in 10 volumes containing 20 mM Tris-HCl (pH 8.0), 0.25 M NaCl, 1 mM DTT, 1 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride (PMSF). After suspension in the buffer solution, it was ultrasonically decomposed using an ultrasonic disrupter. Cell debris was removed by centrifugation at 12,000 rpm for 20 minutes at 4 ° C. Supernatants containing soluble protein fractions were decanted into a new tube. 50 microliters of 2 mM SDS sample buffer containing 8% 2-mercaptoethanol was mixed with the soluble protein fraction and the sample was then subjected to SDS-PAGE (sodium dodecyl sulfate) using a 15% gel. Boil for 5 minutes prior to polyacrylamide gel electrophoresis. The target protein was then purified using Nickel-nitrilotriacetic acid (Ni-NTA) (Qiagen) agarose affinity chromatography. After loading of samples and equilibration of the Ni-NTA column, the His-tagged target protein bound to the resin was eluted with elution buffer, and then fractions were collected in new tubes. Finally, the obtained target protein was obtained by lyophilization. To produce a solution of 100 μg μl ⁻¹ smfBDI, the acid product was dissolved in 20 mM Tris-HCl buffer (pH 7.8) and then the smfBDI solution was serially diluted to prepare various concentrations of smfBDI.

Example 6 Antimicrobial Activity of Recombinant smfBD1

The inventors evaluated the antimicrobial activity of smfBDI using agar disc diffusion assay and liquid bacteria killing assays for E. coli BL21 (DE3). Specifically, agar plate diffusion assays were performed by plating bacterial cells in 2 × YT medium agar plates in the mid-logarithmic phase and then adding 1, 2.5, 5 or 10 μg smfBDI onto the agar plates. -mm paper was added to the plate. The plates were incubated at 37 ° C. until a circular bacterial inhibition zone appeared. Only buffer was used as a negative control. Liquid bacterial killing assays were also inoculated with 1 ml of LB medium in E. coli of about 1 × 10 ⁶ colony forming units. smfBDI samples were prepared by diluting lyophilized smfBDI with 20 mM Tris-HCl buffer and then adding the culture medium. As a negative control, 20 mM Tris-HCl buffer was added to separate samples. After overnight incubation (37 ° C., 200 rpm), the cell concentration was determined as OD ₆₀₀ . As a result, as shown in FIG. 6, the fusion protein containing smfBDI exhibited an antimicrobial activity of 1 μg μl ⁻¹ (FIG. 6A). In other words, the recombinant mature fBDI was shown to have biological activity. In addition, the growth inhibition curve significantly inhibited the growth of E. coli , and the degree of inhibition was confirmed to be high as the concentration of recombinant smfBDI increased (FIG. 6B).

Betadifensine, a novel peptide of the present invention, has an important function in the immune response of the olive flounder, and has high antibacterial activity in recombinant betadefensins, and thus may be usefully used for natural antibiotic development.

1 is a diagram showing the nucleotide and amino acid sequence of five beta-defensin subtype derived from flounder. Nucleotide identity is indicated by a dot (?). The dash (-) marks spaces inserted to maximize alignment. Signal peptides are underlined and six conserved cysteine residues are shaded.

2 is a diagram showing a comparison of amino acid sequences between fBDI and known beta-defensin (β-defensin). The dash (-) marks spaces inserted to maximize alignment. Isoelectric point (pI) values are indicated at the ends of each sequence. Cysteine residues (1-6) are indicated by boxes and connecting lines to show intramolecular disulfide bonds.

3 is a diagram showing the genomic organization of fBDI.

3A is a diagram showing a result of Southern blot analysis on BAC DNA including fBDI gene. Five micrograms of flounder fBDI BAC DNA were digested with restriction enzymes and then sized by intermittent field gel electrophoresis. DNA was transferred to an positively charged nylon membrane and hybridized with full length fBDI cDNA. The figure on the right represents the standard size in kb. B is cleaved by Hind III; H is cleaved by Hind III; P is cleaved by Pst I; S is cut by Sal I.

