CN103509099B - Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof - Google Patents
Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof Download PDFInfo
- Publication number
- CN103509099B CN103509099B CN201310347678.2A CN201310347678A CN103509099B CN 103509099 B CN103509099 B CN 103509099B CN 201310347678 A CN201310347678 A CN 201310347678A CN 103509099 B CN103509099 B CN 103509099B
- Authority
- CN
- China
- Prior art keywords
- csw2
- female
- gene
- cynoglossus semilaevis
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/142—Amino acids; Derivatives thereof
- A23K20/147—Polymeric derivatives, e.g. peptides or proteins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/80—Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Animal Husbandry (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Insects & Arthropods (AREA)
- Marine Sciences & Fisheries (AREA)
- Biophysics (AREA)
- Birds (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a female cynoglossus semilaevis specific protein CSW2, whose amino acid sequence is represented by the SEQ ID No.2; the sequence of the nucleotide, which encodes the female cynoglossus semilaevis specific protein CSW2, is represented by the SEQ ID No.1. The external recombinant protein of the CSW2 gene can prominently improve the aromatizing enzyme expression level of female cynoglossus semilaevis fry related genes, namely fox12 and P450, has a biological activity which can promote female-related gene expression, and at the same time has a biological activity that can reduce the expression level of male-related gene SOX9. The recombinant expression product of CSW2 can be used as a feed addictive, which has the function of promoting the growth of female gonad and has an effect of improving the female fish ratio. So the CSW2 gene provided by the invention has a potential application prospect on aspects of cynoglossus semilaevis gender control and improvement on the female fry ratio.
Description
Technical field
The invention belongs to the functional gene screening and application technical field in aquatic wholesale market, be specifically related to the female specific expression gene of a kind of Cynoglossus semilaevis, i.e. the activation analysis of the screening of the female specific expression gene CSW2 of Cynoglossus semilaevis, clone, in-vitro recombination expression and expression product thereof.
Background technology
Cynoglossus semilaevis (Cynoglossus semilaevis) is the large-scale ground fish of a kind of coastal waters warm water, its delicious meat, nutritious, and deeply liking by human consumer, is that one of fish are dominated in China's sea farming.But female, the male individual growth speed difference of Cynoglossus semilaevis is very large, female faster than male growth 2-4 times.Due to male poor growth, the individual reason such as little, cause add Cynoglossus semilaevis aquaculture cost, reduce cultured output, had a strong impact on the popularization of semi-smooth tongue sole offspring breed and the development of aquaculture industry.Thus carrying out female, the male Screening and Identification of specific gene of Cynoglossus semilaevis and the analysis and research of function thereof is disclose Cynoglossus semilaevis Sex Determination Mechanism, explore the molecule mechanism of female, male growth differences, set up the vital task of Sex Control.
There are gender difference in many fish in growth velocity.Such as, the male individual growth of tilapia faster than female individuals more than 30%; Oncorhynchi female individuals is than male growth fast more than 30%.Equally, the female individuals growth of many seawater fishes in bothid and true plaice is also faster than male many.Such as, the female individuals of the fishes in bothid and true plaice such as Cynoglossus semilaevis, lefteye flounder and verasper moseri grows fast more than 30-100% than male.The country such as the current U.S., Japan, Germany, France, Canada is numerous and confused throws huge fund and carries out fish sex specific gene with Oncorhynchi, tilapia and blue or green Medaka etc. for material and screen and research (Lee et al., 2004 of sex determination mechanism; Devlin and Nagahama, 2002; Matsuda et al., 2002; Nanda et al., 2002), result of study publishes thesis many sections on the international top publication such as Nature, PNAS.Be the most successfully wherein Japanese Scientists with blue or green Medaka for material screening is to the special functional gene DMY of the male Sex determination gene Y chromosome of blue or green Medaka, paper is delivered on Nature (Matsuda et al., 2002).But, research subsequently shows, DMY only finds in blue or green Medaka and the very near blue or green Medaka of the back of a bow of another kind of sibship, and has no DMY male Sex determination gene (Matsuda et al., 2003 in other sibship Medaka section fish far away and other fish; Volffet al., 2003; Kondo et al., 2003).Thus, up to now, be only cloned into male Sex determination gene (DMY) only a few fish such as blue or green Medaka and the blue or green Medaka of the back of a bow, and there is not yet the reported success of relevant sex determining gene clone other fish.In addition, the sex of above-mentioned fish is most is XY decision type, and namely milter is XY type, and raun is XX type, and Cynoglossus semilaevis is ZW sex determination type, and namely female have special W karyomit(e), and male sex-chromosome homotype (ZZ) (Zhou Liqing etc., 2005).And about fish female special or determine the screening of the screening of gene and the female specific gene of clone, particularly Cynoglossus semilaevis and clone there is not been reported both at home and abroad at present.Therefore, fish sex is special/determine gene, the particularly female specific expression gene of Cynoglossus semilaevis or determine that the screening of gene and the research of clone and sex determination molecular mechanism are upper important scientific issues suddenly to be captured both at home and abroad at present is also the important foundation setting up Cynoglossus semilaevis sex control and complete female rearing of fingerling.
