CN1328382C - Recombination expression method for black porgy tumor necrosis factor alph gene - Google Patents
Recombination expression method for black porgy tumor necrosis factor alph gene Download PDFInfo
- Publication number
- CN1328382C CN1328382C CNB2004100503312A CN200410050331A CN1328382C CN 1328382 C CN1328382 C CN 1328382C CN B2004100503312 A CNB2004100503312 A CN B2004100503312A CN 200410050331 A CN200410050331 A CN 200410050331A CN 1328382 C CN1328382 C CN 1328382C
- Authority
- CN
- China
- Prior art keywords
- expression
- necrosis factor
- gly
- tumor necrosis
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to expression in vitro and purification technology of a tumor necrosis factor alpha (BS TNF alpha) of black sea bream, which belongs to the technical field of molecular biology. The present invention comprises technological steps: construction and conversion of a recombinant expression carrier, sieving of a transformant, separation, purification and identification of expression products and the like, wherein the construction of the recombinant predicts a cDNA sequence design primer of mature peptide according to the tumor necrosis factor alpha of black sea bream; two different restriction incision enzyme mutational sites are introduced and then cloned to the expression carrier; then the constructed recombinant expression carrier is converted into colibacillus and yeast; the positive clone is sieved, and the expression of recombination proteins is induced by IPTG or methanol; and the tumor necrosis factor alpha of high-purity expression in vitro is obtained by multi-stage purification of the expression products by utilizing affinity chromatography. The product can be used for the theoretical research of immunologic mechanisms of fish and can be used as bait feed additives, immunity enhancing agents, medicines for preventing and treating diseases and the like to be applied to the aspect of production.
Description
Technical field
The present invention relates to technology such as the clone of functional gene in the gene engineering technology field, recombinant expressed and purifying, specifically the separation and purification of the clone of black porgy (Acanthopagrus schlegeli) tumor necrosis factor alpha (BS TNF α) gene, recombinant expressed, expression product and evaluation etc.
Background technology
The fast development of aquatic animal high-density, intensification makes that culturing disease is on the rise, and various diseases frequently break out, and have become the main bottleneck of the sustainable sound development of culture fishery.All kinds of agricultural chemicals, blindly unordered and frequent use of microbiotic, not only the prevention to disease does not play a significant role with treatment, and, since a large amount of use havocs of these medicines natural ecological environment, the residual human beings'health that directly threatened of medicine, therefore, find and seek highly versatile, prevention effect is good, and free of contamination novel prevention of damage by disease of wide spectrum and medicine become one of important topic that people need to be resolved hurrily.
TNF claims to dislike quality (cachectin), cytotoxic factor (cytotoxin factor) or differentiation inducing factor (differentiation inducing factor) again, it is a kind of being present in of being found by Carswell in the serum in 1975, have killing tumor cell, and the cytokine that in-vivo tumour is necrosed.TNF α can be by various kinds of cell such as monocyte, scavenger cell, NK cell, mastocyte, brain cell and inoblast secretions (Vassalla, 1992), all can killing tumor cell in the inside and outside and suppress the propagation of tumour cell; And can be by stimulation T cell, the expression of inducing MHC, immunne response, inflammation and the exothermic reaction (Camussi, 1991) of participation and regulation and control body are most important pro-inflammatory cytokines in the body inflammatory reaction.The major function of TNF α comprises and suppressing and killing tumor cell; Induce the differentiation of white corpuscle and scavenger cell, be suppressed to the fat expression of gene, suppress the adipocyte differentiation; Promote T cell proliferation, induce the MHCI quasi-molecule to express, induce relevant production of cytokines; Induce the secretion of activating B cell propagation and Ig; Short scorching activity and immunoregulatory activity comprise activated monocyte and scavenger cell, induce the respiratory metabolism outburst, and the phagocytic activity of cell is provided, and induce the NK cell, bring into play cytotoxic effect; And to the biologic activity such as regulation and control of virus replication.
Tumor necrosis factor alpha content in animal body very low (pik or nanogram magnitude), and the transformation period short (several hours to several days), separation and purifying in-vivo tumour necrosin ﹠ be difficulty very, has greatly limited research and further development and utilization (kuby, 1997) to its function.The end of the seventies and the beginning of the eighties, follow the ripe and development of molecule clone technology, the foundation of various kinds of cell system for Study of cytokines has been brought new development space, to the end of the nineties, has obtained a large amount of cytokines and acceptor gene thereof.At present, in the bioengineering product of Ying Yonging, cytokine has occupied most market shares clinically, comprises Interferon, rabbit, G CFS, interleukin and tumour necrosis factor etc.
Because cytokine such as TNF has extensive biologic activity in the mammal inflammatory reaction and in immunity system the core status of immunoregulation, for many years, people seek the evidence that TNF exists always in lower animal.Ottaviani (1993) and Wittwer (1999) find to have the TNF analogous components respectively in mollusk and insect.Aspect the research of tumours of fish necrosin, Hardie (1994) and Jang (1995) applied biology cross reaction have proved that there is the similar composition of TNF α in fish.Hirono was cloned into TNF α gene in 2000 first by the EST technology from lefteye flounder.Laing and Zou use the homologous gene clone technology in calendar year 2001, are cloned into two TNF-α genes that structure is close from rainbow trout.Subsequently, carp (Saeij, 2003), golden head porgy (Garcia-Castillo J, 2002), zebra fish (Bobe, 2001) is pitched tail Channel-catfish (Zou, 2003), has found the gene order of TNF α in the porgy economic fishes such as (Cai Zhonghua, 2003) in succession.
The vitro recombination of tumours of fish necrosin ﹠ and activity identification work are also carried out now.(Cai Zhonghua, 2004) are finished in the expression of porgy TNF α in intestinal bacteria; Recombinant expressed and activity identification to completed rainbow trout TNF α studies show that, reorganization TNF α has the biologic activity similar to mammals, 1ng/ml, the expression that 10ng/ml and 100ng/ml reorganization TNF α can stimulate IL-1 β, in the concentration range of 10ng/ml and 100ng/ml, reorganization TNF has significant inducing action to comprising cytokines such as IL-1 β, TNF α, COX2 and IL-8.Similar result also shows and induces on cytophagous activate the phagocytic capacity and the leukocytic transfer ability of chemotactic, engulfing with chemotactic of reorganization TNF α pair cell has tangible dose-dependently, engulf with the chemotactic ability the strongest with the 10-20ng/ml pair cell, and too high concentration such as 100-200ng/ml can reduce engulfing and chemotactic ability (Cai Zhonghua etc. 2003) of cell on the contrary.We utilize RT-PCR and RACE technology, are cloned into tumor necrosis factor alpha gene (BS TNF α) from black porgy, and land at GenBank that (the sequence number of registration is: AY335443)
Summary of the invention
Tumour necrosis factor all has important effect at aspects such as the immunomodulatory of body and disease controls, but body self secreting tumor necrosis factor yields poorly, and the transformation period end is difficult for separation and purification.The present invention is directed to these characteristics and deficiency, utilize the black porgy tumor necrosis factor alpha gene (BSTNF α) of being cloned into, adopt the molecular recombination technology, the black porgy tumor necrosis factor alpha gene has been carried out vitro recombination, made up intestinal bacteria and Yeast expression carrier, through inducing, at vivoexpression the black porgy tumor necrosis factor alpha, expression product has been carried out separation and purification and evaluation, set up purifying and authentication method, the recombinant expressed of black porgy tumor necrosis factor alpha gene is provided and used.
