CN105112425A - Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) - Google Patents
Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) Download PDFInfo
- Publication number
- CN105112425A CN105112425A CN201510671508.9A CN201510671508A CN105112425A CN 105112425 A CN105112425 A CN 105112425A CN 201510671508 A CN201510671508 A CN 201510671508A CN 105112425 A CN105112425 A CN 105112425A
- Authority
- CN
- China
- Prior art keywords
- myo6
- gene
- pig
- primer
- related gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of livestock molecular biology, and particularly relates to molecular cloning and application of pork quality character related gene Myo6 (Myosin 6). The molecular marker disclosed by the invention is obtained through cloning the Myo6 gene, and the sequence of the Myo6 molecular marker is described as SEQ ID NO: 1. The polymorphism of the Myo6 gene is as follows: a primer is designed by using the comparative genomics method according to the My06 gene sequence of human, the genome DNA of pigs is adopted as a template for amplification, SNP is screened by sequencing the amplified fragments, genotyping is carried out by using PCR-RFLP, a G/A base mutation at 709bp is discovered, and PCR-RFLP-Xba I polymorphism is caused. The molecular cloning and application of pork quality character related gene Myo6 provide a novel molecular marker for the assistant selection of pig markers.
Description
Technical field
The invention belongs to domestic animal technical field of molecular biology, relate to a kind of nucleic acid molecule comprising pig gene nucleotide as shown in SEQIDNO:1.The invention still further relates to the mononucleotide polymorphism site in the molecular cloning method of the Myo6 gene as shown in SEQIDNO:1 and polynucleotide sequence and the method for mononucleotide polymorphism site as described in detecting.
Background technology
Pork is the main source of animal protein, along with people are to the increase of meat requirement, to the requirement also corresponding raising of meat.Affecting pork qualitative factor has hereditary and extragenetic, and pig intramuscular fat content has a great impact Meat Quality, and in general, intramuscular fat content is higher, and Meat is tenderer, thus meat is better.Meat Quality belongs to quantitative character mostly, is controlled by minor-polygene.Many Meat Qualities could can only measure after animal slaughtering, so conventional herd breeding can only carry out compatriot or half-sibs test, must increase seed selection cost like this, and genetic progress are slow.The structure of pig draft genome, makes to find the key-gene affecting Meat Quality or the molecule marker being close to lock with it becomes possibility, and these molecule markers, once confirmation, just can carry out marker assisted selection breeding.Utilizing molecule marker to carry out assisted Selection (MAS), to carry out Meat Quality improvement be a kind of effective approach.
Myo6 (Myosin6, myosin 6) belongs to myosin family.Myosin family is the mechanical enzyme of a large class dependency ATP, be present in all eukaryotic cells, utilize ATP to be hydrolyzed the power produced to move along actin filament, it is the contraction participating in muscle the earliest by the physiological action be familiar with, and the numerous myosin of discovered in recent years is in cell movement, cell fission, intracellular signaling etc. play an important role.The myosin participating in the bipolarity myofilament of Muscle contraction is called as conventional myosin; These myosins do not have bipolarity myofilament, and also referred to as unconventional myosin, Myo6 is a member in unconventional myosin gene families.
Its several functions of Myo6 gene and receive the concern of multiple fields scholar, as found in fruit bat, it participates in the rotation of spindle body in the generation of sperm, asymmetric cell fission, and in mammalian cell, Myo6 participates in the endocytosis of cell, the maintenance of golgi body, and also relevant with human auditory etc.
Myo6 gene is very conservative in evolution, in a lot of species of nematode to the mankind, all have expression, and it is positioned at human chromosome 6q13, mouse chromosome 9E1, pheasant No. 3 karyomit(e)s, pig No. 1 karyomit(e).The function of the domestic and international Myo6 gene about the mankind, mouse, fruit bat etc. and proteins encoded thereof, Regulation Mechanism are all studied more deep at present.But, little about the research report of pig Myo6 gene.
Summary of the invention
The object of the invention is to clone pig Myo6 gene cDNA molecule, find the mutational site of Myo6 gene and the detection method of gene pleiomorphism, for pig flesh characters marker-assisted breeding provides a kind of useful molecule marker.