Summary of the invention
The object of this invention is to provide the female specific expression gene of a kind of Cynoglossus semilaevis, and construct the in-vitro recombination expression carrier of this gene, in-vitro recombination expression is carried out to this gene, obtain recombination expression product, the qualification biological activity of recombination expression product and the function of gene, for Cynoglossus semilaevis sex control and complete female seed development provide genetic resources and technological method.
The female specific expression gene CSW2 of Cynoglossus semilaevis of the present invention, its aminoacid sequence is SEQ IDNO:2.Above-mentioned female specific gene CSW2, its nucleotides sequence is classified as SEQ ID NO:1;
Another aspect of the present invention relates to the recombinant plasmid for recombinant expressed CSW2 albumen, inserts the DNA fragmentation that sequence is SEQ ID NO:1 in described recombinant plasmid.
Another aspect of the present invention relates to the application of CSW2 albumen in Cynoglossus semilaevis sex control and the female fry ratio of raising.
CSW2 albumen of the present invention, as fodder additives, is grown for stimulating Cynoglossus semilaevis female gonads.
The vitro recombination albumen of CSW2 gene of the present invention obviously can raise the expression level of the female genes involved foxl2 of Cynoglossus semilaevis and P450 aromatizing enzyme, has the biological activity stimulating female related gene expression; There is the biological activity reducing male genes involved SOX9 expression level simultaneously, thus there is the activity stimulating female gonads to grow.Stimulate female gonads to grow by having after CSW2 recombination expression product is acted on Cynoglossus semilaevis fry, there is the effect improving raun ratio.Therefore, the CSW2 gene of the present invention's screening has application potential in Cynoglossus semilaevis sex control and the female fry ratio of raising.
Accompanying drawing illustrates:
Fig. 1: the expression level analysis of CSW2 gene in Cynoglossus semilaevis different tissues;
A: Semi quantitative PCR analysis result, DNA band is above CSW2 expression level, and DNA band is below that actin is as internal reference; B: quantitative PCR analysis result in good time.
Fig. 2: the expression level analysis of Cynoglossus semilaevis different development stage spermary (column with slant lines) and the middle CSW2 gene of ovary (black post); 4d:4 days, 7d:7 days, 25d:25 days, 48d:48 days, 62d:62 days, 5m:5 month, 1n:1,2n:2.
The recombinant expression vector plasmid figure of Fig. 3: Cynoglossus semilaevis CSW2 gene;
Fig. 4: containing recombinant protein electrophorogram after the total protein in the recombination bacillus coli culture supernatant of Cynoglossus semilaevis CSW2 gene and purifying; Wherein M: standard protein marker; 1. empty carrier pet-32a tropina electrophorogram after IPTG induction, 2. CSW2 recombinant expression vector pet-32-CSW2 tropina electrophorogram after IPTG induction, the CSW2 recombinant protein electrophorogram 3. after purifying;
After Fig. 5: Cynoglossus semilaevis recombinant C SW2 protein injection in fish body sexual gland foxl2 gene at 0 hour, 6 hours, 12 hours, 24 hours, 36 hours, 48 hours, the expression analysis of 72 hours and 96 hours;
After Fig. 6: Cynoglossus semilaevis recombinant C SW2 protein injection in fish body sexual gland P450 gene at 0 hour, 6 hours, 12 hours, 24 hours, 36 hours, 48 hours, the expression analysis of 72 hours and 96 hours;
After Fig. 7: Cynoglossus semilaevis recombinant C SW2 protein injection in fish body sexual gland sox9 gene at 0 hour, 6 hours, 12 hours, 24 hours, 36 hours, 48 hours, the expression analysis of 72 hours and 96 hours.