The technical solution used in the present invention is:
The recombinant expression method of black porgy tumor necrosis factor alpha gene comprises the separation and purification and the evaluation of construction of recombinant vector, conversion and screening, expression product, is respectively described below:
1) construction of recombinant vector: according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, utilize a pair of Auele Specific Primer rTF to introduce two different restriction endonuclease sites of BamHI and HindIII at its two ends with rTR, be cloned into expression vector, carrier comprises pQE series, pET series, pGEX-4T series, pPIC series and pGAPZ series;
2) transform and screening
The recombinant expression vector that obtains that makes up is transformed in bacillus coli DH 5 alpha, Jm109, XL1-blue or pichia spp, the saccharomyces pastorianus, carries out the PCR bidirectional screening with carrier primer and gene-specific primer respectively; The positive colony that obtains carries out plasmid purification, the digestion with restriction enzyme checking; And after sequencing was identified, the positive colony that is screened carried out abduction delivering to bacterium or yeast respectively as the preparation engineering strain;
3) separation and purification of expression product: adopt inductor to induce the expression of engineering bacteria, directly get supernatant liquor or through lysate or granulated glass sphere lysing cell, carry out purifying with affine layer method, the SDS-PAGE electrophoresis is identified.
Described construction of recombinant vector is divided into:
The structure of prokaryotic system expression vector: (the GenBank number of registration is: AY335443) according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, utilize a pair of gene-specific primer rTF 5 '-TAGGAT CCC TGA GGC GCA TCA GCA G-3 ' and rTR 5 '-GCG AAG CTT AAG TGCAAA CAC ACC GAA G-3 ', introduce BamHI respectively at the primer two ends, two different restriction endonuclease sites of HindIII, increasing through the enterprising performing PCR of the black porgy cDNA that infects, PCR product subclone to expression vector pQE30, is finished the structure of prokaryotic system expression vector;
The structure of eukaryotic system expression vector: (the GenBank number of registration is: AY335443) according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, adopt another Auele Specific Primer ryTF 5 '-CAG AGC TCG CAA AAT GCT GAG GCG CAT CA-3 ' and yrTR:5 '-ATG GAT CCT AAG TGC AAA CAC ACC GAA-3 ' to containing restriction enzyme site, this Auele Specific Primer contains SacI and two restriction enzyme sites of BamHI respectively, in the head-kidney cDNA library that Vibrio anguillarum infects, carry out pcr amplification black porgy, amplified production is behind SacI and two digestion with restriction enzyme of BamHI, subclone is finished and is used for different hosts and transforms required expression vector establishment to pMETA fabric shuttle-type expression vectors such as (invitrogen).
The described protokaryon engineering bacteria of inducing is isopropyl-(IPTG) at the inductor of escherichia coli expression; Inducing the recombination yeast engineering bacteria is methyl alcohol at the inductor of yeast expression.
After inducing, the bacterium liquid of amalgamation and expression is through lysate or granulated glass sphere cracking, and the secretion type expression cell is directly collected supernatant liquor, carries out immunoaffinity chromatography with the 6His monoclonal antibody, or with nickel metal affinity chromatography purifying, identifies with the SDS-PAGE electrophoresis; The nickel metal affinity purification colloid that described nickel metal affinity chromatography purifying uses is: Ni-NTA (Qiagen).
After the separation and purification of expression product, should carry out the activity identification of expression product, its authentication method is, with the reorganization black porgy tumor necrosis factor alpha recombinant protein behind the purifying, the scavenger cell of stimulated in vitro black porgy and porgy detects interleukin-11 β, TNF α, TGF β and IL8 cytokine by the abduction delivering of recombinant protein; With the reorganization black porgy tumor necrosis factor alpha recombinant protein behind the purifying, the scavenger cell of stimulated in vitro black porgy and porgy can increase the cytophagy and the chemotactic ability of scavenger cell.
The present invention is black porgy tumor necrosis factor alpha (BS TNF α) gene in vitro expression and purification technology; The present invention is cloned into expression vector with the coding region of black porgy tumor necrosis factor alpha gene, in intestinal bacteria and yeast, realizes expressing, and at the external purifying that carries out; Expression product of the present invention can be used for the fish immunity theoretical research of mechanism, and can be used for making immunostimulant and disease control medicine and other pharmaceutical prods of fodder additives, vaccine.Expression product can be induced the expression of other fish cell factor
(as IL-1 β etc.), strengthen fish macrophage phagocytic and chemotactic ability, the immunizing potency and the immune protective efficiency of raising fish vaccine.
Embodiment
Black porgy tumor necrosis factor alpha gene construction of recombinant vector method, construction of recombinant vector is:
(1) the cDNA sequence of the black porgy tumor necrosis factor alpha mature peptide that obtains according to the clone, design that a pair of Auele Specific Primer rTF 5 '-TAG GAT CCC TGA GGC GCA TCA GCA G-3 ' and rTR5 '-GCG AAG CTT AAG TGC AAA CAC ACC GAA G-3 ' is used for BSTNF to express intestinal bacteria, introduce two different restriction endonuclease sites of BamHI and HindIII at these two ends to primer, in the head-kidney cDNA library that Vibrio anguillarum infects, carry out pcr amplification black porgy, use glue to reclaim test kit (go up marine Ke Kairui Biochip company) purified pcr product, amplified production behind BamHI and two digestion with restriction enzyme of HindIII, according to corresponding cloning vector working instructions with the endonuclease bamhi subclone to pQE30 expression vectors such as (Qiagen).
The PCR reaction conditions is as follows:
Black porgy head-kidney cDNA library 1 μ l
10X?PCR?buffer 5μl
25mM?MgCL
2 3μl
2.5mM?dNTP 2μl
10uM?rTF(rTF) 2μl
10uM?rTR(rTR) 2μl
5U/ μ l Taq enzyme 0.25 μ l
Adding water, to mend cumulative volume be 50 μ l
The PCR reaction conditions:
1 circulation: 94 ℃ of 5min; 10 circulations: 94 ℃ of 45s, 67 ℃ of 30s (each circulation reduces by 0.6 ℃), 72 ℃ of 45s; 25 circulations, 94 ℃ of 45s, 61 ℃ of 30s, 72 ℃ of 45s; 1 circulation: 72 ℃ of 10min, 4 ℃ of preservations.
The digestion with restriction enzyme condition is as follows:
0.1μg?DNA 2μl
10Xbuffer 2μl
BamHI(Promega) 1μl
HindIII(Promega)1μl
ddH
2O?to 20μl
Above-mentioned reaction system is mixed, hatched 1% agarose electrophoresis, ultraviolet lamp detection 3 hours in 37 ℃.