Technical problem to be solved by this invention is: for above-mentioned the deficiencies in the prior art, provides molecular cloning and the application of a kind of pork quality trait related gene Myo6, is the molecule marker that pig flesh characters marker assisted selection provides.
In order to solve the problem, the technical solution adopted in the present invention is: with the Myo6 gene order of people (the GenBank number of including is NC_000006.12) for Seed Sequences, BLASTN (BasicLocalAlignmentSearchToolNucleotide) is utilized in GenBank, special primer is designed with reference to the pig EST (ExpressionSequenceTags) of its homology more than 80%, utilize RACE (RapidAmplificationofcDNAEnd), clone pig Myo6 gene cDNA total length, the DNA sequence dna of this pig Myo6 gene is as shown in SEQIDNO:1.Myo6 gene polynorphisms utilizes comparative genomics method according to the Myo6 gene order design primer of people, with the genomic dna of pig for template amplification, amplified fragments utilizes order-checking screening SNP, and utilize PCR-RFLP to carry out genotyping technique, find that there is the base mutation of a G/A at 709bp place, cause PCR-RFLP-XbaI polymorphism.
Test materials: 25 age in days Shaziling pig are provided by Shaziling pig resource field, xiangtan, hunan province city, get longissimus dorsi muscle-80 DEG C preservation, and 5 '-RACEVersion2.0 test kit is purchased from Invitrogen company, 3 '-RACESMARTer
tMrACEcDNAAmplificationKit test kit is purchased from Clontech company.
The synthesis of Total RNAs extraction and cDNA the 1st chain: carry out the synthesis of gene first chain cDNA to total serum IgE with SUPERSCRIPTIIRT enzyme and primer GSP1, uses the cDNA of RNaseMix to synthesis to go RNA process, finally carries out purifying to cDNA.
Design of primers: according to GenBank people Myo6 gene (accession number: NC_000006.12) sequence conservation design primer, the software of design of primers is Premiere5.0, the principle of design of primers is that Auele Specific Primer length is at 23-28 Nucleotide, GC content is at 50%-70%, annealing temperature, at 65-70 DEG C, uses nest-type PRC to increase.
Encoding sequence pcr amplification: with the pig cDNA synthesized for template, at conserved regions design primer through cloning and sequencing, obtains this Gene Partial CDS sequence.
5 '-RACE amplification: use TdT enzyme and dCTP to add poly C to the cDNA end after purifying, uses bridging rivet primer AUAP (table 1) in primer GSP2 (Gene-SpecificPrimers) and test kit to carry out PCR first round amplification to the cDNA adding dC tail; Use the bridging universal amplification primer AUAP in primer GSP3 and test kit to carry out nest-type PRC second and take turns amplification, take turns PCR primer to carry out electrophoresis and cut glue to object band reclaiming purifying by second, PCR primer after purifying is connected with pMD18-T, after conversion, positive colony is checked order, obtain aim sequence.
3 '-RACE amplification: use primer 3 ' 452-1 and UPM (UniversalPrimerAMix), with the cDNA synthesized for template carries out first round pcr amplification above.First round pcr amplification product is diluted 50 times, then uses primer 3 ' 452-2 and UPM (table 1) to carry out second and take turns pcr amplification.Take turns PCR primer to carry out electrophoresis and cut glue to object band reclaiming purifying by second.PCR primer after purifying is connected with pMD18T, picking positive colony order-checking after transforming.
The length 2264bp that the 5 '-RACE length that obtains is 526bp by increasing, 3 '-RACE increases to be obtained and intermediate sequence splice to obtain the full length cDNA sequence of Myo6 gene, thus complete the content of the clone of Myo6 gene of the present invention.
The primer sequence used in table 1 the present invention
| Primer | Primer sequence (5'-3') |
| Myo6-F | ACTACGGGAACTCCAACC(SEQ ID NO：2) |
| Myo6-R | ACTTAACCAAATGCCACC(SEQ ID NO：3) |
| GSP1 | CTTCTAGGAGTGGGTT(SEQ ID NO：4) |
| GSP2 | GGTTCCATAGGATTCAGTCAG(SEQ ID NO：5) |
| GSP3 | ATTTTCCGTTTTGCCAGCTCC(SEQ ID NO：6) |
| AUAP | GGCCACGCGTCGACTAGTAC(SEQ ID NO：7) |
| 3′452-1 | CCCACTCCTAGAAGCCTTTGGAAATGC(SEQ ID NO：8) |
| 3′452-2 | GAAAAGAGTTCAGTTGTTGGAGGATTTG(SEQ ID NO：9) |
| UPM | CTAATACGACTCACTATAGGGC(SEQ ID NO：10) |
It is below the screening of Myo6 gene molecule marker.