FIG. 3B is a schematic of BAC subclone generated by cleavage with Hind III and Pst I, showing 202M05Hind-001 (with fBDI-3) and 202M05Pst-010 (with fBDI-4 and -5), respectively . Open boxes and shaded boxes represent untranslated and translated sites, respectively.

4 is a diagram showing the nucleotide sequence of the 5 'flanking region of the fBDI-4 gene. The 5 'flanking sequence of the fBDI-4 gene of about 2 kb was analyzed for the cis- acting element. Underlined indicates potential transcription sites. Transcription initiation sites are indicated by +1 position. Exon sequences are in capital letters and amino acid sequences are in single letter code.

5 is a diagram showing the expression level of fBDI mRNA using RT-PCR. Amplification of the flounder 18S rRNA was shown as an internal control.

5A is a diagram showing the expression level of each fBDI mRNA in the samples obtained at each developmental stage of larvae 1 to 35 days after hatching.

5B is a diagram showing the expression level of each fBDI mRNA in the head kidney tissue of the samples 1, 3, 6, 12, 24 and 72 hours after E. tarda injection.

Figure 6 shows the antibacterial activity of fBDI against E. coli .

6A is a diagram showing the results of the evaluation of the inhibitory zone (Inhibitory zone) of fBDI.

Figure 6B is a graph showing the results of the antimicrobial analysis of fBDI in liquid culture. The survival rate (%) was calculated as the ratio of cell concentration (absorbance measurement at 600 nm) to cell concentration in the absence of fBDI (absorbance measurement at 600 nm).