(2) design another to primer ryTF 5 '-CAG AGC TCG CAA AAT GCT GAG GCG CATCA-3 ' with ryTR:5 '-ATG GAT CCT AAG TGC AAA CAC ACC GAA-3 ' is used for BSTNF expresses at Yeast system, this Auele Specific Primer contains SacI and two restriction enzyme sites of BamHI respectively, in the head-kidney cDNA library that Vibrio anguillarum infects, carry out pcr amplification black porgy, amplified production is behind SacI and two digestion with restriction enzyme of BamHI, subclone is finished and is used for different hosts and transforms required expression vector establishment to pMETA fabric shuttle-type expression vectors such as (invitrogen).
The PCR reaction conditions is as follows:
Black porgy head-kidney cDNA library 1 μ l
10XPCR?buffer 5μl
25mM?MgCL
2 3μl
2.5mM?dNTP 2μl
10uM?rTF(ryTF) 2μl
10uM?rTR(ryTR) 2μl
5U/ μ l Taq enzyme 0.25 μ l
Adding water, to mend cumulative volume be 50 μ l
The PCR reaction conditions:
1 circulation: 94 ℃ of 5min; 10 circulations: 94 ℃ of 45s, 67 ℃ of 30s (each circulation reduces by 0.6 ℃), 72 ℃ of 45s; 25 circulations, 94 ℃ of 45s, 61 ℃ of 30s, 72 ℃ of 45s; 1 circulation: 72 ℃ of 10min, 4 ℃ of preservations.
The digestion with restriction enzyme condition is as follows:
0.1μgDNA 2μl
10X?buffer 2μl
SacI(Promega)?1μl
BamHI(Promega)1μl
ddH
2O?to 20μl
Above-mentioned reaction system is mixed, hatched 1% agarose electrophoresis, ultraviolet lamp detection 3 hours in 37 ℃.
Transform and screening (method): the method for electricity consumption conversion or chemical conversion, with recombinant expression vector transformed into escherichia coli and the yeast that structure obtains, screen the correct positive colony of sequence and direction of insertion as the preparation engineering strain, and abduction delivering.Identify with SDS PAGE whether engineering bacteria expresses, and express output, the bacterial strain that screening efficiently expresses is as expressing engineering bacteria.
Detailed process is:
1) preparation competent cell
Single bacterial clone (XL1-blue) bacterium of picking incubated overnight is in the 5ml liquid nutrient medium, and 220rpm cultivated 2 hours for 37 ℃ at shaking table.To go up step 5ml liquid nutrient medium again and change in the 100ml LB liquid nutrient medium, cultivate about 3 hours for 37 ℃, make OD600 about 0.3 at shaking table (220rpm/min).Effectively transform, the amount of bacterium should be no more than 10
8/ ml.Under aseptic condition, culture is transferred in the aseptic disposable ice-cold centrifuge tube, placed on ice 10 minutes, make culture be cooled to 0 ℃.In 4 ℃ of centrifugal 10min of 4000rpm, reclaim cell.Pour out nutrient solution, pipe is inverted 1min so that the trace nutrient solution of final residual flows to end.Bacterial precipitation is resuspended in the ice-cold CaCl2 of 10ml0.1M, places 15min on ice, 4 ℃ of centrifugal 10min reclaim cell.Every 50ml culture is with the resuspended precipitation of CaCl2 of 2ml 0.1mM, adds 140ul DMSO in the resuspended cell of every 4ml, places 15min on ice.Add 140ul DMSO in every part of suspension again, be reentered in the ice bath.Competent cell is sub-packed in the Eppendorf pipe.The 100ul/ pipe is stored in-70 ℃ of refrigerators.
2) transform
Take out frozen competent cell, place on ice and treated its dissolving in 5-10 minute.Add 10 μ l and connect product. ice bath 30min.This mixture is placed 42 ℃ of water-bath 45s-60s, rapidly reactant is placed 2-3min on ice, add 250 μ l SOC nutrient solutions.In 37 ℃ of shaking table 220rpm jolting 60min.Take out culture, nutrient solution is coated on the flat board that contains 100 μ g/ml penicillin, after question response liquid is blotted by flat board, flat board is placed on 37 ℃ of overnight incubation.After the 16-20hr, the plate inspection of making even, and carry out colony screening.
3) screening of recon
Available Mai Kangkai substratum screens, and utilizes its color reaction to judge possible recon.Usually, there is the segmental bacterium of insertion to have color reaction, shows as white colony.To not show as red bacterium colony and insert segmental bacterium colony.After the color reaction preliminary evaluation, do further screening with the PCR reaction, put into the PCR pipe with the single clone of toothpick picking who sterilizes, as dna profiling, the clone is carried out the PCR positive-selecting with gene-specific primer.The PCR product is through agarose electrophoresis, and EB dyeing with standard control, is determined positive colony,
The PCR condition is:
94 ℃ of sex change 5min;
28 circulations: 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 45s;
72 ℃ are extended 10min; 4 ℃ of insulations.
4) order-checking: detected positive colony is sent order-checking.
5) carry out at the Pichia methanolicaExpression System of the conversion employing Invitrogen of barms Corporation and with reference to its explanation.