DNA sample: get fritter pig ear tissue and extract DNA, totally 6 kinds: Large White 167, the black pig in the Land of Peach Blossoms 58, Shaziling pig 100, Pu city gagger pig 74, Ning Xiang Swine 196 and Daweizi pig 228, amount to 823.
Design of primers: utilize comparative genomics method according between the 11st exon of the Myo6 gene (the GenBank number of including is NC_000006.12) of people to the 12nd exon, BLAST is made at GenBank with this gene, filter out candidate SNP s site after sequence alignment, use this site of PCR-RFLP technical identification.
Prepare the primer pair of the above-mentioned sequence table SEQ IDNO:1 gene fragment sudden change of detection, described primer pair, forward primer is 5 '-ACTACGGGAACTCCAACC-3 ' (see SEQIDNO:2), and reverse primer is 5 '-ACTTAACCAAATGCCACC-3 ' (see SEQIDNO:3).
PCR condition: PCR reaction system (cumulative volume 20 μ L): 10 × Buffer2 μ L, 2mmol/LdNTPs1.6 μ L, 20mmol/LMgCl
21.6 μ L, Taq DNA polymerase (5U/ μ L) 0.4 μ L, DNA profiling (100ng/ μ L) 1 μ L, upstream and downstream primer (10pmol/ μ L) each 0.4 μ L and ddH
2o12.6 μ L.
Response procedures: 94 DEG C of denaturation 7min; 94 DEG C of sex change 45s, 59 DEG C of annealing 30s, 72 DEG C extend 45s, totally 30 circulations; 7min is extended, last 4 DEG C of preservations after 72 DEG C.
Get 10 μ LPCR amplified productions, after adding 2 μ L tetrabromophenol sulfonphthalein sample-loading buffer mixings, point sample, on the sepharose (containing 0.05%EB) of 2%, then puts 6 μ L100bpDNAMarkers as reference.5V/cm electrophoresis 0.5-1.0h.In gel imaging system, observe amplification after electrophoresis terminates and take pictures, result as shown in Figure 1.By the PCR primer Hou Songboshang biotech company order-checking after purifying.
The XbaI enzyme cutting of PCR primer:
In 10 μ LPCR products, add 0.8 μ L10 × restriction endonuclease damping fluid, 0.2 μ L restriction enzyme and 1 μ L distilled water, cumulative volume is 12 μ L, 37 DEG C of digestion 4-10h.The 2% agarose gel electrophoresis analysis of A/G site, 5V/cm electrophoresis 0.5h, observations under ultraviolet lamp is also taken pictures, enzyme cuts result as Fig. 2, amplified production checks order, and sequence is as shown in SEQIDNO:1, and am-plified fragments is the sequence between the 11st exon to the 12nd exon, 866bp, is PCR-RFLP-XbaI molecule marker altogether.
SNP finds to set up with detection method: applicant devises amplification and comprises this SNP primer, and the sudden change in A/G site can adopt XbaI to carry out enzyme and cut detection polymorphism by analysis.In the segment of the 866bp of amplification, there is the restriction enzyme site of 1 XbaI, there are 3 kinds of genotype in the A/G site that electrophoresis detection result is presented at Myo6 gene, GG type (705bp, 161bp), AG type (866bp, 705bp, 161bp) and AA genotype (866bp).
Utilize the pig molecule mark of above-mentioned preparation to be applied to external pig kind and the gene frequency of place of china kind and the analysis of genotype frequency, and analyze its genetic polymorphism, the molecule marker that really can provide for pig flesh characters marker assisted selection.
The present invention will establish solid basis for marker assisted selection (MAS), for improving Swine Production economic benefit, and guide the breeding practice of pig to provide theoretical foundation.
