CN102943076B - Cloning and application of beef quality-related gene CMYA1 - Google Patents

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to cloning and application of a beef quality-related gene CMYA1. The mRNA (micro Ribonucleic Acid) sequence of the cloned CMYA1 gene is shown as SEQ ID NO: 1, the protein sequence of the cloned CMYA1 gene is shown as SEQ ID NO: 2, an SNP (single nucleotide polymorphism) marker locus is formed at the second exon 1058bp of the CMYA1 gene due to C/T mutation, an SNP marker locus is formed at the second exon 2168bp of the CMYA1 gene due to C/T mutation, and primer sequences for detection of SNP markers are shown as SEQ ID NO: 3 to SEQ ID NO: 6. The beef quality-related SNP marker in the gene CMYA1 is used as a genetic marker for molecular breeding of Simmental beef. New information is provided for a cattle genome database, and references are provided for application of genes with excellent traits. A new technical indictor is provided for detection of the beef quality due to the application of polymorphic sites of the SNP, and a new marker is provided for marker-assisted breeding of cattle.

Description

A kind of clone and application of beef qualitative correlation gene CMYA 1

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of clone and application of beef qualitative correlation gene CMYA 1.

Background technology

Along with improving constantly of standard of living, people are also more and more higher to the requirement of meat quality.The index of tolerance meat quality mainly comprises pH value, is waterpower, intramuscular fat content, tender degree, yellowish pink, diameter of muscle fiber, cold cuts rate, storage loss etc.Intramuscular fat content (Intramuscular fat, IMF) is an important indicator of tolerance meat quality.Research finds that suitably improving intramuscular fat content will make Meat Tenderness and succulence improve, thereby improves the quality of meat.Beef has the features such as high protein, lower fat, low-cholesterol, nutritious, is the first-selection of world Rou Ye developed country consumption of meat always, and the beef consumption of China is also rising year by year.

Muscle in animal body can be divided into three major types: skeletal muscle, cardiac muscle and unstriated muscle.The 40-60% of skeletal muscle percentage of liveweight, is determining the meat yield of domestic animal.Skeletal muscle is comprised of a large amount of myofiber (myofiber), and each myofiber is exactly a myocyte.Myofiber can be divided into according to metabolic characteristic: red muscle fiber (slowly aerobic shrinkage type) and white muscle fiber (fast glycolytic shrinkage type), also have in addition the contained enzyme activity of a kind of myofiber to occupy between this two classes myofiber, pinkiness is intermediate muscle fiber.The composition of the muscle tissue of CMYA family gene and animal has close relationship.The process of growth of skeletal muscle relates to the expression of large quantities of genes and transcribes the regulation and control with translation skill, and the expression regulation of the meat-producing traits difference of Different Individual or different breeds of cattle and embryonic stage and raw late gene is closely related.CMYA is primary cardiomyopathy associated protein (cardiomyopathy associated protein, CMYA), and the research about CMYA family gene at present mainly concentrates on the interaction to this gene and myoprotein.In order to explore the molecular genetic mechanism of China and foreign countries' ox kind phenotypic difference on muscle growth and meat quality, our previous work adopts mRNA differential display technique to express EST(expressed sequence tag with adult Mongolia Cattle longissimus dorsi muscle histological difference to two Representative Cultivars summer Lip river of growing up) analyze, wherein new EST expression amount in Xia Luo comes is apparently higher than Mongolia Cattle.Further by upper people's nonredundancy (non redundancy, the nr) sequence library of comparison GenBank, find that this EST is corresponding to people's primary cardiomyopathy associated protein 1 (cardiomyopathy associated 1, CMYA1) gene.Utilize the expression rule of in situ hybridization and Northern hybridization research CMYA1 gene, find that the mRNA level of CMYA1 gene is up-regulated expression in the chicken embryo heart tissue of growing, subsequently the identified called after of this gene " cXin " or " heart ".Someone utilizes cXin sequence to compare in EST public database and has found the homology EST of this gene on mouse, and screen, identify in mice skeletal cDNA library this EST as probe, after this by upper this unnamed gene of mouse, be mXin α, also utilize cXin to process the chicken embryo of hatching simultaneously, found that the dirty aberrant morphogenesis of chicken blastophore, infer that thus cXin plays an important role in heart development.Studies have found that the homologous gene of mXin α on people is CMYA1, by radiation hybrid by this assignment of genes gene mapping at 3p21.2-p21.3, genomic dna sequencing result shows that this gene is positioned at 3p22.2.By cXin cDNA sequence, as probe, carry out low rigorous Southern hybridization with the genomic dna of mouse, found the existence of another one mXin β, people upper mXin β be again CMYA3 gene, is positioned at people's 2q24.3.CMYA1 is the Actin muscle binding motif that a class is new, specifically expressing in voluntary muscle, Actin muscle (actin), TnC (troponinC), TnT (troponin T) and Actin muscle gelsolin (gelsolin) are its interact proteins, the product of its coding is positioned at the junction of adult animals heart intercalated disc, may participate in the formation of heart intercalated disc and the integrity that maintains sarcostyle.