Black porgy tumor necrosis factor alpha (TNF α) cDNA sequence: (referring to SEQ ID NO.1 in the sequence table)
1 AGCAGGCAGTAACGACAGAGAGCAGACTTGTGCACAGTATGGTGGCATACACAACAGCTC
61 CATGTGACTTGGAGATGGGTCCTGAGGAGAGGACGGTAGTCTTGATAGAGAAGAAGTCAG
121 CTACAGGGTGGATGTGGAAGGTGTCCGTGGCCCTGCTCGTCGCAGCACTTGCTTTCGCAG
181 GCGTCCTGCTGTTTGCTTGGTATTGGAATGGCAAGCCAGAAATTCTGATACATTCAGGCC
241 AAACAGAGGCGCTAACCAAGAATGACCACACTGAGAAAACAGATCCCCACTCCACGCTGA
301 GGCGCATCAGCAGCAAAGCCAAGGCAGCCATCCATTTAGAAGGGAGCTATGATGAAGACG
361 AAGGTTTGAAAGACCAGGTGGAGTGGAAGAATGGTCAAGGCCAGGCGTTCGCTCAGGGCG
421 GCTTCCGACTGGTGGACAATAAGATCGTGATCCCGCAGACCGGCCTCTACTTCGTCTACA
481 GCCAGGCGTCGTTCAGAGTCTCCTGCAGCGATGGCGACGAGGAGGGAGCAGGGAGACACC
541 TCACACCTCTCAGCCACACCATCTCGCGCTACTCAGAGTCCATGGGCACTGATGTGTCTC
601 TGATGAGCGCGGTGAGGTCGGCGTGCCAGAACACCGCTCACGAGGACAGCTACAGCGACG
661 GACGGGGCTGGTACAACACCATCTATCTGGGCGCCGTGTTTCAGCTGAACAGAGGTGACA
721 GACTGGAGACGGAAACCAACCAGTTGTCAGAGCTGGAGACAGACGAGGGCAAGACCTTCT
781 TCGGTGTGTTTGCACTTTAAAATGACTGTGATACTGACAGAGAGGACGCAAAGCCTTGCA
841 CAGTGCCAAAAGTTTGGCTTTTCTGAAAGATTTTATTTGAATTTTTATTATTCATCTTCA
901 TGGTGATGTAGAAATGTTGAAATCTCAATGGAGATAACGCTTGCGGCTGAACAGGCGCTG
961 CTGATTTTTTAAAATCCTATAAACTGTAACAGTTTGAAATGTTATTTCTATTTTAGGCAC
1021 TTTTTGTACATTATTTATGCTGACCTGAGATTGTAGTAGGCCAGACTCTCTCTGCTGTAT
1081 CTGATGACGACACAGCTCTTCACTGGAGAGTGCAGGTTTTTGAGGATTATCTACAGAATT
1141 GTTATCATGTACCAATACAGCCTGTATGTATTTATTTGTATTTATTTATATTTAAATTGT
1201 TGGGGTAAGGTGTTGAAAGATTTATATTTATATGTGCACATAAACTTAATTAAAATGCAA
1261 AAAAACCCAAAAGAAAAAAAAAAAAAAA
Sequence signature:
Length: 1288 base pairs
Type: nucleic acid
Chain: two strands
Topological framework: linear
Source: black porgy (Acanthopagrus schlegeli)
The aminoacid sequence of black porgy tumor necrosis factor alpha (TNF α) proteins encoded: (referring to SEQ ID NO.2 in the sequence table)
1?MVAYTTAPCD?LEMGPEERTV?VLIEKKSATG?WMWKVSVALL?VAALAFAGVL?LFAWYWNGKP
61?EILIHSGQTE?ALTKNDHTEK?TDPHSTLRRI?SSKAKAAIHL?EGSYDEDEGL?KDQVEWKNGQ
121?GQAFAQGGFR?LVDNKIVIPQ?TGLYFVYSQA?SFRVSCSDGD?EEGAGRHLTP?LSHTISRYSE
181?SMGTDVSLMS?AVRSACQNTA?HEDSYSDGRG?WYNTIYLGAV?FQLNRGDRLE?TETNQLSELE
241?TDEGKTFFGV?FAL
Sequence signature:
Length: 253 amino acid
Type: amino acid
Chain: strand
Topological framework: linear
Source: black porgy (Acanthopagrus schlegeli)
The black porgy tumor necrosis factor alpha of escherichia coli expression (TNF α) cDNA and aminoacid sequence: (referring to SEQ ID NO.3 and 4)
1?TCATTAAAGAGGAGAAATTAACTATGAGAGGATCGCATCACCATCACCATCACGGATCCC
1 I K E E K L T M R G S
H H H H H H G S L
61 TGAGGCGCATCAGCAGCAAAGCCAAGGCAGCCATCCATTTAGAAGGGAGCTATGATGAAG
21 R R I S S K A K A A I H L E G S Y D E D
121 ACGAAGGTTTGAAAGACCAGGTGGAGTGGAAGAATGGTCAAGGCCAGGCGTTCGCTCAGG
41 E G L K D Q V E W K N G Q G Q A F A Q G
181 GCGGCTTCCGACTGGTGGACAATAAGATCGTGATCCCGCAGACCGGCCTCTACTTCGTCT
61 G F R L V D N K I V I P Q T G L Y F V Y
241 ACAGCCAGGCGTCGTTCAGAGTCTCCTGCAGCGATGGCGACGAGGAGGGAGCAGGGAGAC
81 S Q A S F R V S C S D G D E E G A G R H
301 ACCTCACACCTCTCAGCCACACCATCTCGCGCTACTCAGAGTCCATGGGCACTGATGTGT
101 L T P L S H T I S R Y S E S M G T D V S
361 CTCTGATGAGCGCGGTGAGGTCGGCGTGCCAGAACACCGCTCACGAGGACAGCTACAGCG
121 L M S A V R S A C Q N T A H E D S Y S D
421 ACGGACGGGGCTGGTACAACACCATCTATCTGGGCGCCGTGTTTCAGCTGAACAGAGGTG
141 G R G W Y N T I Y L G A V F Q L N R G D
481 ACAGACTGGAGACGGAAACCAACCAGTTGTCAGAGCTGGAGACAGACGAGGGCAAGACCT
161 R L E T E T N Q L S E L E T D E G K T F
541 TCTTCGGTGTGTTTGCACTTTAA
181 F G V F A L *
The black porgy tumor necrosis factor alpha of yeast expression (TNF α) cDNA and aminoacid sequence: (referring to SEQ ID NO.5 and 6 in the sequence table)
1 CGAGgCAAAATGCTGAGGCGCATCAGCAGCAAAGCCAAGGCAGCCATCCATTTAGAAGGG
1 R G K M L R R I S S K A K A A I H L E G
61 AGCTATGATGAAGACGAAGGTTTGAAAGACCAGGTGGAGTGGAAGAATGGTCAAGGCCAG
21 S Y D E D E G L K D Q V E W K N G Q G Q
121 GCGTTCGCTCAGGGCGGCTTCCGACTGGTGGACAATAAGATCGTGATCCCGCAGACCGGC
41 A F A Q G G F R L V D N K I V I P Q T G
181 CTCTACTTCGTCTACAGCCAGGCGTCGTTCAGAGTCTCCTGCAGCGATGGCGACGAGGAG
61 L Y F V Y S Q A S F R V S C S D G D E E
241 GGAGCAGGGAGACACCTCACACCTCTCAGCCACACCATCTCGCGCTACTCAGAGTCCATG
81 G A G R H L T P L S H T I S R Y S E S M
301 GGCACTGATGTGTCTCTGATGAGCGCGGTGAGGTCGGCGTGCCAGAACACCGCTCACGAG
101 G T D V S L M S A V R S A C Q N T A H E
361 GACAGCTACAGCGACGGACGGGGCTGGTACAACACCATCTATCTGGGCGCCGTGTTTCAG
121 D S Y S D G R G W Y N T I Y L G A V F Q
421 CTGAACAGAGGTGACAGACTGGAGACGGAAACCAACCAGTTGTCAGAGCTGGAGACAGAC
141 L N R G D R L E T E T N Q L S E L E T D
481 GAGGGCAAGACCTTCTTCGGTGTGTTTGCACTTAGGATCCACGCGTCGTCGACCCGCGGC
161 E G K T F F G V F A L R I H A S S T R G
541 GGCCGCCAGCTTCCTAGGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG
181 G R Q L P R G K P I P N P L L G L D S T
601 CGTACCGGTCATCATCACCATCACCAT
201 R T G H H H H H H
Embodiment 1. utilizes escherichia expression system to express the black porgy tumor necrosis factor alpha, is example with pQE30.
(1) with PCR method clone black porgy tumor necrosis factor alpha gene.