Accompanying drawing explanation
Fig. 1 is the electrophoresis result figure of the pcr amplification product of Myo6 gene fragment of the present invention.
Wherein: M:100bpDNALadderMarker, 1-4 represent different swimming lane.
Fig. 2 is the XbaI enzyme cutting electrophoresis result in Myo6 of the present invention Gene A/G site.
Wherein: swimming lane 1,2:GG genotype; Swimming lane 3:AA genotype: swimming lane 4:AA genotype; M:100bpDNALadderMarker.
Embodiment
Below in conjunction with specific embodiment, the present invention is explained further, but concrete enforcement does not do any restriction to the present invention.
With the Myo6 of people (the GenBank number of including is for NC_000006.12) for Seed Sequences, BLASTN is utilized in GenBank, design special primer with reference to the pig EST (ExpressedSequenceTags) of its homology more than 80%, utilize RACE technology to clone pig Myo6 gene cDNA total length.Myo6 gene polynorphisms utilizes comparative genomics method according to the Myo6 gene order design primer of people, with the genomic dna of pig for template amplification, amplified fragments utilizes order-checking screening SNP, find that there is the base mutation of a G/A at the 709th place, cause PCR-RFLP-XbaI polymorphism, and utilize this have detected distribution situation that this is marked at China and foreign countries' pig kind.
Get 25 age in days Shaziling pig longissimus dorsi muscles, the synthesis of Total RNAs extraction and cDNA the 1st chain uses SUPERSCRIPTIIRT enzyme and Auele Specific Primer 3'445-1 to carry out the synthesis of gene first chain cDNA to total serum IgE, uses the cDNA of RNaseMix to synthesis to go RNA process.
Utilize RACE test kit to carry out 5 '-RACE amplification, intermediate sequence and 3 '-RACE are spliced to obtain the full length cDNA sequence of Myo6 gene, thus complete the clone of Myo6 gene of the present invention.
Design of primers: utilize comparative genomics method according to the intron between the 11st exon of the Myo6 gene (the GenBank number of including is NC_000006.12) of people to the 12nd exon, BLAST is made at GenBank with this gene, Myo6 gene candidate SNPs site is filtered out after sequence alignment, choose Myo6 gene candidate SNPs site, with reference to GenBank sequence NC_000006.12 primers, use this site of PCR-RFLP technical identification.Forward primer is 5 '-ACTACGGGAACTCCAACC-3 ', and reverse primer is 5 '-ACTTAACCAAATGCCACC-3 '.
PCR reaction conditions: PCR reaction system (cumulative volume 20 μ L), comprises 10 × Buffer2 μ L, 2mmol/LdNTPs1.6 μ L, 20mmol/LMgCl
21.6 μ L, Taq DNA polymerase (5U/ μ L) 0.4 μ L, DNA profiling (100ng/ μ L) 1 μ L, upstream and downstream primer (10pmol/ μ L) each 0.4 μ L, ddH
2o12.6 μ L.
PCR response procedures: 94 DEG C of denaturation 7min; 94 DEG C of sex change 45s, 59 DEG C of annealing 30s, 72 DEG C extend 45s, totally 30 circulations; 7min is extended, last 4 DEG C of preservations after 72 DEG C.
Get 10 μ LPCR amplified productions, after adding 2 μ L tetrabromophenol sulfonphthalein sample-loading buffer mixings, point sample, on the sepharose (containing 0.05%EB) of 2%, puts 6 μ L100bpDNAMarkers as reference.5V/cm electrophoresis 0.5-1.0h.
The XbaI enzyme cutting of PCR primer: add 0.8 μ L10 × restriction endonuclease damping fluid, 0.2 μ L restriction enzyme and 1 μ L distilled water in 10 μ LPCR products, cumulative volume is 12 μ L, 37 DEG C of digestion 4-10h.The 2% agarose gel electrophoresis analysis of A/G site, 5V/cm electrophoresis 0.5h, observations under ultraviolet lamp is also taken pictures.
The XbaI polymorphism of PCR-RFLP technology for detection Myo6 gene.