<110> National Fisheries Research and Development Institute <120> Novel genes encoding beta-defensin of olive flounder and uses          the <130> 9p-07-12 <160> 23 <170> Kopatentin 1.71 <210> 1 <211> 400 <212> DNA <213> Artificial Sequence <220> <223> fBDI-1 (FLDS-14-46_F06) cDNA <400> 1 gaaagacgca gtttcagacc caacaatgtc tcgttatcgt gtggctgttt tggcgctggt 60 cgttgtcttg cttgtttttg ttgcagagaa tgaagcagac caacctaagt tggattgctc 120 caccatacag ggagtctgta aagacagttg cctctcaaca gaattctcta ttggagctct 180 cggctgttcc gcagagagtt caactgtatg ttgcataacc aaaccataat tcagccaaga 240 tacaagactt gccaagcatc acagatgatg ggacagacag aagacatcgt tgtggaggat 300 ttgctttggc tgacgtgttg ctgatttgaa tgcagctcca atggttgaat aaaacattac 360 attgagaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 400 <210> 2 <211> 404 <212> DNA <213> Artificial Sequence <220> <223> fBDI-2 (FLDS-4-F11) cDNA <400> 2 gacgcagttt cagacccaac aatgtctcgt tatcgtgtgg ctgttttggc gctggtcgtt 60 gtcttgcttg tttttgttgc agagaatgaa gcagaccgac ctaagttgga ttgctccacc 120 atacagggag tctgtaaaga cagttgcctc tcaacagaat tctctattgg agctcttggc 180 tgttctgcag agagttcaac tgtatgttgc ataaccaaac cataattcag ccaagataca 240 agacttgcct agcatcacag atgatgggac agacagaaga catcgttgtg gaggatttgc 300 tttggctgac gtgttgctga tttgaatgca gctccaatgg ttgaataaaa cattaccttg 360 aaaaaaaaaa agaaaaatga aaaaaaaaaa aaaaaaagaa aaaa 404 <210> 3 <211> 390 <212> DNA <213> Artificial Sequence <220> <223> fBDI-3 (FLDS-9-13_E02) cDNA <400> 3 gcagtttcag acccaacaat gtctcgttat cgtgtggctg ttttggcgct ggtcgttgtc 60 ttgcttgttt ttgttgcaga gaatgaagca gaccaaccta agccagaccg acctaagttg 120 gattgctcca ccatacaggg agtctgtaaa gacagttgcc tctcaacaga attctctatt 180 ggagctctcg gctgttccgc agagagttca actgtatgtt gcataaccaa accataattc 240 agccaagata caagacttgc caagcatcac agatgatggg acagacagaa gacatcgttg 300 tggaggattt gctttggctg acgtgttgct gatttgaatg cagctccaat ggttgaataa 360 aacattacat tgaaaaaaaa aaaaaaaaaa 390 <210> 4 <211> 433 <212> DNA <213> Artificial Sequence <220> <223> fBDI-4 (FLDS-4-C12) cDNA <400> 4 gaaagacgca gtttcagacc caacaatgtc ttgttatcgt gtggctgttt tggcgctggt 60 cgttgtcttg cttgtttttg ttgcagagaa tgaagcagat cgacctaagg cagaccgacc 120 taagccagac cgacctaagg cagattgctc caccatacag ggagtctgta aagacagttg 180 cctctcaaca gaattctcta ttggagctct cggctgttcc gcagagagtt caactgtatg 240 ttgcgtaacc aaaccataat tcagccaaga tacaagactt gccaagcatc acagatgatg 300 ggacagacag aagacatcgt tgtggaggat ttgcattggc tgacgtgttg ctgatttgaa 360 tgcagctcca atggttgaat aaaacattac attgaaaaaa aaaaaaaaaa aaaaaaaaaa 420 aaaaaaaaaa aaa 433 <210> 5 <211> 450 <212> DNA <213> Artificial Sequence <220> <223> fBDI-5 (FLDS-4-F10) cDNA <400> 5 gaaagacgca gtttcagacc caacaatgtc tcgttatcgt gtggctgttt tggcgctggt 60 cgttgtcttg cttgtttttg ttgcagagaa tgaagcagat cgacctaagg cagaccgacc 120 taagccagac cgacctaagt tggattgctc caccatacag ggagtctgta aagacagttg 180 cctctcaaca gaattctcta ttggagctct tggctgttct gcagagagtt caactgtatg 240 ttgcgtaacc aaaccataat tcagtcaaga tacaagactt gccaagcatc acagatgatg 300 ggacagacag aagacatcgt tgtggaggat ttgctttggc tgacgtgttg ctgatttgaa 360 tgcagctcca