(2) carry out PCR with the primer that has the specificity restriction enzyme site, amplification purpose fragment, and with this fragment subclone to expression vector, make up recombinant expression vector.
(3), recombinant vectors is transformed into intestinal bacteria, the preparation engineering bacterium with chemical transformation.
(4) induce engineering strain to express with IPTG.
(5) with nickel metal affinity chromatography or immunoaffinity chromatography separation and purification recombinant protein.
Embodiment 2. utilizes yeast expression system to express the black porgy tumor necrosis factor alpha, is example with the pMETA carrier.
(1) with PCR method clone black porgy tumor necrosis factor alpha gene.
(2) carry out PCR with the primer that has specificity restriction enzyme site and yeast expression initiating sequence, amplification purpose fragment, and with this fragment subclone to expression vector, make up recombinant expression vector.
(3) with electrotransfer method and chemical transformation, recombinant vectors is transformed into pichia methanolica, the preparation engineering bacterium.
(4) express with the methanol induction engineering strain.
(5) with the granulated glass sphere smudge cells.
(6) obtain immunoaffinity chromatography separation and purification recombinant protein with the nickel metal affinity chromatography.
Embodiment 3: the expression product of embodiment 1,2 is as additive of bait or medicated premix
Recombination yeast is directly broken, with the yeast of fragmentation directly as the added ingredients of bait, as the immunostimulant of aquaculture organism, improve aquaculture organism to disease and stress resistibility; Behind the purifying 1,2 recombinant products are as the application of medicine on aquaculture organism.Marine cultured animal comprises the additive of bait of fish, shrimp and shellfish, bird additive of bait and domestic animals additive of bait etc.
The expression product of embodiment 4. embodiment 1,2 is as immunostimulant
The recombinant products of purifying and various vaccine share, and strengthen the immunizing potency and the immune protective efficiency of vaccine.As: share with various vaccines and the vaccine of fish, increase the protection of vaccine fish; Share with various veterinary vaccines, increase the protection of vaccine animal products.
The expression product of embodiment 5. embodiment 1,2 is as the disease control medicine
When disease takes place, directly use 1,2 purified products as multiple prevention or the medicine of preventing and treating disease, fish and other animal diseases are treated.
The expression product of embodiment 6. embodiment 1,2 is used for the fish immunity Study on Mechanism
Directly the purified product of use-case 1,2 or the monoclonal antibody or the polyclonal antibody of example 1,2 carry out fish and other animal immune Study on Mechanism.
Black porgy
SEQUENCE?LISTING
＜110〉Institute of Oceanology of the Chinese Academy of Sciences
＜120〉recombinant expression method of black porgy tumor necrosis factor alpha gene
<130>
<160>6
<170>PatentIn?version?3.1
<210>1
<211>1288
<212>DNA
＜213〉black porgy (Acanthopagrus schlegeli)
<220>
<221>CDS
<222>(39)..(797)
<223>
<400>1
agcaggcagt?aacgacagag?agcagacttg?tgcacagt?atg?gtg?gca?tac?aca?aca 56
Met?Val?Ala?Tyr?Thr?Thr
1 5
gct?cca?tgt?gac?ttg?gag?atg?ggt?cct?gag?gag?agg?acg?gta?gtc?ttg 104
Ala?Pro?Cys?Asp?Leu?Glu?Met?Gly?Pro?Glu?Glu?Arg?Thr?Val?Val?Leu
10 15 20
ata?gag?aag?aag?tca?gct?aca?ggg?tgg?atg?tgg?aag?gtg?tcc?gtg?gcc 152
Ile?Glu?Lys?Lys?Ser?Ala?Thr?Gly?Trp?Met?Trp?Lys?Val?Ser?Val?Ala
25 30 35
ctg?ctc?gtc?gca?gca?ctt?gct?ttc?gca?ggc?gtc?ctg?ctg?ttt?gct?tgg 200
Leu?Leu?Val?Ala?Ala?Leu?Ala?Phe?Ala?Gly?Val?Leu?Leu?Phe?Ala?Trp
40 45 50
tat?tgg?aat?ggc?aag?cca?gaa?att?ctg?ata?cat?tca?ggc?caa?aca?gag 248
Tyr?Trp?Asn?Gly?Lys?Pro?Glu?Ile?Leu?Ile?His?Ser?Gly?Gln?Thr?Glu
55 60 65 70
Black porgy
gcg?cta?acc?aag?aat?gac?cac?act?gag?aaa?aca?gat?ccc?cac?tcc?acg 296
Ala?Leu?Thr?Lys?Asn?Asp?His?Thr?Glu?Lys?Thr?Asp?Pro?His?Ser?Thr
75 80 85
ctg?agg?cgc?atc?agc?agc?aaa?gcc?aag?gca?gcc?atc?cat?tta?gaa?ggg 344
Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?AIa?Ala?Ile?His?Leu?Glu?Gly
90 95 100
agc?tat?gat?gaa?gac?gaa?ggt?ttg?aaa?gac?cag?gtggag?tgg?aag?aat 392
Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp?Gln?Val?Glu?Trp?Lys?Asn
105 110 115
ggt?caa?ggc?cag?gcg?ttc?gct?cag?ggc?ggc?ttc?cga?ctg?gtg?gac?aat 440
Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly?Phe?Arg?Leu?Val?Asp?Asn
120 125 130
aag?atc?gtg?atc?ccg?cag?acc?ggc?ctc?tacttc?gtc?tac?agc?cag?gcg 488
Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr?Phe?Val?Tyr?Ser?Gln?Ala
135 140 145 150
tcg?ttc?aga?gtc?tcc?tgc?agc?gat?ggc?gac?gag?gag?gga?gca?ggg?aga 536
Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp?Glu?Glu?Gly?Ala?Gly?Arg
155 160 165
cac?ctc?aca?cct?ctc?agc?cac?acc?atc?tcg?cgc?tac?tca?gag?tcc?atg 584
His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser?Arg?Tyr?Ser?Glu?Ser?Met
170 175 180
ggc?act?gat?gtg?tct?ctg?atg?agc?gcg?gtg?agg?tcg?gcg?tgc?cag?aac 632
Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val?Arg?Ser?Ala?Cys?Gln?Asn
185 190 195
acc?gct?cac?gag?gac?agc?tac?agc?gac?gga?cgg?ggc?tgg?tac?aac?acc 680
Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly?Arg?Gly?Trp?Tyr?Asn?Thr
200 205 210
atc?tat?ctg?ggc?gcc?gtg?ttt?cag?ctg?aac?aga?ggt?gac?aga?ctg?gag 728
Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn?Arg?Gly?Asp?Arg?Leu?Glu
215 220 225 230
acg?gaa?acc?aac?cag?ttg?tca?gag?ctg?gag?aca?gac?gag?ggc?aag?acc 776
Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu?Thr?Asp?Glu?Gly?Lys?Thr
235 240 245
ttc?ttc?ggt?gtg?tttgca?ctt?taaaatgact?gtgatactga?cagagaggac 827
Phe?Phe?Gly?Val?Phe?Ala?Leu
250
gcaaagcctt?gcacagtgcc?aaaagtttgg?cttttctgaa?agattttatt?tgaattttta 887
ttattcatct?tcatggtgat?gtagaaatgt?tgaaatctca?atggagataa?cgcttgcggc 947
tgaacaggcg?ctgctgattt?tttaaaatcc?tataaactgt?aacagtttga?aatgttattt 1007
ctattttagg?cactttttgt?acattattta?tgctgacctg?agattgtagt?aggccagact 1067
ctctctgctg?tatctgatga?cgacacagct?cttcactgga?gagtgcaggt?ttttgaggat 1127
tatctacaga?attgttatca?tgtaccaata?cagcctgtat?gtatttattt?gtatttattt 1187
atatttaaat?tgttggggta?aggtgttgaa?agatttatat?ttatatgtgc?acataaactt 1247
aattaaaatg?caaaaaaacc?caaaagaaaa?aaaaaaaaaa?a 1288
Black porgy
<210>2
<211>253
<212>PRT
＜213〉black porgy (Acanthopagrus schlegeli)
<400>2
Met?Val?Ala?Tyr?Thr?Thr?Ala?Pro?Cys?Asp?Leu?Glu?Met?Gly?Pro?Glu
1 5 10 15
Glu?Arg?Thr?Val?Val?Leu?Ile?Glu?Lys?Lys?Ser?Ala?Thr?Gly?Trp?Met
20 25 30
Trp?Lys?Val?Ser?Val?Ala?Leu?Leu?Val?Ala?Ala?Leu?Ala?Phe?Ala?Gly
35 40 45
Val?Leu?Leu?Phe?Ala?Trp?Tyr?Trp?Asn?Gly?Lys?Pro?Glu?Ile?Leu?Ile
50 55 60
His?Ser?Gly?Gln?Thr?Glu?Ala?Leu?Thr?Lys?Asn?Asp?His?Thr?Glu?Lys
65 70 75 80
Thr?Asp?Pro?His?Ser?Thr?Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?Ala
85 90 95
Ala?Ile?His?Leu?Glu?Gly?Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp
100 105 110
Gln?Val?Glu?Trp?Lys?Asn?Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly
115 120 125
Phe?Arg?Leu?Val?Asp?Asn?Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr
130 135 140
Phe?Val?Tyr?Ser?Gln?Ala?Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp
145 150 155 160
Glu?Glu?Gly?Ala?Gly?Arg?His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser
165 170 175
Arg?Tyr?Ser?Glu?Ser?Met?Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val
180 185 190
Arg?Ser?Ala?Cys?Gln?Asn?Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly
195 200 205
Black porgy
Arg?Gly?Trp?Tyr?Asn?Thr?Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn
210 215 220
Arg?Gly?Asp?Arg?Leu?Glu?Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu
225 230 235 240
Thr?Asp?Glu?Gly?Lys?Thr?Phe?Phe?Gly?Val?Phe?Ala?Leu
245 250
<210>3
<211>563
<212>DNA
＜213〉black porgy (Acanthopagrus schlegeli)
<220>
<221>CDS
<222>(3)..(560)
<223>
<400>?3
tc?att?aaa?gag?gag?aaa?tta?act?atg?aga?gga?tcg?cat?cac?cat?cac 47
Ile?Lys?Glu?Glu?Lys?Leu?Thr?Met?Arg?Gly?Ser?His?His?His?His
1 5 10 15
cat?cac?gga?tcc?ctg?agg?cgc?atc?agc?agc?aaa?gcc?aag?gca?gcc?atc 95
His?His?Gly?Ser?Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?Ala?Ala?Ile
20 25 30
cat?tta?gaa?ggg?agc?tat?gat?gaa?gac?gaa?ggt?ttg?aaa?gac?cag?gtg 143
His?Leu?Glu?Gly?Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp?Gln?Val
35 40 45
gag?tgg?aag?aat?ggt?caa?ggc?cag?gcg?ttc?gct?cag?ggc?ggc?ttc?cga 191
Glu?Trp?Lys?Asn?Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly?Phe?Arg
50 55 60
ctg?gtg?gac?aat?aag?atc?gtg?atc?ccg?cag?acc?ggc?ctc?tacttc?gtc 239
Leu?Val?Asp?Asn?Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr?Phe?Val
65 70 75
tac?agc?cag?gcg?tcg?ttc?aga?gtc?tcc?tgc?agc?gat?ggc?gac?gag?gag 287
Tyr?Ser?Gln?Ala?Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp?Glu?Glu
80 85 90 95
gga?gca?ggg?aga?cac?ctc?aca?cct?ctc?agc?cac?acc?atc?tcg?cgc?tac 335
Gly?Ala?Gly?Arg?His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser?Arg?Tyr
100 105 110
tca?gag?tcc?atg?ggc?act?gat?gtg?tct?ctg?atg?agc?gcg?gtg?agg?tcg 383
Black porgy
Ser?Glu?Ser?Met?Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val?Arg?Ser
115 120 125
gcg?tgc?cag?aac?acc?gct?cac?gag?gac?agc?tac?agc?gac?gga?cgg?ggc 431
Ala?Cys?Gln?Asn?Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly?Arg?Gly
130 135 140
tgg?tac?aac?acc?atc?tat?ctg?ggc?gcc?gtg?ttt?cag?ctg?aac?aga?ggt 479
Trp?Tyr?Asn?Thr?Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn?Arg?Gly
145 150 155
gac?aga?ctg?gag?acg?gaa?acc?aac?cag?ttg?tca?gag?ctg?gag?aca?gac 527
Asp?Arg?Leu?Glu?Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu?Thr?Asp
160 165 170 175
gag?ggc?aag?acc?ttc?ttc?ggt?gtg?ttt?gca?ctt?taa 563
Glu?Gly?Lys?Thr?Phe?Phe?Gly?Val?Phe?Ala?Leu
180 185
<210>4
<211>186
<212>PRT
＜213〉black porgy (Acanthopagrus schlegeli)
<400>4
Ile?Lys?Glu?Glu?Lys?Leu?Thr?Met?Arg?Gly?Ser?His?His?His?His?His
1 5 10 15
His?Gly?Ser?Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?Ala?Ala?Ile?His
20 25 30
Leu?Glu?Gly?Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp?Gln?Val?Glu
35 40 45
Trp?Lys?Asn?Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly?Phe?Arg?Leu
50 55 60
Val?Asp?Asn?Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr?Phe?Val?Tyr
65 70 75 80
Ser?Gln?Ala?Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp?Glu?Glu?Gly
85 90 95
Ala?Gly?Arg?His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser?Arg?Tyr?Ser
100 105 110
Glu?Ser?Met?Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val?Arg?Ser?Ala
115 120 125
Black porgy
Cys?Gln?Asn?Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly?Arg?Gly?Trp
130 135 140
Tyr?Asn?Thr?Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn?Arg?Gly?Asp
145 150 155 160
Arg?Leu?Glu?Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu?Thr?Asp?Glu
165 170 175
Gly?Lys?Thr?Phe?Phe?Gly?Val?Phe?Ala?Leu
180 185
<210>5
<211>627
<212>DNA
＜213〉black porgy (Acanthopagrus schlegeli)
<220>
<221>CDS
<222>(1)..(627)
<223>
<400>5
cga?ggc?aaa?atg?ctg?agg?cgc?atc?agc?agc?aaa?gcc?aag?gca?gcc?atc 48
Arg?Gly?Lys?Met?Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?Ala?Ala?Ile
1 5 10 15
cat?tta?gaa?ggg?agc?tat?gat?gaa?gac?gaa?ggt?ttg?aaa?gac?cag?gtg 96
His?Leu?Glu?Gly?Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp?Gln?Val
20 25 30
gag?tgg?aag?aat?ggt?caa?ggc?cag?gcg?ttc?gct?cag?ggc?ggc?ttc?cga 144
Glu?Trp?Lys?Asn?Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly?Phe?Arg
35 40 45
ctg?gtg?gac?aat?aag?atc?gtg?atc?ccg?cag?acc?ggc?ctc?tacttc?gtc 192
Leu?Val?Asp?Asn?Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr?Phe?Val
50 55 60
tac?agc?cag?gcg?tcg?ttc?aga?gtc?tcc?tgc?agc?gat?ggc?gac?gag?gag 240
Tyr?Ser?Gln?Ala?Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp?Glu?Glu
65 70 75 80
gga?gca?ggg?aga?cac?ctc?aca?cct?ctc?agc?cac?acc?atc?tcg?cgc?tac 288
Gly?Ala?Gly?Arg?His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser?Arg?Tyr
85 90 95
tca?gag?tcc?atg?ggc?act?gat?gtg?tct?ctg?atg?agc?gcg?gtg?agg?tcg 336
Ser?Glu?Ser?Met?Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val?Arg?Ser
100 105 110
Black porgy
gcg?tgc?cag?aac?acc?gct?cac?gag?gac?agc?tac?agc?gac?gga?cgg?ggc 384
Ala?Cys?Gln?Asn?Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly?Arg?Gly
115 120 125
tgg?tac?aac?acc?atc?tat?ctg?ggc?gcc?gtg?ttt?cag?ctg?aac?aga?ggt 432
Trp?Tyr?Asn?Thr?Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn?Arg?Gly
130 135 140
gac?aga?ctg?gag?acg?gaa?acc?aac?cag?ttg?tca?gagctg?gag?aca?gac 480
Asp?Arg?Leu?Glu?Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu?Thr?Asp
145 150 155 160
gag?ggc?aag?acc?ttc?ttc?ggt?gtg?ttt?gca?ctt?agg?atc?cac?gcg?tcg 528
Glu?Gly?Lys?Thr?Phe?Phe?Gly?Val?Phe?Ala?Leu?Arg?Ile?His?Ala?Ser
165 170 175
tcg?acc?cgc?ggc?ggc?cgc?cag?ctt?cct?agg?ggt?aag?cct?atc?cct?aac 576
Ser?Thr?Arg?Gly?Gly?Arg?Gln?Leu?Pro?Arg?Gly?Lys?Pro?Ile?Pro?Asn
180 185 190
cct?ctc?ctc?ggt?ctc?gat?tct?acg?cgt?acc?ggt?cat?cat?cac?cat?cac 624
Pro?Leu?Leu?Gly?Leu?Asp?Ser?Thr?Arg?Thr?Gly?His?His?His?His?His
195 200 205
cat 627
His
<210>6
<211>209
<212>PRT
＜213〉black porgy (Acanthopagrus schlegeli)
<400>6
Arg?Gly?Lys?Met?Leu?Arg?Arg?Ile?Ser?Ser?Lys?Ala?Lys?Ala?Ala?Ile
1 5 10 15
His?Leu?Glu?Gly?Ser?Tyr?Asp?Glu?Asp?Glu?Gly?Leu?Lys?Asp?Gln?Val
20 25 30
Glu?Trp?Lys?Asn?Gly?Gln?Gly?Gln?Ala?Phe?Ala?Gln?Gly?Gly?Phe?Arg
35 40 45
Leu?Val?Asp?Asn?Lys?Ile?Val?Ile?Pro?Gln?Thr?Gly?Leu?Tyr?Phe?Val
50 55 60
Tyr?Ser?Gln?Ala?Ser?Phe?Arg?Val?Ser?Cys?Ser?Asp?Gly?Asp?Glu?Glu
65 70 75 80
Gly?Ala?Gly?Arg?His?Leu?Thr?Pro?Leu?Ser?His?Thr?Ile?Ser?Arg?Tyr
85 90 95
Black porgy
Ser?Glu?Ser?Met?Gly?Thr?Asp?Val?Ser?Leu?Met?Ser?Ala?Val?Arg?Ser
100 105 110
Ala?Cys?Gln?Asn?Thr?Ala?His?Glu?Asp?Ser?Tyr?Ser?Asp?Gly?Arg?Gly
115 120 125
Trp?Tyr?Asn?Thr?Ile?Tyr?Leu?Gly?Ala?Val?Phe?Gln?Leu?Asn?Arg?Gly
130 135 140
Asp?Arg?Leu?Glu?Thr?Glu?Thr?Asn?Gln?Leu?Ser?Glu?Leu?Glu?Thr?Asp
145 150 155 160
Glu?Gly?Lys?Thr?Phe?Phe?Gly?Val?Phe?Ala?Leu?Arg?Ile?His?Ala?Ser
165 170 175
Ser?Thr?Arg?Gly?Gly?Arg?Gln?Leu?Pro?Arg?Gly?Lys?Pro?Ile?Pro?Asn
180 185 190
Pro?Leu?Leu?Gly?Leu?Asp?Ser?Thr?Arg?Thr?Gly?His?His?His?His?His
195 200 205
His
Claims (6)
1. the recombinant expression method of black porgy tumor necrosis factor alpha gene comprises the separation and purification and the evaluation of construction of recombinant vector, conversion and screening, expression product, it is characterized in that:
1) construction of recombinant vector: according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, utilize a pair of Auele Specific Primer rTF to introduce two different restriction endonuclease sites of BamHI and HindIII at its two ends with rTR, be cloned into expression vector, carrier comprises pQE series, pET series, pGEX-4T series, pPIC series and p6APZ series;
2) transform and screening
The recombinant expression vector that obtains that makes up is transformed in bacillus coli DH 5 alpha, Jm109, XL1-b1ue or pichia spp, the saccharomyces pastorianus, carries out the PCR bidirectional screening; The positive colony that obtains carries out plasmid purification, the digestion with restriction enzyme checking; And after sequencing was identified, the positive colony that is screened carried out abduction delivering to bacterium or yeast respectively as the preparation engineering strain;
3) separation and purification of expression product: adopt inductor to induce the expression of engineering bacteria, directly get supernatant liquor or through lysate or granulated glass sphere lysing cell, carry out purifying with affine layer method, the SDS-PAGE electrophoresis is identified.
2. according to the recombinant expression method of the described black porgy tumor necrosis factor alpha gene of claim 1, it is characterized in that: described construction of recombinant vector is divided into:
The structure of prokaryotic system expression vector: according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, utilize a pair of gene-specific primer rTF5 '-TAG GAT CCC TGA GGC GCA TCA GCAG-3 ' and rTR 5 '-GCG AAG CTT AAG TGC AAA CAC ACC GAA G-3 ', introduce two different restriction endonuclease sites of BamHI, HindIII respectively at the primer two ends, increasing through the enterprising performing PCR of the black porgy cDNA that infects, PCR product subclone to expression vector pQE30, is finished the structure of prokaryotic system expression vector;
The structure of eukaryotic system expression vector: according to the cDNA sequence of black porgy tumor necrosis factor alpha mature peptide, adopt another Auele Specific Primer ryTF5 '-CAG AGC TCG CAA AAT GCTGAG GCG CAT CA-3 ' and yrTR:5 '-ATG GAT CCT AAG TGC AAA CAC ACC GAA-3 ' to containing restriction enzyme site, this Auele Specific Primer contains SacI and two restriction enzyme sites of BamHI respectively, in the head-kidney cDNA library that Vibrio anguillarum infects, carry out pcr amplification black porgy, amplified production is behind SacI and two digestion with restriction enzyme of BamHI, subclone is finished and is used for different hosts and transforms required expression vector establishment to pMETA fabric shuttle-type expression vector.
3. according to the recombinant expression method of the described black porgy tumor necrosis factor alpha gene of claim 1, it is characterized in that: the described protokaryon engineering bacteria of inducing is an isopropyl-at the inductor of escherichia coli expression; Inducing the recombination yeast engineering bacteria is methyl alcohol at the inductor of yeast expression.
4. according to the recombinant expression method of the described black porgy tumor necrosis factor alpha gene of claim 1, it is characterized in that: after inducing, the bacterium liquid of amalgamation and expression is through lysate or granulated glass sphere cracking, the secretion type expression cell is directly collected supernatant liquor, carry out immunoaffinity chromatography with the 6His monoclonal antibody, or, identify with the SDS-PAGE electrophoresis with nickel metal affinity chromatography purifying.
5. according to the recombinant expression method of the described black porgy tumor necrosis factor alpha gene of claim 4, it is characterized in that: the nickel metal affinity purification colloid that described nickel metal affinity chromatography purifying uses is: Ni-NTA.
6. according to the recombinant expression method of the described black porgy tumor necrosis factor alpha gene of claim 1, it is characterized in that: the activity identification that after the separation and purification of expression product, should carry out expression product, its authentication method is, with the reorganization black porgy tumor necrosis factor alpha recombinant protein behind the purifying, the scavenger cell of stimulated in vitro black porgy and porgy detects interleukin-11 β, TNF α, TGF β and IL8 cytokine by the abduction delivering of recombinant protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100503312A CN1328382C (en) | 2004-08-27 | 2004-08-27 | Recombination expression method for black porgy tumor necrosis factor alph gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100503312A CN1328382C (en) | 2004-08-27 | 2004-08-27 | Recombination expression method for black porgy tumor necrosis factor alph gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1740321A CN1740321A (en) | 2006-03-01 |
| CN1328382C true CN1328382C (en) | 2007-07-25 |
Family
ID=36092853
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100503312A Expired - Fee Related CN1328382C (en) | 2004-08-27 | 2004-08-27 | Recombination expression method for black porgy tumor necrosis factor alph gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1328382C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229995B (en) * | 2011-05-31 | 2013-03-20 | 中国农业科学院饲料研究所 | Kit for detecting fish immune factor level |
| CN102998457B (en) * | 2012-07-12 | 2015-08-26 | 电子科技大学 | The Competitive assays enzyme-linked immune detection method of grass carp TNFa lpha |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1272549A (en) * | 1999-05-04 | 2000-11-08 | 同济医科大学 | GFP-TNF-alpha fusion protein prokaryotic expression system construction and its product and application |
-
2004
- 2004-08-27 CN CNB2004100503312A patent/CN1328382C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1272549A (en) * | 1999-05-04 | 2000-11-08 | 同济医科大学 | GFP-TNF-alpha fusion protein prokaryotic expression system construction and its product and application |
Non-Patent Citations (1)
| Title |
|---|
| 虹鳟肿瘤坏死因子(TNFα)基因体外表达与纯化的研究 蔡中华，水生生物学报，第27卷第6期 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1740321A (en) | 2006-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ordás et al. | Turbot TNFα gene: molecular characterization and biological activity of the recombinant protein | |
| Yu et al. | Molecular cloning and characterization of a putative lipopolysaccharide-induced TNF-α factor (LITAF) gene homologue from Zhikong scallop Chlamys farreri | |
| CN101137391B (en) | Uses of recombinant super-compound interferon | |
| CN102399784B (en) | CpG oligonucleotide possessing immune enhancement activity to aquatic livestock, its preparation method and its application | |
| CN101967485A (en) | Human FGF21 mutant gene and method for preparing recombinant human FGF21 protein | |
| HRP20100340T1 (en) | Polypeptides having antimicrobial activity and polynucleotides encoding same | |
| CN109627316B (en) | Grass carp IFN-gamma 2 gene, recombinant protein coded by same and application of gene | |
| CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
| CN1328382C (en) | Recombination expression method for black porgy tumor necrosis factor alph gene | |
| CN101356191A (en) | Neuropeptides for the culture of aquatic organisms | |
| CN110042102A (en) | It is a kind of can it is mosquito-proof control mosquito double-stranded RNA, expression vector and its application | |
| CN108822220A (en) | Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon | |
| CN1772298A (en) | The pIL-6 gene adjuvant for pig vaccine and its prepn process | |
| CN1207305C (en) | Preparing process and application of recombined human interleukin-11 | |
| CN1752210A (en) | Chicken interferon gamma, preparing process and use thereof | |
| CN107217068A (en) | A kind of method for improving canine recombinant interferon alpha fusion protein antiviral activity | |
| CN102899331A (en) | Complex duck interferon-alpha gene, and recombinant vector and application thereof | |
| CN109851666A (en) | A kind of recombinant IFN-alpha albumen and its encoding gene and application | |
| CN1157477C (en) | Engineering fungus containing large-scale salmon growth factor | |
| Antony et al. | Molecular characterization and phylogenetic analysis of a penaeidin-like antimicrobial peptide, Fi-penaeidin from Fenneropenaeus indicus | |
| CN104531691A (en) | Primers for obtaining genes of bovine interferon alpha and preparation method for recombinant bovine interferon alpha | |
| CN100352841C (en) | Antibiotic peptide and its coding sequence and uses | |
| CN1247794C (en) | Production process of human horny cell growth factor-2 | |
| CN1239516C (en) | Tumor necrosis factor relative cell death inducing ligand extracellular region mutation polypeptide and its prepn and use | |
| BR0209911A (en) | nucleic acid and protein sequence of bovine epidermal growth factor and its uses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070725 Termination date: 20100827 |