Embodiment
Below in conjunction with attached Example, method of the present invention is described further.But example is only limitted to illustrate, is not limited to this.The experimental technique of unreceipted actual conditions in the following example, usually can condition routinely, the condition as described in " Molecular Cloning: A Laboratory guide " that J. Pehanorm Brooker (Sambrook) etc. is write, or runs according to the condition that manufacturer advises.
One, the clone of the female specific gene CSW2 of Cynoglossus semilaevis and sequence thereof
, milter female to Cynoglossus semilaevis has carried out genome sequencing respectively, pass through bioinformatic analysis, find to have in ZW female individuals genome a special gene C SW2, adopt cDNA end rapid amplifying (RACE) technology, the cDNA of female specific gene CSW2 has been cloned into from Cynoglossus semilaevis ovary, its full length sequence is SEQ ID NO:1, and the aminoacid sequence of the albumen of coding is SEQ ID NO:2.
The cDNA sequence total length of the female specific gene CSW2 of Cynoglossus semilaevis is 2043bp, comprise the open reading frame (ORF region) of 669bp, 222 amino acid of encoding, 5 ' non-coding head of district 233bp, 3 ' non-coding head of district 1141bp, has polyadenylic acid tailing signal and polyadenylic acid tail.
Concrete steps are as follows:
1. the screening of the female specific gene of Cynoglossus semilaevis and clone
Female special gene sequence in patent of the present invention derives from Cynoglossus semilaevis various genome sequencing programs.SOLEXA sequencing technologies is adopted to carry out genome sequencing and assembling respectively to Cynoglossus semilaevis female individuals and male, adopt bioinformatics method to compare to the raun genome sequence obtained and milter genome sequence, therefrom filter out the female specific candidate gene of Cynoglossus semilaevis; To these female specific candidate gene design primers, utilize these special primers to carry out pcr amplification respectively to the female milter genomic dna of Cynoglossus semilaevis, find that 10 candidate genes exist in raun genomic dna, and can not increase out in milter genome.Be raun genome specific gene by these 10 unnamed genes.
2. the sequence of the female specific gene of Cynoglossus semilaevis
Next, analyze the encoder block of these 10 genome specific genes, the primer of design amplification cDNA fragment, adopt these primer pair rauns and milter sexual gland cDNA to increase, the gene of substantially not expressed in milter sexual gland by specifically expressing in raun sexual gland is defined as female specific expression gene.1 gene of a specifically expressing in ZW raun sexual gland is we have found, the female specific expression gene CSW2 of called after Cynoglossus semilaevis by these methods.Adopt cDNA end rapid amplifying (RACE) technology, adopt CSW2 gene specific PCR primers (
CSW2-5 ' GSP:ACTGCTCCCGTTCTTGCTCCTGTTCC, CSW2-3 ' GSP:CGAGAC AGGGATGAAGCCATAGCCA), from Cynoglossus semilaevis ovary, be cloned into the full-length cDNA of female specific gene CSW2 gene, its full length sequence is that SEQ ID NO:1 is shown in sequence table.