In real work, people attempt to find a kind of method of easy live body evaluation carcass quality, to reduce, butcher the financial loss of bringing, and therefore large quantity research is devoted to find the optimum prediction index that trunk forms.And development and the application of DNA molecular marker technology at present, for the rapid evaluation of carcass quality has been opened up new way.Therefore molecular genetic marker may overcome this shortcoming and earlier kind of an ox be selected, and suitable genetic marker, for carrying out marker assisted selection, is accelerated genetic progress, and finally to realize molecular breeding be extremely important.In addition, the polymorphism of research mutational site in colony, and carry out the strong means that proterties association analysis is research gene function.In colony, by proterties association analysis, find the gene relevant to ox important economical trait, carry out molecular breeding and be all the time the important and difficult task of of breeder.

CMYA1 gene is an important muscle growth development related gene, this gene is used in the selection of molecule aid mark significant, separating clone beef qualitative correlation gene CMYA 1 also carries out the association analysis of its polymorphism and carcass trait, can develop the new technology for detection of beef matter index, for the marker-assisted breeding of ox provides new mark.

Summary of the invention

The object of the invention is to Separation of Bovine meat genes involved CMYA1, obtain CMYA1 gene mRNA sequence, the clone of realization to beef qualitative correlation gene CMYA 1, by the RFLP polymorphic detection to clone gene, the association analysis of RFLP polymorphism and carcass trait, set up RFLP polymorphism for detection of the technology of beef matter index, and provide new mark for the marker-assisted breeding of ox.

The present invention solves its technical problem and takes following technical scheme to realize:

A beef qualitative correlation gene CMYA 1, this CMYA1 gene mRNA sequence is as described in SEQ ID NO:1, and this CMYA1 gene protein sequence is as described in SEQ ID NO:2.

And there is a SNP marker site at the exon 2 1058bp place of CMYA1 gene, for C/T sudden change, at exon 2 2168bp place, there is a SNP marker site, be C/T sudden change.

A clone for beef qualitative correlation gene CMYA 1, preparation process is as follows:

The first step, by inquiry ncbi database ( http:// www.ncbi.nlm.nih.gov/guide/) and Ensembl database ( http:// asia.ensembl.org/index.html) utilize comparative genomics method to obtain CMYA1 gene mRNA sequence in conjunction with RT-PCR technology:

(1) by Query Database, obtain Homo sapiens cardiomyopathy-associated protein 1 (CMYA1), mRNA sequence NM_194293.2 and Mus musculus cardiomyopathy-associatedprotein 1 (CMYA1), mRNA sequence NM_011724.3;

(2) utilize Highly similar sequences (megablast) comparison ox expressed sequence tag EST for NCBI BLAST instrument, choose the expressed sequence tag sequences Design RT-PCR primer that homology is greater than 80%, fill up the vacancy between expressed sequence tag;

(3) utilize

reagent (Invitrogen, USA) extract cor bovinum and the total RNA of muscle, RevertAidTM Premium Reverse Transcriptase (Fermentas) reverse transcription becomes the cDNA corresponding vacancy that increases, RT-PCR product is reclaimed to test kit (Solarbio, China) recovery connection with glue and enter the order-checking of pUCM-T carrier.

Second step, according to CMYA1 gene mRNA sequence, utilizes the method for comparing to carry out chromosomal localization and gene structure analysis and the albumen characteristic analysis of CMYA1 gene:

The 3rd step, finds out two SNP sites of CMYA1 gene, and design primer amplification is containing the genomic dna in SNP site:

(1) find out two SNP sites of CMYA1 gene;

(2) according to gene order design primer amplification, go out the nucleotide fragments at SNP to be measured place;

The 4th step, RFLP-PCR polymorphic detection.

And (2) the of described preparation process the 3rd step designs the primer sequence of nucleotide fragments that primer amplification goes out SNP to be measured place in step as shown in SEQ ID NO:3 ~ 6.

An application for beef qualitative correlation gene CMYA 1, using in gene CMYA 1 with the SNP mark of beef qualitative correlation as Simmental beef molecular breeding genetic marker.

And, using as follows as the step of beef molecular breeding genetic marker with the SNP mark of beef qualitative correlation in gene CMYA 1:

The first step, the association analysis of ox CMYA1 gene Hin6I-RFLP genotype and Part Traits;

Second step, the association analysis of ox CMYA1 Gene A paI-RFLP genotype and Part Traits;

The 3rd step, determines that gene CMYA 1 and SNP site thereof are for detection of carcass traits such as lipid content and tare weights between individual flesh.

Advantage of the present invention and effect are:

1, Separation of Bovine meat genes involved CMYA1 of the present invention; utilize comparative genomics method to obtain CMYA1 gene mRNA sequence in conjunction with RT-PCR technology; and the chromosomal localization of definite CMYA1 gene and the structure of gene; can be for cow genome group database provides new information, for the utilization of high-quality character gene provides reference.