The present invention with pig Myo6 gene for research object, with 5 local pig breeds (Shaziling pig, Ning Xiang Swine, Pu city gagger pig, the black pig in the Land of Peach Blossoms, Daweizi pig) and 1 external pig kind (Large White), wherein Large White 167, the black pig in the Land of Peach Blossoms 58, Shaziling pig 100, Pu city gagger pig 74, Ning Xiang Swine 196 and Daweizi pig 228, amount to 823.
Applicant devises amplification and comprises this SNP primer, and the sudden change in G/A site adopts XbaI to carry out enzyme and cuts detection polymorphism by analysis.In the fragment of the 866bp of amplification, there is the restriction enzyme site of 1 XbaI, there are 3 kinds of genotype in the A/G site that electrophoresis detection result is presented at Myo6 gene: GG type (705bp, 161bp), AG type (866bp, 705bp, 161bp) and AA genotype (866bp).
Myo6 Gene A/the gene frequency in G site, genotype frequency are detected, and analyzes its genetic polymorphism.
The distribution situation of PCR-RFLP-XbaI polymorphism in each kind is as shown in table 1, as shown in Table 2, in Shaziling pig, Ning Xiang Swine, Pu city gagger pig, the black pig in the Land of Peach Blossoms, Daweizi pig, these 6 kinds of Large White, G gene is advantage allelotrope, and wherein this gene frequency of Shaziling pig is up to 0.84.From genotype distribution frequency, GG type is preponderated in distribution, and AA type individuality is less, only in Daweizi pig, finds 9, in Large White, find 3, finds 1 in Shaziling pig, and Pu city gagger pig, the black pig in the Land of Peach Blossoms do not find AA type.
The gene frequency in table 2 different varieties Myo6 Gene A/G site and genotype frequency distribution
As shown in Table 3, the hereditary homozygosity (Ho) of 7 pig kinds is all more than 0.5, and Large White genetic heterozygosity is 0.4266 a little less than 0.5.Except Ning Xiang Swine and Daweizi pig, the effective number of allele (Ne) of all the other 4 local pig kinds is all lower than Large White pig kind.From polymorphism information content, except the polymorphism information content (PIC) of Shaziling pig is lower than 0.25, result shows as low polymorphic; The polymorphism information content (PIC) of other 6 product boars is between 0.25 – 0.5, belong to moderate polymorphic, this gene locus is described, Large White, Daweizi pig, Shaziling pig, Pu city gagger pig and Land of Peach Blossoms pig have genetic polymorphism, and have higher heritable variation.
The gene genetic polymorphism analysis of table 3Myo6 Gene A/G variant sites
Claims (5)
1. a pork quality trait related gene Myo6, its nucleotide sequence is as shown in SEQIDNO:1.
2. pork quality trait related gene Myo6 as claimed in claim 1, there is the base mutation of 1 G/A at the 709bp place of sequence table SEQ IDNO:1, causes PCR-RFLP-XbaI polymorphism.
3. test right requires the primer pair of pork quality trait related gene Myo6 base mutation described in 2, and wherein, forward primer is 5 '-ACTACGGGAACTCCAACC-3 ', and reverse primer is 5 '-ACTTAACCAAATGCCACC-3 '.
4. the application of pork quality trait related gene Myo6 in pig molecule mark assisted Selection described in claim 1 or 2.