CDNA sequence obtain take cDNA RLM-RACE (RACE), method according to SMARTerTM RACE cDNA Amplification Kit (Clontech),
The system that 3 ' RACE is used and reaction conditions:
50 μ l reaction systems
5μl 10X BD Advantage 2 PCR Buffer
1μl dNTP Mix (10 mM)
5μl UPM
1μl GSP
2μl 3′-RACE-Ready cDNA
1μl50X BD Advantage 2 Polymerase Mix
35μl PCR-grade water
Reaction conditions is as follows:
94 DEG C of 30S, 72 DEG C of 3min 5 circulations, 94 DEG C of 30S, 70 DEG C of 30S, 72 DEG C of 3min, 5 circulations, 94 DEG C of 30S, 68 DEG C of 30S, 72 DEG C of 3min, 25 circulations
5 ' RACE system used and reaction conditions:
50 μ l reaction systems
5μl 10X BD Advantage 2 PCR Buffer
1μl dNTP Mix (10 mM)
5μl UPM
1μl GSP
2μl 5′-RACE-Ready cDNA
1μl50X BD Advantage 2 Polymerase Mix
35μl PCR-grade water
Reaction conditions is as follows:
94 DEG C of 30S, 72 DEG C of 3min 5 circulations, 94 DEG C of 30S, 70 DEG C of 30S, 72 DEG C of 3min, 5 circulations, 94 DEG C of 30S, 68 DEG C of 30S, 72 DEG C of 3min, 25 circulations.
The PCR primer of 3 ' RACE and 5 ' RACE is detected with 1.5% agarose gel electrophoresis, recovery and the purifying that test kit (Omega) carries out PCR primer is reclaimed with glue, be connected with pMD-18T carrier (Takara) again, select positive colony and extract plasmid, 3730DNA Analyzer(ABI) order-checking, the sequence recorded is analyzed splicing through CLUSTER and is obtained full length sequence.And carry out total length amplification from the Nucleotide two ends design primer of SEQ IDNO:1, result shows not occur to splice mistake.
The cDNA sequence total length of the female specific expression gene CSW2 of Cynoglossus semilaevis is 2043bp, comprise the open reading frame (ORF region) of 669bp, 222 amino acid of encoding, 5 ' non-coding head of district 233bp, 3 ' non-coding head of district 1141bp, has polyadenylic acid tailing signal and polyadenylic acid tail.
Two, the female specific expression gene CSW2 of Cynoglossus semilaevis is at different tissues and different development stage expression pattern
1. Cynoglossus semilaevis female specific expression gene CSW2 is at the expression pattern of different tissues: adopt sxemiquantitative and in good time quantitative PCR technique to analyze the expression of CSW2 gene in Cynoglossus semilaevis different tissues (heart, liver, the gill, skin, blood, kidney, intestines, brain, spleen, muscle, hypophysis, ovary, spermary), find that CSW2 only expresses in female individuals, wherein in female fish ovaries, expression level is the highest, less at raun hypophysis, brain expression amount, other is organized and expresses hardly, and almost can detect out expression (Figure 1A and B) in the tissues such as milter spermary.Prove thus, CSW2 be the female specifically expressing of Cynoglossus semilaevis and in ovary the gene of high expression level.The qualification of raun and pseudo-milter genetic sex is carried out (Chen S L et al., 2012, Marine Biotechnology, 14 (1): 120-128.) according to the method reported.CSW2 gene in the concrete steps of the detection of expression of different tissues is:
(1). the extraction of Cynoglossus semilaevis different tissues total serum IgE and reverse transcription: get the heart of the Cynoglossus semilaevis raun of 250-500 grammes per square metre, liver, the gill, skin, blood, kidney, intestines, brain, spleen, muscle, hypophysis, ovary, spermary tissue, extract test kit with RNA and extract total serum IgE, adopt ordinary method to become cDNA by M-MLV ThermoScript II (Takara) reverse transcription.
(2). real-time fluorescence quantitative PCR reaction conditions
According to Cynoglossus semilaevis CSW2 gene cDNA sequence design real-time fluorescence quantitative PCR primer CSW2-S, CSW2-A (CSW2-S:TAACCTCCCTCAGTTCTTCTCCTAA, CSW2-A:CCTCAGCCAAGGATGTGCC), the expression of CSW2 in Cynoglossus semilaevis raun different tissues (heart, liver, the gill, skin, blood, kidney, intestines, brain, spleen, muscle, hypophysis, ovary) and milter spermary is analyzed.
Real-time fluorescence quantitative PCR reaction system and reaction conditions:
20 μ l reaction systems
10μl SYBR Taq
0.4μl primer F
0.4μl Primer R
0.4μl Rox RD II
0.5μl cDNA(600ng/μl)
8.3μl H
20
Find that CSW2 expression level in ovary is the highest, express all seldom (see Figure 1B) in other tissue of raun and milter spermary etc. respectively tissue, therefore, CSW2 is Cynoglossus semilaevis raun sexual gland cance high-expression gene.