2, CMYA1 gene is an important muscle growth development related gene, this gene is used in the selection of molecule aid mark significant, the present invention chooses two SNP sites of CMYA1 gene, the nucleotide fragments that goes out SNP to be measured place according to gene order design primer amplification, carries out RFLP-PCR with Hin6I and ApaI respectively.In the cows of analyzing, utilize two pairs of primers for different mutational sites, by PCR-RFLP, detect genotype and the gene frequency in each SNP site.And for Simmental, carry out proterties association analysis with 130 13 months large F3, and confirm available beef molecular breeding genetic marker, can develop the new technology for detection of beef matter index, for the marker-assisted breeding of ox provides new mark.

Accompanying drawing explanation

Fig. 1 is used online software in the present invention http:// cn.expasy.org/tools/the prediction CMYA1 protein function territory figure that predicts the outcome;

Fig. 2 is C1058-T1058 of the present invention site and C2186-T2186 site pcr amplification and genotype demonstration figure, wherein Fig. 2 (a) is that C1058-T1058 site PCR and Hin6I-RFLP genotype show figure, and Fig. 2 (b) is that C2186-T2186 site PCR and ApaI-RFLP genotype show figure.

Embodiment

Below in conjunction with specific embodiments, the present invention is further described, and its specific embodiments is only construed as illustrating, and is not determinate, can not illustrate to limit protection scope of the present invention with following.

Technological line of the present invention is: the total RNA extraction of ox muscular tissue, RT-PCR obtain full length cDNA sequence, obtain the mRNA sequence of CMYA1 gene, utilize the method for comparison to carry out chromosomal localization and gene structure analysis and the albumen characteristic analysis of CMYA1 gene, design primer amplification containing the association analysis of genomic dna, RFLP polymorphic detection, RFLP polymorphism and the carcass trait in SNP site, and confirmation can be used as beef molecular breeding genetic marker SNP site.

A kind of clone's step of beef qualitative correlation gene CMYA 1 is as follows:

The first step, by inquiry ncbi database ( http:// www.ncbi.nlm.nih.gov/guide/) and Ensembl database ( http:// asia.ensembl.org/index.html) utilize comparative genomics method to obtain CMYA1 gene mRNA sequence in conjunction with RT-PCR technology:

(1) by Query Database, obtain Homo sapiens cardiomyopathy-associated protein 1 (CMYA1), mRNA sequence NM_194293.2 and Mus musculus cardiomyopathy-associatedprotein 1 (CMYA1), mRNA sequence NM_011724.3;

(2) utilize Highly similar sequences (megablast) comparison ox expressed sequence tag EST for NCBI BLAST instrument, choose the expressed sequence tag sequences Design RT-PCR primer that homology is greater than 80%, fill up the vacancy between expressed sequence tag;

(3) utilize

reagent (Invitrogen, USA) extract cor bovinum and the total RNA of muscle, RevertAidTM Premium Reverse Transcriptase (Fermentas) reverse transcription becomes the CDNA corresponding vacancy that increases, RT-PCR product is reclaimed to test kit (Solarbio, China) recovery connection with glue and enter the order-checking of PUCM-T carrier; Its concrete steps are:

1. RNA extracting: Simmental cor bovinum and the muscle tissue of utilizing laboratory to preserve are extracted total RNA, post transcription cloning CMYA1 gene;

Getting 50-100mg, to organize liquid nitrogen to be ground to Powdered, adds 1ml Trizol, treats that Trizol reagent and tissue are melted into liquid, mixture after 10 minutes, added in 1.5ml centrifuge tube to the standing 5min of room temperature as for homogenate in glass homogenizer; 4 ℃ of 12000rpm * 5min are centrifugal, get supernatant and put into a new centrifuge tube; Add 0.2ml chloroform, thermal agitation 15s, standing 3min; 4 ℃ centrifugal, and 12000rpm * 10min, gets supernatant; Add 0.5ml Virahol, mix, on ice standing 20-30min.4 ℃ centrifugal, and 12000rpm * 10min, abandons supernatant; Add 1ml 75% ethanol, washing precipitation 2 times.4 ℃, 7500g * 5min, abandons supernatant; Room temperature place dry or super clean bench in dry up 5min left and right, add the Rnase-free H2O of 20 microlitres to dissolve; Electrophoresis detection-RNA electrophoresis result;

2. reverse transcription: cDNA the first chain is synthetic:

In 0.2-ml PCR pipe, add following reagent: 5 μ l total RNA, 50pmol of random primer, 50pmol of oligo (dT) primer, 1 μ L dNTPs (10mM each), 70 ° of C temperature are bathed 5min.

Ice bath 10sec, centrifugally add following reagent: 4.0 μ l 5*Reaction Buffer, 1.0 μ l dNTP Mix(10mmol/L), 1.0 μ l RNA enzyme inhibitorss (20U/ μ l), 2.0 μ l RevertAidTM PremiumReverse Transcriptase, 20.0 μ l Total volume, 37 ° of C temperature are bathed 5min;

42 ° of C temperature are bathed 60min;

70 ° of C temperature are bathed 10min.Termination reaction;

Above-mentioned solution-20 ° C is preserved;

3. RT-PCR reaction system and step:

Reaction system: 1.25 μ L (50ng) of cDNA, 1 μ L of each primer (10 μ M) (as table 1), 0.5 μ L dNTPs (10mM), 2.5 μ L of 10 * PCR buffer with 1.5mM MgCl2,0.625unitsof Taq DNA polymerase (CW, BioTech Co.Ltd, China), and 18.625 μ L nuclease-freewater, 25 μ L reaction mixture containing Total volume;