atggttgaat aaaacattac attgaaaaaa aaaaaaaaaa aaaaaaaaaa 420 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 450 <210> 6 <211> 415 <212> DNA <213> Artificial Sequence <220> <223> fBDI-1 (FLDS-14-46_F06) gDNA <400> 6 atgtctcgtt atcgtgtggc tgttttggcg ctggtcgttg tcttgcttgt ttttggtgag 60 tattgataca tctctgcatg tttttgcagc tcatatctgc acatttttac agttattttt 120 tttaattgac aacgaaagga tttgaacaaa aacatacata acgtttctct ttgttttcag 180 tagcagagaa tgaagcagac caacctaagt tggattgctc caccatacag ggagtctgta 240 aagacagttg cctctcaaca gaattctcta ttggagctct cggctgttcc gcagagagtt 300 cgtaagttca gatgcttaga tgcagcatgt gagtaaatat tgtctattta tttgcaggtg 360 gaattaaagt atgtattgtt tctttttcag aactgtatgt tgcgtaacca aacca 415 <210> 7 <211> 415 <212> DNA <213> Artificial Sequence <220> <223> fBDI-2 (FLDS-4-F11) gDNA <400> 7 atgtctcgtt atcgtgtggc tgttttggcg ctggtcgttg tcttgcttgt ttttggtgag 60 tattgataca tctctgcatg tttttgcagc tcatatctgc acatttttac agttattttt 120 tttaattgac aacgaaagga tttgaacaaa aacatacata acgtttctct ttgttttcag 180 tagcagagaa tgaagcagac caacctaagt tggatcgctc caccatacag ggagtctgta 240 aagacagttg cctctcaaca gaattctcta ttggagctct cggctgttcc gcagagagtt 300 cgtaagttca gatgcttaga tgcagcatgt gagtaaatat tgtctattta tttgcaggtg 360 gaattaaagt atgtattgtt tctttttcag aactgtatgt tgcgtaacca aacca 415 <210> 8 <211> 2615 <212> DNA <213> Artificial Sequence <220> <223> fBDI-3 (FLDS-9-13_E02) gDNA <400> 8 gcacttgttg atgttatacg ttaccatttt acgatacaaa agcataccca gagctccatt 60 ctgataccca tggatcagtc tatcctacta gatcttcttg aaaagtgggt tggcgtcagg 120 taaaatgctc tggactcatt taaatctgat tcatcatgca gaactgtcgt aatagttatg 180 ggtaatgcct catcttctgg ggtccccctg acttgtggtg tcccacaggg atcaatcatt 240 ggcacctttg gtgagaatat gtatttatgt aagtgaaagg gagttttggt ggtgtcgcgc 300 cacttaatgg ctacacatca atacaccatc cgcttctatt gacaccatcg catcatgcca 360 acgtcacaaa atgttcccat cagatgcaat gattgtcatt ttatttcgag gtccacgatg 420 tttgaacgtg ttgtcgtggt gtaacatgct aattgtacac aaaatgtctt ttaaaaatct 480 tatggatttc ttttgaaata atgccacaca aaccaacagg cacattttga accgactaaa 540 aaagacaatg acatggcaga aacaccatct gtctgtcatg gaatcttctg gaaagctgct 600 catccaaatt gacttcaaac gtggtgggtc gagtttgacc ctgttcccat ggtaaatatt 660 caatatgtca ttatcatatt aatacacaga atgacatctt ccactgctac tataaaactc 720 tgttggattc tggtgagggg aggggctttt tgaaaggtaa acagatagtt aatgaaccta 780 aaacgtatat ttctgtatgc tcaggcagtt gacatagtcg tctgtgaaga ttcttagtta 840 tctaggtcac gtttatccaa aactggttcc agcgatgaca actggacttg gttgtagata 900 cttgacaaag tttcaccttt cttgaatgtc ttggatatga gatgaaatgt ccttaagcat 960 aaacacttct ggtcctgaaa accctatttc tgtagggcct tgtgaatgta gtttttggtt 1020 ctgacacaag tccagtcttg gtttattatt ttctttgttg ctcaaatacc atgttttctt 1080 caacactgag aggcaaaagt aaagtgaaga aattgtcctt gcatgtaaag taaaactgaa 1140 tgaaatgtct tctatcatct ctgtggtaga ctatacacat atactttgag aattgaagaa 1200 cattgcaata tttcaacaaa aacgtttgat ttgaaataca caatcgctag atagatttaa 1260 aaccaagagg caggtttgga caggcaaacc tccaattttc catcatcagg tagttgacaa 1320 acacagcccc aggagaacca gcttgaaata tgaattatac taactgctga aaataaatta 1380 gagaccaacc catttcctcc tatatctcct atttcactcc