2. Cynoglossus semilaevis female specific gene CSW2 is in the expression of Cynoglossus semilaevis different development stage: adopt in good time quantifying PCR method to have detected the female specific expression gene CSW2 of Cynoglossus semilaevis at Cynoglossus semilaevis raun and milter different development stage (4d, 7d, 25d, 48d, 62d, 5m, 1y, 2y) (d is sky, m is the moon, y is year) expression in sexual gland, discovery was expressed less in ovary before 62 days, express hardly, within 62 days, express and obviously strengthen, 62 days to 1 year expression amounts present and increase in time and increase trend, 1 age (1y) expression amount is the highest, 2 ages (2y) expression amount is in a slight decrease.In spermary, all very low at the expression level of each developmental stage CSW2, even almost can't detect expression, and different steps there was no significant difference (Fig. 2).Prove thus, CSW2 gene plays an important role in Cynoglossus semilaevis raun Gonad Differentiation and growth course, and has not had anything to act in milter gonad development process.
Qualification that is female, milter genetic sex is carried out (Chen S L etal., 2012, Marine Biotechnology, 14 (1): 120-128.) according to the method reported.CSW2 gene in the concrete steps of Cynoglossus semilaevis different development stage detection of expression is:
(1) extraction of Cynoglossus semilaevis different development stage raun sexual gland total serum IgE and reverse transcription: the male and female piscinity gland getting the different development stages such as Cynoglossus semilaevis 4d, 7d, 25d, 48d, 62d, 5m, 1y, 2y, extract test kit with RNA and extract Total RNA, M-MLV ThermoScript II (Takara) reverse transcription becomes cDNA.
(2) real-time fluorescence quantitative PCR reaction conditions:
Real-time fluorescence quantitative PCR analysis is carried out to the cDNA of different development stage (4d, 7d, 25d, 48d, 62d, 5m, 8m, 10m, 1y, 2y) raun sexual gland, reaction system and reaction conditions as follows:
20 μ l reaction systems
10μl SYBR Taq
0.4μl primer F
0.4μl Primer R
0.4μl Rox RD II
0.5μl cDNA(600ng/μl)
8.3μl H
20。
Result shows the carrying out that CSW2 gene is grown along with fish bulk-growth and female gonads, in ovary, the expression level of CSW2 raises gradually from 4d, 7d, 25d, 48d, 62d, 5m, 1y and 2y, reach the highest when 1 age, the expression amount (Fig. 2) in a slight decrease when two ages.
3. the genetic sex qualification of Cynoglossus semilaevis fry and adult fish:
The tail fin tissue of 0.1g size is taked from Cynoglossus semilaevis fry or adult fish, phenol chloroform method conveniently extracts genomic dna, the cynoglossus semilaevis gunther sex-linked microsatellite marker adopting the old pine forest laboratory of Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science to set up subsequently and genetic sex identification method (the Chen S L et al. of foundation, 2012, Marine Biotechnology, 14:120-128) carry out Cynoglossus semilaevis fry and adult fish genetic sex qualification.