5. the application of primer pair according to claim 3 in pig molecule mark assisted Selection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510671508.9A CN105112425A (en) | 2015-10-16 | 2015-10-16 | Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510671508.9A CN105112425A (en) | 2015-10-16 | 2015-10-16 | Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105112425A true CN105112425A (en) | 2015-12-02 |
Family
ID=54660539
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510671508.9A Pending CN105112425A (en) | 2015-10-16 | 2015-10-16 | Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105112425A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070662A (en) * | 2016-11-15 | 2018-05-25 | 大韩民国（农村振兴厅长） | Genetic marker for determining quality character of pork and application thereof |
| KR20190100798A (en) * | 2018-02-21 | 2019-08-29 | 대한민국(농촌진흥청장) | Composition for predicting meat quality of pork and method for simple and rapid predicting of meat quality using thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102776273A (en) * | 2011-12-26 | 2012-11-14 | 华中农业大学 | Genetic marker using pig MLC(myosin light chain)2 5' flanking promoter region SNP (single nucleotide polymorphism) as pig carcass traits and application |
| KR20150010881A (en) * | 2013-07-19 | 2015-01-29 | 중앙대학교 산학협력단 | Biomarkers for Predicting Fertility and Method for Predicting Fertility Using the Same |
-
2015
- 2015-10-16 CN CN201510671508.9A patent/CN105112425A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102776273A (en) * | 2011-12-26 | 2012-11-14 | 华中农业大学 | Genetic marker using pig MLC(myosin light chain)2 5' flanking promoter region SNP (single nucleotide polymorphism) as pig carcass traits and application |
| KR20150010881A (en) * | 2013-07-19 | 2015-01-29 | 중앙대학교 산학협력단 | Biomarkers for Predicting Fertility and Method for Predicting Fertility Using the Same |
Non-Patent Citations (1)
| Title |
|---|
| GENBANK登录号：NC_010443.4: "sus scrofa breed mixed chromosome 1, Sscrofa10.2", 《GENBANK数据库》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070662A (en) * | 2016-11-15 | 2018-05-25 | 大韩民国（农村振兴厅长） | Genetic marker for determining quality character of pork and application thereof |
| CN108070662B (en) * | 2016-11-15 | 2022-02-25 | 大韩民国（农村振兴厅长） | Genetic marker for determining pork quality traits and application thereof |
| KR20190100798A (en) * | 2018-02-21 | 2019-08-29 | 대한민국(농촌진흥청장) | Composition for predicting meat quality of pork and method for simple and rapid predicting of meat quality using thereof |
| KR102019997B1 (en) | 2018-02-21 | 2019-09-10 | 대한민국 | Composition for predicting meat quality of pork and method for simple and rapid predicting of meat quality using thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004235B (en) | SNP locus related to rapid growth of fugu obscurus and application | |
| CN105755131B (en) | Genetic marker associated with pork quality traits and carcass traits | |
| CN104450729B (en) | Pig flesh characters is correlated with the clone of WNT10B gene molecule marker and application | |
| CN104774836A (en) | Polygene pyramiding early-breeding method for raising litter size of sheep | |
| CN101440399B (en) | Molecular marking method for indicating and identifying litter size in pigs by MMP23 gene | |
| CN101824416B (en) | Pork quality trait related gene DGAT1 and application thereof in porcine marker-assisted selection | |
| CN108546765A (en) | A kind of and the relevant SNP marker of Gaoyou duck muscle growth development character, its acquisition methods and application | |
| Sun et al. | Genetic variation in eight Chinese cattle breeds based on the analysis of microsatellite markers | |
| CN103966231B (en) | Pig flesh characters is correlated with the molecular cloning of GLP2R gene fragment and application | |
| CN105112425A (en) | Molecular cloning and application of pork quality character related gene Myo6 (Myosin 6) | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| KR102019997B1 (en) | Composition for predicting meat quality of pork and method for simple and rapid predicting of meat quality using thereof | |
| CN103525822B (en) | The molecular mark detection method that a kind of piglet diarrhea resistance is relevant and application | |
| CN104109669B (en) | Genetic markers and application of the pig AMPD1 gene promoter regions SNP as hog on hook character | |
| CN103224941B (en) | A kind of detect the relevant molecular marker of pig flesh characters and application | |
| CN103333899B (en) | Cloning and application of CDC16 gene molecular marker related to pork quality character | |
| CN102943076B (en) | Cloning and application of beef quality-related gene CMYA1 | |
| CN105063059A (en) | Cloning and application of pork quality character related GADD45G gene molecule marker | |
| CN104342435B (en) | The molecular cloning of fat thickness at back of pig correlation SLC13A5 genes and application | |
| CN105200148B (en) | A kind of method and kit for aiding in detection meat breast dual-purpose ox trunk composition character | |
| Teneva et al. | Short tandem repeats (STR) in cattle genomics and breeding | |
| CN103898120B (en) | The molecular cloning of pig NR1H4 gene and application | |
| KR101505120B1 (en) | DNA marker for detecting improvement of porcine meat quality using SNPs in region of muscle specific microRNA-208b | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof | |
| Akram et al. | Molecular characterization of myostatin gene in Malpura sheep of Rajasthan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151202 |
|
| RJ01 | Rejection of invention patent application after publication |