tcccctcctc agaggtgagc 1440 agataaataa gacaaaccat cctgggtcta aacatcgttt tggagaaaga cgcagtttca 1500 gacccaacaa tgtctcgtta tcgtgtggct gttttggcgc tggtcgttgt cttgcttgtt 1560 tttggtgagt attgatacat ctctgcatgt ttttgcagct catatctgca catttttaca 1620 gttatttttt ttaattgaca acgaaaggat ttgaacaaaa acatacataa cgtttctctt 1680 tgttttcagt tgcagagaat gaagcagacc aacctaagcc agaccgacct aagttggatt 1740 gctccaccat acagggagtc tgtaaagaca gttgcctctc aacagaattc tctattggag 1800 ctctcggctg ttccgcagag agttcgtaag ttcagatgct tagatgcagc atgtgagtaa 1860 atattgtcta tttatttgcc ggtggaatta aagtatgtat tgtttctttt tcagaactgt 1920 atgttgcata accaaaccat aattcagcca agatacaaga cttgccaagc atcacagatg 1980 atgggacaga cagaagacat cgttgtggag gatttgcttt ggctgacgtg ttgctgattt 2040 gaatgcagct ccaatggttg aataaaacat tacattgaac aacttttctt gtttgtattc 2100 ttttacttaa agttgtatga ttcatcagaa gatcatttta ctttcaacta aaactacaaa 2160 tctgccacta tttgattggc atcccatcat cttttatata tgaagtgaaa acatctacat 2220 ttctgtcttg actcaaagta ctttgttttc actcatgttt gcttccaaat gggatttgtg 2280 gttcatatga aacatgtttg acagaagcag accatcattt tgggtcccta acaagaagga 2340 agtgaaaaca tacttttcac aaagtaacct aacccctact tgcatgactt aaggttaatt 2400 gcatgtccca ccttttgagt ttaaggacag atagacagac agatttttaa tttatagttg 2460 gactagtaac tgtgtttttg ccctttcaga atgtaacagt gtgttgcatt gtttcaagaa 2520 aagttagatt cattgaagtt cattgggttt tctaagattt taagttcaat tccaaaaaga 2580 aagcatttca taacaaaatg agctggttca agctt 2615 <210> 9 <211> 2630 <212> DNA <213> Artificial Sequence <220> <223> fBDI-4 (FLDS-4-C12) gDNA <400> 9 ctgcagagag ttcgtaagtt cagatgctta gatgcagcat gtgagtaaat attgtctatt 60 tatttgccgg tggaattaaa gtatgtattg tttctttttc agaactgtat gttgcgtaac 120 caaaccataa ttcagccaag atacaagact tgccaagcat cacagatgat gggacagaca 180 gaagacatcg ttgtggagga tttgctttgg ctgacgtgtt gctgatttga atgcagctcc 240 aatggttgaa taaaacatta cattgaacaa cttttcttgt ttgtattctt ttacttaaag 300 ttgtatgatt catcagaaga tcattttact ttcaactaaa actacaaatc tgccactatt 360 tgattggcat cccatcatct tttatatatg aagtgaaaac atctacattt ctgtcttgac 420 tcaaagtact ttgttttcac tcatgtttgc ttccaaatgg gatttgtggt tcatatgaaa 480 catgtttgac agaagcagac catcattttg ggtccctaac aagaaggaag tgaaaacata 540 cttttcacaa agtaacctaa cccctacttg catgacttaa ggttaattgc atgtcccacc 600 ttttgagttt aaggacagat agacagacag atttttaatt tatagttgga ctagtaactg 660 tgtttttgcc ctttcagaat gtaacagtgt gttgcattgt ttcaagaaaa gttagattca 720 ttgaagttca ttgggttttc taagatttta agttcaattc caaaaagaaa gcatttcata 780 acaaaatgag ctggttcaag ctagttgaaa tgttatacgt taccatttta cgatacaaaa 840 aagcataccc agagctccat tctgataccc atggatcagt ctatcctact agatcttctt 900 gaaaagtggg ttggcgtcag gtaaaatgct ctggactcat ttaaatctga ttcatcatgc 960 agaactgtcg taatagttat gggtaatgcc tcatcttctg gggtccccct gacttgtggt 1020 gtcccacagg gatcaatcat tggcaccttt ggtgagaata tgtatttatg taagtgaaag 1080 ggagttttgg tggtgtcgcg ccacttaatg gctacacatc aatacaccat ccgcttctat 1140 tgacaccatc gcatcatgcc aacgtcacaa aatgttccca tcagatgcaa tgattgtcat 1200 tttatttcga ggtccacgat gtttgaacgt gttgtcgtgg tgtaacatgc taattgtaca 1260 caaaatgtct tttaaaaatc ttatggattt cttttgaaat