Three, the structure of Cynoglossus semilaevis female specific expression gene CSW2 recombinant expression vector and the separation and purification at colibacillary recombinant expressed and expression product thereof
Adopt Standard PCR technology, to increase the open reading frame ORF region of CSW2 gene, and be cloned on pET-32a (+) expression vector, construct CSW2 prokaryotic expression carrier, by this expression vector transformation of E. coli BL21, carry out the in-vitro recombination expression of CSW2 gene, obtain recombination expression product, recombination expression product, after GE company His-tag affinity chromatography column purification, obtains the CSW2 recombinant protein of purifying, and recombinant protein molecular weight is about 47kd.The concrete scheme realizing above-mentioned target is as follows:
1. the construction process of CSW2 recombinant expression vector:
Restriction enzyme site analysis is carried out to PET-32a (+) carrier sequence and CSW2 gene ORF region sequence, and design band restriction enzyme site special primer PET-32-CSW2S, PET-32-CSW2A (PET-32-CSW2S:GCCGATATCATGGAGCAGGAGGAACAGGA
PET-32-CSW2A: GCCGAATTCTCACTCTGTGCATGTCATCCTG)
Upstream 5 ' is held containing EcoRV restriction enzyme site, and downstream 3 ' is held containing EcoRI restriction enzyme site.Be that template carries out PCR reaction with ovarian cdna, amplification CSW2 coding region.Be connected after PCR primer purifying with cloning vector pMD18-T, positive colony is checked order.By the correct cloned plasmids of order-checking and PET-32a(+) carry out double digestion with EcoRI and EcoRV simultaneously, agarose electrophoresis reclaims CSW2 fragment and expression vector plasmid, according to ligase enzyme specification sheets, connect with T4DNA ligase enzyme, build recombinant expression plasmid PET-32a-CSW2(Fig. 3), transformation of E. coli TOP10 competence, checks order detection positive colony, and the correct clone that checks order extracts plasmid.Again PET-32a-CSW2 Plastid transformation is expressed competence BL21 (DE3) bacterium, to add in 30% glycerine to 2-3 milliliter competence bacteria culture in-80 DEG C of freezen protective as conservation bacterium simultaneously.
2. the abduction delivering of recombinant protein and the initial analysis of expression product
The thalline getting 5 μ l conservations is inoculated into (containing 100 μ g/mL penbritins) in the fresh LB substratum of 1mL, 37 DEG C, 200r/min incubated overnight, the thalline of incubated overnight 1% is inoculated into (containing 100 μ g/mL penbritins) in the fresh LB substratum of 10mL, 37 DEG C, 250r/min is cultured to OD600 when reaching 0.6-0.8, IPTG induction is added in control group (PET-32a) and experimental group (PET-32a-CSW2) bacterium liquid, IPTG final concentration is made to be 1mmol/L, 28 DEG C, 200r/min continues to cultivate 6h, 0, 1, 2, 3, 4, 5 and 6h sample 1mL respectively, by the sample of collection at 4 DEG C, centrifugal 5min under 12000r/min condition, bacterium mud PBS damping fluid (the NaCl 137mmol/L of 200 μ L, KCl 2.7mmol/L, Na2HPO4 10mmol/L, KH2PO4 2mmol/L) wash three times, the centrifugal 2min of 12000r/min after each rinsing, add the PBS mixing of 30 μ L, adding isopyknic 2x sample-loading buffer (1mol/L pH 6.8 Tris-HCl, 1% tetrabromophenol sulfonphthalein, 0.154gDTT, 10%SDS, 10% glycerine) process, boiling water bath 5min cracking thalline, collect cracking bacterium liquid sample and carry out 12%SDS-PAGE electrophoresis detection, find CSW2 recombinant expression vector pet-32-CSW2 through IPTG induction after tropina in have 1 molecular weight to be the protein band of 38.75KD (2 in Fig. 4), then without this protein band (3 in Fig. 4) in empty carrier pet-32a control group.
3. the separation and purification of recombinant protein
Above-mentioned conservation bacterium a large amount of (250mL) under 37 DEG C of conditions being cultured to cell density, to reach OD600 be 0.6, adding IPTG final concentration is after 1mmol/L 28 DEG C induces 6h, 4 DEG C of centrifugal 5min of 12000r/min collect thalline, according to 1g wet thallus/10mL lysis buffer (20mM/L Na3PO4, 0.5M NaCl, 20mM/L imidazoles, DNaseI 10U, 200 μ L 50mM/L, 200ul 10mg/L N,O-Diacetylmuramidase) the resuspended thalline of ratio, ultrasonication under condition of ice bath, 4 DEG C, the centrifugal 10min of 12000r/min collects supernatant, by the metre filter of supernatant with 0.45 μ L, the supernatant filtered is collected for subsequent use.Application His Trap HP(GE company) affinity column carries out separation and purification, and concrete operations are as follows:
First, 1mL pillar is washed once, 5ml binding buffer liquid (20mM/L Na3PO4,0.5M NaCl subsequently with 5mL distillation, 20mM/L imidazoles) wash pillar, again the pretreated supernatant collected is crossed pillar, flow velocity is 1-2mL/min, washes pillar with 5mL binding buffer liquid, use elution buffer (the 20mM/L Na3PO4 of 5mL again, 0.5M NaCl, 500mM/L imidazoles) wash-out once, finally with the binding buffer liquid of 5mL regeneration pillar.Collect the recombinant protein sample of purifying after affinity chromatography and carry out 12%SDS-PAGE electrophoresis detection, observing recombinant protein molecular weight is about 47KD (Fig. 4).