PCR reactions steps: 94 degree denaturation 5min, 94 degree sex change 30s, (TmF+TmR/2) degree 30s, 72 degree extend (the extension time is according to PCR product size 1Kb/min) 35 circulations, and 72 degree extend 15 minutes;

Table 1.CMYA1 RT-PCR primer

4. product reclaims to connect and enters the order-checking of pUCM-T carrier:

Product reclaims:

Under ultraviolet lamp, cut the sepharose that contains target DNA, weigh gel weight, with 1mg=1 μ l conversion gel volume.The sol solution that adds 3 times of gel volumes; After suspending evenly in 55 ℃-65 ℃ heating 10min, during every 2-3min rock once, until gel piece melts completely; DNA-agarose solution is added to one and reclaims on purification column, and pillar is contained in to a clean 2ml collects in vitro, the centrifugal 1ml of 13000rpm, discards effluent liquid.For volume, be greater than the sample of 700 μ l, be added to respectively on different pillars, each 700 μ l; Lavation buffer solution washing pillar with 700 μ l dehydrated alcohol dilutions, adds rear standing 2-3min in pillar.The centrifugal 1min of 13000rpm under room temperature; Abandon filtrate, with same method, wash again once;

Pillar is contained on the clean 1.5ml centrifuge tube of sterilizing, and, on base for post matter, the centrifugal 1min of 13000rpm is to elute DNA to add the DNA elution buffer of 30-50 μ l or aseptic deionized water (65 degree preheating).Get 3 μ l samples, 1% agarose gel electrophoresis detects and reclaims result.Reclaiming product-20 degree preserves.

PCR product is directly connected with T carrier:

In advance by PCR instrument (or water) in ice chest Temperature Setting at 16 ° of C, get the 200ul Eppendorf tube of sterilizing one by one, add: 4 μ L goal gene, 1 μ L T carrier, 1 μ L ligase enzyme damping fluid 10 x buffer, 1 μ L PGE, 1 μ L T4 DNA ligase (5U/ul), 2 μ L aqua sterilisas.Of short duration centrifugal again after above-mentioned mixed solution light shaking, be then placed in 16 ° of C PCR Wen Yizhong incubated overnight (16h).Product after connection is used for transformed competence colibacillus cell immediately, and picking mono-clonal utilizes universal primer M13R and M13F order-checking;

(4) obtain CMYA1 mRNA total length;

Splicing NCBI expressed sequence tag EST:DV802652.1, DY086104.1, DY191701.1, DY051477.1, DY043391.1, BM287640.1, EE371471.1, DV791878.1 and RT-PCR product sequencing result, obtain Bos taurus cardiomyopathy-associated protein 1(CMYA1) mRNA, CMYA1 mRNA sequence 6272bp, sequence is as shown in SEQ ID NO:1

CMYA1 mRNA sequence: SEQ ID NO:1 is as follows:

acagaccccgagctagggcagcgagaaggcgtccgacggagccagcagagtgagagcagcccaaacaagaggaaccgacagagccgcaggcctcacctgccgaagaccccaaaccccaacagccaggcagaacccgcagaaggatggccaatgcccagacgcagatggcccccaccccaaccatcccgatggcagctacagaggacctgcccctccctccaccacctgccctggaggatctaccaccgccgccacccaaggagtccttctccaagttccaccagcagcggcaagccagcgagctccgccgcctctacaagcacatccaccctgagctccgcaagaatctggctgaggccgtggccgaagacttggctgaggtcctgggttccgaggagcccaccgagggtgatgtccaatgcatgcgctggatctttgagaactggcggctcgatgccattggggaccatgagaagccacctgccaaggagtccgtgcctggtggcaacgtccaggccacctcccgcaagtttgaggaaggctcctttgctaatagtataaaccaggagccggctggacctcggccatctggaggggacgtgcgtgcagcccgccagctgtttgagacaaagccgctggatgcgctgacagttcgtgctgaagcatcagaggctacagtgagggagcctgcagccagtggagacgtccagggtaccaggatgctctttgagacacggccactggaccgccttggctcccgcccctccacccaggagcagagccccttggagctgcgctcagagatccaggagctgaaaggcgatgtgaagaagacagtgaagctattccaaacagagccgctgtgtgccatccaggactcagagggcgccatccacgaggtcaaggccgcctaccgggaggagatccaaagcaacgcagtgaggtctggccgttggctcttcgagaccaagcctctggatgccatcaaccgggaccccagccaggtgcgggtgatccgggggatctccctggaggaggcagcccggcctgatgtcagcgcgactcgctggatctttgagacacagcccctggatgcgatccgggagatcttagtggatgagcaggacttccagccatccccggaccttatccctcctggtccggatgttcagcagcagcggcgtctgtttgagacccgagcattagacactctcaagggggaagaggaggccggagcagaggccccacccaaagaggcagtggtccccggtgacgtccgctccaccctgtggctgtttgagacgaagcccctggacaccctcagagacaatgtccaagtgggtcatctccagcgggtgggtccccaggagggcgagaggttcacaaacgagcatctatccaatgctgacccctcagcaccaaccctctctcagggtgccccccagagggatggggtgaagggagatgtgaagaccttcaagaacctttttgagacccttcccctggacagtatcgggcagggggaagctttggcccctgggagcatatgcagagcagaaggaactgattctgccgggcagtcccaggacacagggtccccagtgtacgccatgcaggatggcaaaggtcacctccatgccctgacctccgtcagcagagaacaggtagtcggaggtgacgtgcagggttacaagtggatgtttgagacacagcccctagaccgactaggccgaagccccagtaccgtcgatgtggtgcggggtatcacccagcaggaagtggtggctggagatgtgggcactacccggtggctctttgagacacagcccctggaggtaatccaccaacgggagcagcaggaacgagaggaagaagaaggaaagcctcagggaggccctcagcccgaaataccccacaagggtgacgtgcagaccatccgctggttgttcgagacgtgcccgatgagtgagctggccgagaggcaggggtcagaggtcacagacctcacaagcaaggcacggtcgtgcacctggatgttcgcgccccaatccccggactggcctgaaggctccaaggagcagcaccttgaggtgagccaggtccaggctggggaaagacagacggagagacacgtctttgaaactgagcctctgcaggccgcgggccacccctgcggaagggggcccgtgcggtactgcagcagagtggacatcccctcggggcaggtgtctcgtcagaaggaggttttccaggctctggaggcaggcaagagagaagaccagggacccagggaaatccctgagcccatatcagcgggctcagtgcacaagttcacctggctctttgagaactgccccatgggctccctggcagctgagagcatccgagggggcaacctccaggaagagcagcccgtgggtccctcgggcaagggggtgccggagaggcaagagactgcggccgaggggaccctgcggacgctgcatgccacgcctggcgtcctgcaccatggaggcatcctcatggaggcccgagggccaggggagctctgcctcgccaggtacgtgctcccatgcccagggcaggacagcccccatgttcggaaggaggagctggtgtctggggaactccccaggattgtccgccaagtgctgcgccgggcagacgtggaccagcaggggctgctggtgcaggaggaccccgcgggccagcttcacctcaagccgctgaagctgccagcgccaggcagcagcgggagcatcgaagacatggaccctgagttccagcagttgctggcttgtggcctcgggacctcggcggggaggacggggctggtgatgcaggagacagagcggggcctggtggcgctgaccgcctactccctgcaaccctggctagccagcagggcccccgaaaggagcagtgtgcagctgctggccggctgcataaacaaaggagacctgagtggcctgcacaatctgcggtgggagccgccggctgactcaagtccagtgccggccagcaagggggcccagaagctgcccccagctgaaagcatcatccacgttcccccactggaccctggcaaggggatggggcatctgagagggccgggggccaccccctgcgccccacaggccgctggaaaggcagtctctctggctggggaagaaaagcaggaaagcaggtgcactgggcagaaagggacggcagctttaggaaagtcagagggagccatgactatgcccccaggacctaggtttccagccctccaggtcactatgcagagtcgaaggacgccaacagcccaagcccaaagcctgcagcagcaagctcggagcaagcacaagccgggccccacccctggggccgcctctctgcccacccaggatgggcttccgcaagcaccggccgcagggactgcccagagcaacagcaagcctctggcgggaggcaaccccaggatcccagcagcccccagcaaggtcagtggggaacagaaagcactgcctggagggctatctggggggtgggtgactattcaggatggcatctacactgctcatcccgccaggacctttgacctacccggggctgtctggccatctgggcaaggaccctttccactcctggaaggcctgggtcagagtctcgggcccgggcaagaggagctggggggccacacacagaaggcctgggagcctccagagaaggtgatggcaggactcggcccagggggcctccaagctgcagagaccaccctgaaggctgccttagcccaccacactcgggcctctgagcctcgggcggcaggtgccagtctgcactctcgtaacgcctctgttcctcctcctcctcctctcccagcttctgtgacgggaccggacttcccagcccaacccaggcatgatgagaattccatccggcagacttccaagcccacgcaagacccccttctccactcccacaacagccctgctggccagaaaagccctgggcagccacagacaaagaccctgaaaccggagcctcccacacacctgagaaaaaagccccagctgccccccaaacctgcacacttaagccagctcccccttcctcgctggctgtccaagcccgcagccctggctcacagcgccgctgaggagggggggcaagggaaacacaaacaaggtgagactgctacagccaaccacgaccctcggccacacagggtctccatcgctgcagaccagggccgagtatctctaccccagggccctgctggacagagccagcccagcccccagcatggccccagcaccgtggcccccagccccaccaagagccaggcgataggcagcaacaaccacagccctgaccccctcaggctctcagctctcagcagccaccccatctcactgcagcagggccctagcctcacaggagagaagtgctcggacagttcccagcaaggggcccccaagagccctgagattctgcagggaggccagcaagagctccagggcctcctgagccaggtgcaagctctggagaaggaggccgaaagcactgtggacgtgcaggcgctgcagaggctctttgaggctgtgccccagctaccaggagcccctccggctcccgctaccccccacaagcctgaggcctcggtggagcaggcctttggggagctgacgagggttagcacagaagtggcccggctgaaggaacagaccctggccaggctgctggacatcgaggaggctgtgcacaaggcactcagctccatgtctagcctccagactgggactaacaccaggggccattcccagggacccccaaaggaacacagtgctcaagagatcagtgtcacagacagcgggagagtcaggcccaactgctcaggccaggaggtcaaaagtcaaactctagtcaagagccaaactgaggttacaagccatactgaggtccagagtcaagccaaggtcagaaatcactcagaggccggaagccaagcagccccggccaccccttccaccaggaagctggaggccttgagagaagactcgcaccttccccaagcgttacctctcagcagggagtcaccctcctccccaacctttatctccatggagtcggccacaaggaagcttccggaggaggccagccccaggggcaaccctgagatctctgtgaagagggcacatttcacgcaggatgaatgccagactcagccccaccagaaagatatctggcacaaggctggagagaaagaggccccccagctctctggaccgccaccacctggccctgctgcagccagcgccctgcccaccaggcagaagagtgctctggagccgcagacagcgccgggtggctcccggcacgatggagccacaggagcagggactgagagggtgggccagtgcaggaccacagcgctcgtgtcccccaccacggtcactgagcccgccgagccacccaggggcccaggcccccacctcgggcaccacacttcccccttgatgaggcagtttctgcacagccagactgggctcagcaccggcctggcagaagctgagatgctgcgtgtgccctgtggccaccccacaccaactgcgcagtgagcccctccatctgccaccacagtcttccacccacctccagggacccgggacggaggtgggtgctcacctcctgcacgcacggagaaagaaccaaaaagaaagggcatgttctgagatccaggggcagtttccctttcatcagtagcatccatgggccaggttcttgcaaaaggcagggggggatggtagggaagaagccctccggagtagcccaagcccagcaacagaatgggggcttgtggctgcttgtggagcatataatgtgtacagaaacacacgcttctcacacaggtctggcccgcacgccaacacaagtgagtctgcatgccactgcctgcgattgagccccctgagcgaccttccactttttcaatctttatttctttaatacgagtcaaatgttctcagccttctgctctttaattcctagagaagacagggccagccggattggtctctgttacatgttgatgggccccagaagggccccgtcatcagcacctccctcattcagcgggtcatcctggcagcacaaatttcacacagacaaagtctacgatcaccaatgtccctagaagccaaagattctctccacccccacagcctctcactttgtaccccaaagaagaaggatacagtctaataaaccaaagttttattcccttc