aatgccacac aaaccaacag 1320 gcacattttg aaatgactaa aaaagacaat gacatggcag aaacaccatc tgtctgtcat 1380 ggaatcttct ggaaagctgc tcatccaaat tgacttcaaa cgtggtgggt cgagtttgac 1440 cctgttccca tggtaaatat tcaatatgtc attatcatat taatacacag aatgacatct 1500 tccactgcta ctataaaact ctgttggatt ctggtgaggg gaggggcttt ttgaaaggta 1560 aacagatagt taatgaacct aaaacgtata tttctgtatg ctcagggcag gttgacatag 1620 tcgtctgtga agattctcag ttatctaggt cacgttaact ggctccagcg atgacaactg 1680 gacttggttg tagatacttg acaaagtttc acctttcttg aatgtcttgg atatgagatg 1740 aaatgtcctt aagcataaac acttctggtc ctgaaaaccc tatttctgta gggccttgtg 1800 aatgtagttt ttggttctga cacaagtcca gtcttggttt attattttct ttgttgctca 1860 aataccatgt tttcttcaac actgagaggc aaaagtaaag tgaagaaatt gtccttgcat 1920 gtaaagtaaa actgaatgaa atgtcttcta tcatctctgt ggtagactat acacatatac 1980 tttgagaatt gaagaacatt gcaatatttc aacaaaaacg tttgatttga aatacacaat 2040 cgctagatag atttaaaacc aagaggcagg tttggacagg caaacctcca attttccatc 2100 atcaggtagt tgacaaacac agccccagga gaaccagctt gaaatatgaa ttatactaac 2160 tgctgaaaat aaattagaga ccaacccatt tcctcctata tctcccattt cactcctccc 2220 ctcctcagag gtgagcagat aaataagaca aaccatcctg ggtctaaaca tcgttttgga 2280 gaaagacgca gtttcagacc caacaatgtc tcgttatcgt gtggctgttt tggcgctggt 2340 cgttgtcttg cttgtttttg gtgagtattg atacatctct gcatgttttt gcagctcata 2400 tctgcacatt tttacagtta ttttttttta attgacaacg aaaggatttg aacaaaaaca 2460 tacataacgt ttctctttgt tttcagttgc agagaatgaa gcagatcgac ctaaggcaga 2520 ccgacctaag ccagaccgac ctaaggcaga ttgctccacc atacagggag tctgtaaaga 2580 cagttgcctc tcaacagaat tctctattgg agctcttggc tgttctgcag 2630 <210> 10 <211> 446 <212> DNA <213> Artificial Sequence <220> <223> fBDI-5 (FLDS-4-F10) gDNA <400> 10 atgtctcgtt atcgtgtggc tgttttggcg ctggtcgttg tcttgcttgt ttttggtgag 60 tattgataca tctctgcatg tttttgcagc tcatatctgc acatttttac agttattttt 120 ttttaattga caacgaaagg atttgaacaa aaacatacat aacgtttctt tttgttttca 180 gttgcagaga atgaagcaga tcgacctaag gcagaccgac ctaagccaga ccgacctaag 240 ttggattgct ccaccataca gggagtctgt aaagacagtt gcctctcaac agaattctct 300 attggagctc ttggctgttc tgcagagagt tcgtaagttc agatgcttag atgcagcatg 360 tgagtaaata ttgtctattt atttgccggt ggaattaaag tatgtattgt ttctttttca 420 gaactgtatg ttgcgtaacc aaacca 446 <210> 11 <211> 67 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of fBDI-1 (FLDS-14-46_F06) <400> 11 Met Ser Arg Tyr Arg Val Ala Val Leu Ala Leu Val Val Val Leu Leu   1 5 10 15 Val Phe Val Ala Glu Asn Glu Ala Asp Gln Pro Lys Leu Asp Cys Ser              20 25 30 Thr Ile Gln Gly Val Cys Lys Asp Ser Cys Leu Ser Thr Glu Phe Ser          35 40 45 Ile Gly Ala Leu Gly Cys Ser Ala Glu Ser Ser Thr Val Cys Cys Ile      50 55 60 Thr Lys Pro  65 <210> 12 <211> 67 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of fBDI-2 (FLDS-4-F11) <400> 12 Met Ser Arg Tyr Arg Val Ala Val Leu Ala Leu Val Val Val Leu Leu   1 5 10 15 Val Phe Val Ala Glu Asn Glu Ala Asp Arg Pro Lys Leu Asp Cys Ser              20 25 30 Thr Ile Gln Gly Val Cys Lys Asp Ser Cys Leu Ser Thr Glu Phe Ser          35 40 45 Ile Gly Ala Leu Gly Cys Ser Ala Glu Ser Ser Thr