4. determination of protein concentration
Adopt the BCA protein quantification test kit of Beijing Tian Gen biochemical technology company limited to carry out quantitative analysis to the albumen after purifying, concrete operations are carried out to specifications.
Four, the bioactive mensuration of Cynoglossus semilaevis CSW2 recombination expression product and application potential thereof
Recombinant expressed for CSW2 purified product is expelled to the Cynoglossus semilaevis milter spermary of 100-200 grammes per square metre, have detected recombinant C SW2 albumen to sexual gland foxl2, the impact of the sex related gene expression levels such as p450 and sox9, after discovery injection CSW2 recombination expression product in 6-48 hour, the expression level of female genes involved foxl2 progressively raises, and reaches the highest, decline gradually subsequently at 24 hours, to 96 hours, return to normal level (Fig. 5).Female genes involved p450 also expression level rising in 6-48 hour, reached the highest at 48 hours, to 96 hours, returns to normal level (Fig. 6).In contrast, the expression level of male genes involved sox9 is expressed in 6-24 hour and is declined after injection, reaches minimum, raises gradually subsequently, to 96 hours, recover normal level (Fig. 7) to 24 hours.
Concrete detection method is as follows: the concrete scheme realizing above-mentioned target is:
Get 100-200 grammes per square metre one age Cynoglossus semilaevis milter 40 tail, wherein 4 tails get sexual gland, as 0 hr-control.Get 18 tail fishes injection recombinant C SW2 albumen (150ul, 1ug/ul), another 18 endnote lost live-weight group CSW2 albumen (boiling water bath 5min, 150ul, 1ug/ul) as a control group.Experimental group and control group respectively after injection 6h, 12h, 24h, 36h, 48h, 72h, 96h get sexual gland and drop into rapidly in liquid nitrogen, proceed to-80 DEG C subsequently and save backup, each group of each time point is sampled 3 tails.Cynoglossus semilaevis sex genes involved Foxl2(GQ402462 according to reporting in NCBI), P450 (EF134716.1) and the quantitative primer of sequences Design such as Sox9a(GQ402461)
Foxl2-S:TGGTTGGAAGTGCGTGGG,
Foxl2-A:GAGAGGAAGGGCAACTACTGGA;
P450-S: ACGGGCTGAAATCGCAAG,
P450-A: GGTGAGGATGTGACCCAGTGT;
Sox9-S:CGATTCCCCTGCGTCCA,
Sox9-A: GCTTCAGTTCGGCTTTATTGG.
Each changes in gene expression is detected to the sexual gland real-time quantitative PCR after injection recombinant protein.Each gene different time expression amount being carried out independent sample T inspection, carries out significant difference analysis with SPSS 17 statistical software, marking there being the group * of significant difference.
Show thus, the vitro recombination albumen of the CSW2 gene that the present invention obtains obviously can raise the expression level of female genes involved foxl2 and P450 gene, there is the biological activity stimulating female related gene expression and female gonads to grow, the vitro recombination albumen of CSW2 gene can also reduce the expression level of male genes involved SOX9 simultaneously, namely has the biological activity suppressing male gonad to be grown.CSW2 recombination expression product being had the effect stimulating female gonads to grow after fodder additives uses, there is the effect improving raun ratio, therefore, with improving in female fry ratio, there is application potential in Cynoglossus semilaevis sex control.
Claims (4)
1. the female specific proteins CSW2 of Cynoglossus semilaevis, its aminoacid sequence is SEQ ID NO:2.
2. the female specific gene of Cynoglossus semilaevis, described gene is the encoding gene of Female-specific protein according to claim 1.