Second step, according to CMYA1 gene mRNA sequence, utilizes the method for comparing to carry out chromosomal localization and gene structure analysis and the albumen characteristic analysis of CMYA1 gene:

The genome sketch of ox is completed, and we have obtained CMYA1 gene mRNA sequence, so we have utilized the method for comparison to carry out the structural analysis of chromosomal localization and the gene of CMYA1 gene;

(1) CMYA1 is positioned at karyomit(e) Chromosome 22:12549676-12558895bp, there is intron of two exons, the long 6272bp of transcript, the long 1820residues of aminoacid sequence, the isoelectric points of proteins of deriving (Isoelectric point): 6.4162, molecular weight (Molecular weight): 194,814.91g/mol, CMYA1 protein sequence: sequence is as shown in SEQ ID NO:2

CMYA1 protein sequence: SEQ ID NO:2 is as follows:

MANAQTQMAPTPTIPMAATEDLPLPPPPALEDLPPPPPKESFSKFHQQRQASELRRLYKHIHPELRKNLAEAVAEDLAEVLGSEEPTEGDVQCMRWIFEN?WRLDAIGDHEKPPAKESVPGGNVQATSRKFEEGSFANSINQEPAGPRPSGGDVRAARQLFETKPLDALTVRAEASEATVREPAASGDVQGTRMLFETRPLDRLGSRPSTQEQSPLELRSEIQELKGDVKKTVKLFQTEPLCAIQDSEGAIHEVKAAYREEIQSNAVRSGRWLFETKPLDAINRDPSQVRVIRGISLEEAARPDVSATRWIFETQPLDAIREILVDEQDFQPSPDLIPPGPDVQQQRRLFETRALDTLKGEEEAGAEAPPKEAVVPGDVRSTLWLFETKPLDTLRDNVQVGHLQRVGPQEGERFTNEHLSNADPSAPTLSQGAPQRDGVKGDVKTFKNLFETLPLDSIGQGEALAPGSICRAEGTDSAGQSQDTGSPVYAMQDGKGHLHALTSVSREQVVGGDVQGYKWMFETQPLDRLGRSPSTVDVVRGITQQEVVAGDVGTTRWLFETQPLEVIHQREQQEREEEEGKPQGGPQPEIPHKGDVQTIRWLFETCPMSELAERQGSEVTDLTSKARSCTWMFAPQSPDWPEGSKEQHLEVSQVQAGERQTERHVFETEPLQAAGHPCGRGPVRYCSRVDIPSGQVSRQKEVFQALEAGKREDQGPREIPEPISAGSVHKFTWLFENCPMGSLAAESIRGGNLQEEQPVGPSGKGVPERQETAAEGTLRTLHATPGVLHHGGILMEARGPGELCLARYVLPCPGQDSPHVRKEELVSGELPRIVRQVLRRADVDQQGLLVQEDPAGQLHLKPLKLPAPGSSGSIEDMDPEFQQLLACGLGTSAGRTGLVMQETERGLVALTAYSLQPWLASRAPERSSVQLLAGCINKGDLSGLHNLRWEPPADSSPVPASKGAQKLPPAESIIHVPPLDPGKGMGHLRGPGATPCAPQAAGKAVSLAGEEKQESRCTGQKGTAALGKSEGAMTMPPGPRFPALQVTMQSRRTPTAQAQSLQQQARSKHKPGPTPGAASLPTQDGLPQAPAAGTAQSNSKPLAGGNPRIPAAPSKVSGEQKALPGGLSGGWVTIQDGIYTAHPARTFDLPGAVWPSGQGPFPLLEGLGQSLGPGQEELGGHTQKAWEPPEKVMAGLGPGGLQAAETTLKAALAHHTRASEPRAAGASLHSRNASVPPPPPLPASVTGPDFPAQPRHDENSIRQTSKPTQDPLLHSHNSPAGQKSPGQPQTKTLKPEPPTHLRKKPQLPPKPAHLSQLPLPRWLSKPAALAHSAAEEGGQGKHKQGETATANHDPRPHRVSIAADQGRVSLPQGPAGQSQPSPQHGPSTVAPSPTKSQAIGSNNHSPDPLRLSALSSHPISLQQGPSLTGEKCSDSSQQGAPKSPEILQGGQQELQGLLSQVQALEKEAESTVDVQALQRLFEAVPQLPGAPPAPATPHKPEASVEQAFGELTRVSTEVARLKEQTLARLLDIEEAVHKALSSMSSLQTGTNTRGHSQGPPKEHSAQEISVTDSGRVRPNCSGQEVKSQTLVKSQTEVTSHTEVQSQAKVRNHSEAGSQAAPATPSTRKLEALREDSHLPQALPLSRESPSSPTFISMESATRKLPEEASPRGNPEISVKRAHFTQDECQTQPHQKDIWHKAGEKEAPQLSGPPPPGPAAASALPTRQKSALEPQTAPGGSRHDGATGAGTERVGQCRTTALVSPTTVTEPAEPPRGPGPHLGHHTSPLMRQFLHSQTGLSTGLAEAEMLRVPCGHPTPTAQ

(2) use online software http:// cn.expasy.org/tools/prediction CMYA1 protein function territory:

As shown in Figure 1, gene structure territory predictive display CMYA1 albumen comprises a proline(Pro) and enriches district, a spiral corner spiral, 16 amino acid of eight Actin muscle bonding units repeat, and (T/S/G) X (R/K/T) WLFETXPLD of conserved sequence GDV (K/Q/R) is contained in this 16Ge amino acid repeating unit.

The 3rd step, finds out two SNP sites of CMYA1 gene, and design primer amplification is containing the genomic dna in SNP site;

(1) find out two SNP sites of CMYA1 gene:

By inquiry ncbi database, choose two SNP site SNP rs110346467 and the SNP rs110575295 of CMYA1 gene, wherein SNP rs110346467 is positioned at Chromosome 22:12554890bp, CMYA1 gene Second Exon 1058bp, is C/T same sense mutation (C1058-T1058); SNPrs110575295 is positioned at Chromosome 22:12553762bp, and CMYA1 gene Second Exon 2186bp is C/T same sense mutation site (C2186-T2186);

(2) according to gene order design primer amplification, go out the nucleotide fragments at SNP to be measured place:

1. primer sequence is as follows:

SEQ?ID?NO:3?6467-F?CCCGCAAGTTTGAGGAAG

SEQ?ID?NO:4?6467-R?CATTGGATAGATGCTCGTTTGT

SEQ?ID?NO:5?5295-F?CATCCGCTGGTTGTTCG

SEQ?ID?NO:6?5295-R?ACGGGCTGCTCTTCCTG

2. pcr amplification condition:

PCR reaction cumulative volume 20 μ L, wherein the about 100ng of cow genome group DNA, contains 1 * buffer (Promega); 1:5mmol/L MgCl2; dNTP final concentration is 150 μ mol/L, and primer final concentration is 0:2 μ mol/L, 2U Taq archaeal dna polymerase (Promega).Pcr amplification program is: 94 ℃ of 4min, and the 94 ℃ of 45s that circulate 5 times, 62 ℃ of 45s, 72 ℃ of 1min, and then 30 94 ℃ of 45s of circulation, 57 ℃ of 45s, 72 ℃ of 1min, last 72 ℃ are extended 5min.PCR reaction product detects and takes pictures with 2% agarose gel electrophoresis, as Fig. 2 (a), 2(b) shown in;

The 4th step, RFLP-PCR polymorphic detection:

(1) for two different SNP sites, select suitable restriction endonuclease to carry out RFLP-PCR:

RFLP-PCR is carried out with Hin6I and ApaI respectively in C1058-T1058 site and C2186-T2186 site, and PCR product endonuclease reaction volume is 15 μ L, 1 * buffer, 1.5 μ L wherein, and PCR product 3 ~ 5 μ L, restriction enzyme is 0.5 μ L (5U), uses H ₂o supplies 15 μ L, by centrifugal after sample blending, and 37 ℃ of water-bath 4h, with 2% agarose gel electrophoresis, detect enzyme and cut result, record genotype, under ultraviolet lamp, take pictures, C1058-T1058 site and C2186-T2186 loci gene type, as Fig. 2 (a), 2(b) shown in;

(2) to single nucleotide polymorphism, the distribution in cows is added up:

In the cows of analyzing, utilize two pairs of primers for different mutational sites, by PCR-RFLP, detect genotype and the gene frequency in each SNP site, statistics is as shown in table 2 and table 3;

Table 2.SNP rs110346467 (C1058-T1058) allelotrope gene frequency

Table 3.SNP rs110575295 (C2186-T2186) allelotrope gene frequency

By table, can find out C1058-T1058 site, in cows body, CC type is higher than CT type and TT type, and C allelotrope is protogene, and its frequency is greater than T allelotrope.C2186-T2186 site, in cows body, TT type is higher than CT type, and without CC type, T allelotrope is protogene, and its frequency is far longer than C allelotrope.

An application for beef qualitative correlation gene CMYA 1, step is as follows:

First, we determine that proterties association analysis carries out for Simmental with 130 13 months large F3, cows are raised a farm in Horqin, the Inner Mongol according to national feeding standard NY/T 815-2004, the raising term harmonization of all oxen, trunk and Meat Quality are surveyed and are carried out according to national beef segmentation standard GB/T 17238-2008

The first step, the association analysis of ox CMYA1 gene Hin6I-RFLP genotype and Part Traits:

Utilize the clone of beef qualitative correlation gene CMYA 1, the Hin6I-RFLP genotype detection result obtaining, target cows are carried out to the association analysis between genotype and growth traits, carcass trait and Meat Quality, having eliminated kind, butcher batch and sex between difference after, between genotype, simple mean and the standard error analysis of proterties the results are summarized in table 4, found that, SNP rs110346467 does not have proterties associated with ox part Meat Quality;

The association analysis of table 4.SNP rs110346467 proterties

Note: represent that without letter mark difference is not remarkable between each index genotype in table, P>0.05.

Second step, the association analysis of ox CMYA1 Gene A paI-RFLP genotype and Part Traits:

Utilize the clone of beef qualitative correlation gene CMYA 1, the ApaI-RFLP genotype detection result obtaining, target cows have been carried out to genotype and growth traits, association analysis between carcass trait and Meat Quality, eliminating kind, butcher batch and sex between difference after, between genotype, simple mean and the standard error analysis of proterties the results are summarized in table 5, found that, lipid content between SNP rs110575295 and flesh (Intermuscular fatty acid) QIB% significant correlation (p=0.049<0.05), between TT type flesh, lipid content is significantly higher than CT type, exceed 0.303%, with tare weight utmost point significant correlation (p=0.009<0.01), the TT type tare weight utmost point is significantly higher than CT type, exceeds 4.00kg, SNP rs110575295 can be used as the genetic marker of beef molecular breeding, according to the 2186th Nucleotide of CMYA1 gene Second Exon, be C or T, thereby determine that this individuality is in the allelotype in this mutational site, and the difference of assessing lipid content and tare weight between this individuality flesh with this, can be applied in the middle of the molecular mark of ox,

The association analysis of table 5.SNP rs110575295 proterties

Note: in table, between different genotype, lowercase mark represents significant difference, P<0.05; Capitalization mark represents that difference is extremely remarkable, P<0.01.

In sum, beef qualitative correlation gene CMYA 1 of the present invention and SNP site thereof can be used for detecting the carcass trait such as lipid content and tare weight between individual flesh, thereby for the molecular breeding of ox provides a new genetic marker, and will in the breeding of ox, play a significant role.

Claims (2)

1. an application for beef qualitative correlation gene CMYA 1, is characterized in that: using in gene CMYA 1 with the C2186TSNP mark of beef qualitative correlation as Simmental beef molecular breeding genetic marker.

2. the application of beef qualitative correlation gene CMYA 1 according to claim 1, is characterized in that: using as follows as the step of beef molecular breeding genetic marker with the C2186TSNP mark of beef qualitative correlation in gene CMYA 1:

The first step, to carrying out proterties association analysis with the C1058TSNP of beef qualitative correlation in gene CMYA 1, analytical results shows that this SNPrs110346467 and ox part Meat Quality do not have Traits;

Second step, to carrying out proterties association analysis with the C2186TSNP of beef qualitative correlation in gene CMYA 1, analytical results shows this SNPrs110575295 and ox growth traits, carcass trait and Meat Quality significant correlation;

The 3rd step, determines that gene CMYA 1 and C2186TSNP site thereof are for detection of lipid content between individual flesh and tare weight carcass trait.

Images