Val Cys Cys Ile      50 55 60 Thr Lys Pro  65 <210> 13 <211> 72 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of fBDI-3 (FLDS-9-13_E02) <400> 13 Met Ser Arg Tyr Arg Val Ala Val Leu Ala Leu Val Val Val Leu Leu   1 5 10 15 Val Phe Val Ala Glu Asn Glu Ala Asp Gln Pro Lys Pro Asp Arg Pro              20 25 30 Lys Leu Asp Cys Ser Thr Ile Gln Gly Val Cys Lys Asp Ser Cys Leu          35 40 45 Ser Thr Glu Phe Ser Ile Gly Ala Leu Gly Cys Ser Ala Glu Ser Ser      50 55 60 Thr Val Cys Cys Ile Thr Lys Pro  65 70 <210> 14 <211> 77 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of fBDI-4 (FLDS-4-C12) <400> 14 Met Ser Cys Tyr Arg Val Ala Val Leu Ala Leu Val Val Val Leu Leu   1 5 10 15 Val Phe Val Ala Glu Asn Glu Ala Asp Arg Pro Lys Ala Asp Arg Pro              20 25 30 Lys Pro Asp Arg Pro Lys Ala Asp Cys Ser Thr Ile Gln Gly Val Cys          35 40 45 Lys Asp Ser Cys Leu Ser Thr Glu Phe Ser Ile Gly Ala Leu Gly Cys      50 55 60 Ser Ala Glu Ser Ser Thr Val Cys Cys Val Thr Lys Pro  65 70 75 <210> 15 <211> 77 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of fBDI-5 (FLDS-4-F10) <400> 15 Met Ser Arg Tyr Arg Val Ala Val Leu Ala Leu Val Val Val Leu Leu   1 5 10 15 Val Phe Val Ala Glu Asn Glu Ala Asp Arg Pro Lys Ala Asp Arg Pro              20 25 30 Lys Pro Asp Arg Pro Lys Leu Asp Cys Ser Thr Ile Gln Gly Val Cys          35 40 45 Lys Asp Ser Cys Leu Ser Thr Glu Phe Ser Ile Gly Ala Leu Gly Cys      50 55 60 Ser Ala Glu Ser Ser Thr Val Cys Cys Val Thr Lys Pro  65 70 75 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> fBDI-ORF-Forward primer <400> 16 atgtctcgtt atcgtgtggc t 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> fBDI-ORF-Reverse primer <400> 17 ttggctgaat tatggtttgg t 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fBDI-RT-Forward primer <400> 18 acgcagtttc agacccaaca 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> fBDI-RT-Reverse primer <400> 19 cggaacagcc aagagctcca 20 <210> 20 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> smfBDI-Forward primer <400> 20 gggccatggc tatgtcttgt tatcgtgtgg ctg 33 <210> 21 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> smfBDI-Reverse primer <400> 21 gggcagctgt tatggtttgg ttacgcaaca tac 33 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-Forward primer <400> 22 atggccgttc ttagttcctg 20 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-Reverse primer <400> 23 ccacgctgat ccagtcagt 19  

Claims (9)

A polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 13 with antimicrobial activity. The polypeptide of claim 1, which is derived from halibut ( Paralichthys olivaceus , P. olivaceus ). The polypeptide of claim 1 having anionicity. A polynucleotide encoding the polypeptide of claim 1. Recombinant expression vector comprising the polynucleotide of claim 4. A transformant transformed with a recombinant expression vector of claim 5 in a host cell. delete An antibiotic containing the polypeptide of claim 1 as an active ingredient. Feed additive containing the polypeptide of claim 1 as an active ingredient.

Images