3. gene as claimed in claim 2, its nucleotides sequence is classified as SEQ ID NO:1.
4. a recombinant plasmid, described recombinant plasmid is for expressing albumen according to claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310347678.2A CN103509099B (en) | 2013-08-12 | 2013-08-12 | Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310347678.2A CN103509099B (en) | 2013-08-12 | 2013-08-12 | Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103509099A CN103509099A (en) | 2014-01-15 |
CN103509099B true CN103509099B (en) | 2015-03-25 |
Family
ID=49892572
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310347678.2A Active CN103509099B (en) | 2013-08-12 | 2013-08-12 | Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103509099B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105331724B (en) * | 2015-11-29 | 2019-12-10 | 中国水产科学研究院黄海水产研究所 | Cynoglossus semilaevis sex chromosome-linked DNA fragment and application thereof |
CN108029902A (en) * | 2018-01-04 | 2018-05-15 | 广东越群海洋生物研究开发有限公司 | A kind of turning property of tongue sole feed and preparation method thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100469896C (en) * | 2007-12-01 | 2009-03-18 | 中国水产科学研究院黄海水产研究所 | Tongue sole molecular marker auxiliary sex control method |
CN101240348B (en) * | 2008-01-23 | 2012-07-11 | 中国水产科学研究院黄海水产研究所 | Rapid identification method for half-smooth tongue-sole genetic sex |
-
2013
- 2013-08-12 CN CN201310347678.2A patent/CN103509099B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN103509099A (en) | 2014-01-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103981204B (en) | A kind of expression of activated goldfish Tgf2 transposons restructuring transposase albumen | |
CN105624310A (en) | Molecular marker influencing intramuscular fat character of pig and application | |
CN103740729A (en) | SNP locus related to growth characteristics of patinopecten yessoensis and detection and application thereof | |
CN102140522A (en) | Detection method for Apostichopus japonicas AjE101 micro-satellite DNA label | |
Núñez-Acuña et al. | The myostatin gene of Mytilus chilensis evidences a high level of polymorphism and ubiquitous transcript expression | |
CN103509099B (en) | Female cynoglossus semilaevis specific expression gene CSW2 and applications thereof | |
CN103739696B (en) | Cynoglossus semilaevis female specificity CSW3 protein as well as gene and application thereof | |
CN108950017A (en) | A kind of southern china sea area Tridacnidae species mitochondria 16S rRNA gene universal amplification primer and its screening technique | |
CN106011276B (en) | For identifying that the species specificity PCR of the balcony frog identifies primer and method and application | |
Li et al. | Molecular cloning, promoter analysis and induced expression of the complement component C9 gene in the grass carp Ctenopharyngodon idella | |
Meng et al. | An unexpected loss of domains in the conservative evolution ninth complement component in a higher teleost, Miichthys miiuy | |
CN103408651B (en) | Cynoglossus semilaevis female specific gene CSW1 and application thereof | |
CN108892718B (en) | Epinephelus coioides antibacterial peptide and application thereof | |
CN103966231A (en) | Molecular cloning of GLP2R gene fragments associated with pork quality traits and application of GLP2R gene fragments | |
CN110616206B (en) | Tiger skin fish PtScd1 gene and application thereof | |
CN101434951A (en) | Method for obtaining wire-worm microsome amino peptidase gene and use thereof | |
CN101565703B (en) | Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof | |
Zhang et al. | Mitochondrial COI gene sequence variation and taxonomic status of three Macrobrachium species | |
CN103214567B (en) | Cynoglossus semilaevis gender related gene, preparation method of recombinant protein thereof and application thereof | |
CN108329386B (en) | Goose source mitochondria antiviral signal protein and application thereof | |
CN102010868A (en) | Garrupa MHC (Major Histocompatibility Complex) IIB gene as well as cloning method and application thereof | |
CN103524611B (en) | Meloidogyne incognita esophageal gland specific gene Msp40 and proteins encoded thereof are applied with it | |
WO2015070506A1 (en) | Litopenaeus vannamei sodium/calcium exchanger lvncx gene and coded protein thereof | |
CN105112425A (en) | Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) | |
KR101728421B1 (en) | Markers for identitying fish species contained in surimi products |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |