CN105647945A - Tandem duck Alpha and Nu interferon genes and preparation method and application thereof - Google Patents
Tandem duck Alpha and Nu interferon genes and preparation method and application thereof Download PDFInfo
- Publication number
- CN105647945A CN105647945A CN201610133500.1A CN201610133500A CN105647945A CN 105647945 A CN105647945 A CN 105647945A CN 201610133500 A CN201610133500 A CN 201610133500A CN 105647945 A CN105647945 A CN 105647945A
- Authority
- CN
- China
- Prior art keywords
- ifn
- duck
- linker
- pcr
- interferon genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/57—IFN-gamma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/191—Modifications characterised by incorporating an adaptor
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses tandem duck Alpha and Nu interferon genes and a preparation method and application thereof and belongs to gene fusion expression in the biotechnical field. A nucleotide sequence of the tandem duck Alpha and Nu interferon genes is shown as in SEQ ID No. 1. The invention also provides the preparation method of the tandem duck Alpha and Nu interferon gene, a prokaryotic expression plasmid Alpha and Nu interferon prokaryotic expression plasmid pET32a-IFNAlpha-linker-IFNNuexpressing the tandem duck Alpha and Nu interferon gene and its preparation method, and application of a fusion protein expressed by the tandem duck Alpha and Nu interferon gene in the preparation of duck antiviral drugs. Recombinant duck Alpha and Nu interferon prokaryotic expression plasmid pET32a-IFNAlpha-linker-IFNNu is established successfully herein, the duck IFN-Alpha and IFN-Nu genes are tandemly expressed on an Escherichia coli prokaryotic expression system, and it is also possible to ensure that the two interferon genes are expressed in a ratio of 1:1.
Description
Technical field
The invention belongs to the gene fusion expression of biological technical field, be specifically related to a kind of series connection duck ��, gamma interferon genes and its preparation method and application.
Background technology
Interferon (interferon, IFN) is the glycoprotein that a class has the various biological functions such as antiviral, antitumor and immunomodulating on allogenic cell. Nineteen fifty-seven, Isaacs etc. find first. The difference of the international interferon NK antigenic characteristic according to interferon and molecular structure, is divided into 2 types by interferon. Interferon-alpha (IFN-��) belongs to I type interferon, and in nineteen ninety-five, by successful clone such as Schultz and express, subsequently, researcher clones the IFN-�� gene of Beijing duck, Muscovy duck, sheldrake and Shaoxing duck in succession. IFN-�� gene is made up of 576 nucleotide, altogether 191 aminoacid of coding, containing signal peptide. Duck alpha-IFN gene between different cultivars is relatively conservative, and nucleotide sequence homology is between 99.5%��100%. IFN-�� is primarily involved in antiviral, antitumor process, and research shows, DHV is had certain therapeutical effect by restructuring duck IFN-��, it is possible to reduce hepatitis B virus cccDNA transcribing to pgRNA. Additionally, recombinant duck alpha interferon infected by influenza, Avian pneumo-encephalitis virus and reovirus also have certain inhibitory action. IFN-�� (IFN-��) belongs to II type interferon, 1999, and Schultz etc. demonstrates DuIFN-�� open reading frame and contains 495 bases, 164 aminoacid of codified. IFN-�� can induced viral infection cell express virus antigen, increase immune system identification and kill infection cell ability, be alternatively arranged as immunological adjuvant participate in body immunoreation. Research currently, with respect to duck recombinant interferon still is limited to the expression to single interferon and activity research, there is no two duck interferon gene expressing in series the example detecting its antiviral activity.
Bird flu (Avianinfluenza, AI) is the acute high degree in contact sexually transmitted disease caused by influenza virus (Avianinfluenzavirus), and clinical manifestation is serious morbidity and death, or slight respiratory tract infection, or asymptomatic.Within 1878, find in Italy first, at present, almost throughout world various places, cause serious economic loss to aquaculture. Influenza susceptibility with chicken and turkey in poultry is the highest, and animal also can infect for duck, goose and Carnis Coturnicis japonicae etc., and British scientist in 1956 proves that influenza A virus can infected duck first. In recent years, the phenomenon of duck influenza virus infection constantly occurs in China's part province, the serious sound development hindering duck culturing industry.
Duck pestilence (Duckplague, DP) is a kind of acute septic infectious disease of duck, and Clinical symptoms is mainly body temperature and raises, dysentery, and two that leg turning weak is unable, and site morbidity duck shows as incidence enlargement. This disease is propagated rapidly, and sickness rate is high, after duck group's infected duck Pestivirus, often causes high-volume dead. Duck pestilence is mainly through vaccine prevention, if there is morbidity, intramuscular injection that available polyinosini (is called for short PolyI:C, belong to A level interferon inducer), effect is notable.
Summary of the invention
For overcoming the shortcoming existed in above-mentioned prior art with not enough, the primary and foremost purpose of the present invention is in that to provide a kind of series connection duck ��, gamma interferon genes. Series connection duck �� of the present invention, gamma interferon genes are readily produced, and cost is low, and activity is high, has the duck IFN-�� of superposition, IFN-�� antiviral functions, influenza and duck pestilence are all had good therapeutic effect.
Another object of the present invention is to the preparation method that above-mentioned series connection duck ��, gamma interferon genes are provided.
Another object of the present invention is to provide the prokaryotic expression plasmid pET32a-IFN ��-linker-IFN �� of above-mentioned expression series connection duck ��, gamma interferon genes.
Another object of the present invention is to the preparation method that above-mentioned prokaryotic expression plasmid pET32a-IFN ��-linker-IFN �� is provided.
It is still another object of the present invention to provide the application of above-mentioned series connection duck ��, gamma interferon genes.
The purpose of the present invention is achieved through the following technical solutions: a kind of series connection duck ��, gamma interferon genes (IFN ��-linker-IFN ��), and its nucleotide sequence is as follows:
Ttctcctgcagccccctgcgcctccacgacagcgccttcgcctgggacagcctccagctcctccgcaacatggctcccagccccacacagccctgcccgcagcaacacgcgccttgctccttcccggacaccctcctggacaccaacgacacgcagcaagccgcacacaccgccctccacctcctccaacacctcttcgacaccctcagcagccccagcacccccgcgcactggctccacaccgcacgccacgacctcctcaaccagcttcagcaccacatccaccacctcgagcgctgcttcccagccgacgccgcgcgcctccacaggcgagggccccgcaaccttcacctcagcatcaacaagtacttcggctgcatccaacacttcctccagaaccacacctacagcccctgcgcatgggaccacgtccgcctcgaggctcacgcctgcttccagcgcatccaccgcctcacccgcaccatgcgcggtggaggaggctctggtggaggcggtagcggaggcggagggtcgatgacttgccagacctactgcttgtttgttctctctgtcatcatgatttattttggatgttctggaagtgctttatttctaggtcaacttcaaaatgacatagacaaactgaaagctgattttaatgcaagtaattcggatgtagctgatggcaatcctgtttttatagagaaagtgaaaaactggacagagagaaatgaaaaaaggatcatactgagccagattgttaccctgtacttggaaatgctaaagaaaactgacatgtcaaagccacacatcaaaaatttatctgagcagctcaatactctgagaaataccctttccaatgactacaagaagttcagagacctcgtggaactgtcaaaccttcagctgactggcttgaaaatccaacgcaaggctgtgagtgagctgttcagtgtcttacagaaactggtggagacttcgacttccaaaaggaaaaggagccagtctccaaagagatgcagatgttaa��
Described series connection duck ��, gamma interferon genes is application Overlap extension PCR (genesplicingbyoverlapextension, SOE-PCR) method, the duck �� of signal peptide will be removed, gamma interferon genes is connected by a hydrophobicity flexible amino acid linker (linker) (G4S) 3, then by the duck IFN ��-linker-IFN �� gene clone that connects to prokaryotic expression carrier pET32a (+) on, it is built into recombinant expression carrier pET32a-IFN ��-linker-IFN ��, expressed by BL21 system, after purification Identification, active with its influenza of vitro detection and duck pestilence in vivo respectively.
The preparation method of above-mentioned connect duck ��, gamma interferon genes, specifically includes following steps:
(1) design of primer and synthesis
According to the duck IFN-�� provided in Genbank and IFN-�� sequence, separately design 2 couples of primer I FN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1, for expanding duck IFN-�� gene (nucleotide sequence information is SEQIDNO:2 such as) after removing signal peptide and IFN-�� gene (nucleotide sequence information is SEQIDNO:3 such as), and add two restriction enzyme sites of BamHI and HindIII in IFN-�� upstream and IFN-�� downstream respectively; Meanwhile, design is for the primer I FN ��-R2 and IFN ��-F2 of SOE-PCR, wherein, containing part linker sequence in IFN ��-R2, containing the linker sequence complementary with IFN ��-R2 in IFN ��-F2;Primer sequence is as follows: the amplimer of IFN-�� after removal signal peptide:
IFN ��-F1:CGGGATCCTTCTCCTGCAGCCCCCTGCG;
IFN ��-R1:CCCAAGCTTTTAGCGCATGGTGCGGGTGA;
IFN ��-R2:
CTCCGCTACCGCCTCCACCAGAGCCTCCTCCACCGCGCATGGTGCGGGTG; The amplimer of IFN-�� after removal signal peptide:
IFN ��-F1:CGGGATCCTCTGGAAGTGCTTTATTTCT;
IFN ��-F2:
TCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGTCTGGAAGTGCTTTATTTCT;
IFN ��-R1:CCCAAGCTTTTAACATCTGCATCTCTTTGGA;
(2) amplification of duck ��, gamma interferon genes
Extracting RNA from duck peripheral blood lymphocyte, after reverse transcription, obtains the cDNA template of amplification duck ��, gamma interferon genes; With this cDNA for template, respectively with above-mentioned primer I FN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1, amplify required duck ��, IFN-�� genes of interest;
(3) SOE-PCR amplification series connection duck ��, gamma interferon genes (duck IFN ��-linker-IFN �� gene)
This process mainly comprises 3 PCR reactions, first PCR: go out the IFN-�� containing part linker sequence for primer amplification with IFN ��-F1 and IFN ��-R2, go out the IFN-�� containing part linker sequence with IFN ��-F2 and IFN ��-R1 for primer amplification, and carry out glue recovery respectively; Second PCR: the gene gone out with first pcr amplification, for template, is not added with primer, carries out 10-15 PCR reaction; 3rd PCR reaction, reacts the gene amplified for template with second PCR, amplifies fusion gene with primer I FN ��-F1 and IFN ��-R1, be i.e. series connection duck ��, gamma interferon genes (duck IFN ��-linker-IFN �� gene).
A kind of prokaryotic expression plasmid pET32a-IFN ��-linker-IFN �� expressing series connection duck ��, gamma interferon genes, by BamHI and HindIII restriction enzyme site will series connection duck ��, gamma interferon genes (duck IFN ��-linker-IFN �� gene) be connected to prokaryotic expression plasmid pET32a (+) on.
The preparation method of above-mentioned prokaryotic expression plasmid pET32a-IFN ��-linker-IFN ��, specifically comprises the following steps that
1) series connection duck ��, gamma interferon genes (duck IFN ��-linker-IFN �� gene) are cloned into pMD-19T carrier:
Series connection duck �� after pcr amplification purification, gamma interferon genes (duck IFN ��-linker-IFN �� gene) are connected into pMD-19T carrier, and 16 DEG C of connections overnight convert afterwards; Picking colony is inoculated in the LB culture medium of amicillin resistance and continues to cultivate, filter out positive colony by the method for bacterium solution PCR, and amplification culture after order-checking is correct obtains the positive plasmid pMD-19T-IFN ��-linker-IFN �� of this gene;
2) structure of recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��:
Respectively pMD-19T-IFN ��-linker-IFN �� and pET32a empty carrier is carried out double digestion with BamHI and HindIII restricted enzyme, glue reclaims the genetic fragment after obtaining enzyme action and carrier segments, application T4 ligase, purpose fragment is connected to pET32a (+) on carrier, construct recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��; By the above-mentioned Plastid transformation DH5 �� competence antibacterial built, after cultivation, picking colony is inoculated in the LB culture medium of amicillin resistance and cultivates, and application bacterium solution PCR method filters out positive colony, it is thus achieved that recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��.
Above-mentioned series connection duck ��, gamma interferon genes application, be embodied in above-mentioned series connection duck ��, gamma interferon genes express fusion protein preparation duck antiviral drugs in application.
The present invention has such advantages as relative to prior art and effect:
(1) present invention successfully constructs recombinant duck alpha, IFN-�� prokaryotic expression plasmid pET32a-IFN ��-linker-IFN ��, it is achieved that duck IFN-�� and IFN-�� gene expressing in series on escherichia coli prokaryotic expression system. Additionally, two genes are connected by flexible amino acid linker hydrophobic for (G4S) 3, it is possible not only to ensure that two interferon genes are expressed with the ratio of 1:1, it is also possible to make two kinds of duck interferon fully extend, correctly fold, to obtain maximum biologic activity.
(2) external interior resisting virus is it is demonstrated experimentally that the fusion protein constructed by the present invention has higher antiviral activity. In antiviral study in vitro, the restructuring duck IFN ��-linker-IFN anti-VSV of �� fusion protein after purification renaturation, AIV and DPV activity respectively 2.61 �� 107U/mg��1.12��107U/mg and 1.07 �� 107U/mg, hence it is evident that higher than the antiviral activity of single duck interferon; Experiment in vivo shows, the protective rate of AIV and DPV infected duck is significantly improved by the restructuring duck IFN ��-linker-IFN �� fusion protein after purification renaturation, and shedding virus and the internal organs toxic amount of infected duck are significantly reduced. Therefore, the invention provides a kind of cost high restructuring duck interferon fusion protein low, active, can effectively control the fast propagation of viral disease, reduce economic loss.
Accompanying drawing explanation
Fig. 1 is the duck IFN ��-linker-IFN �� gene electrophoresis testing result figure of SOE-PCR amplification; Wherein, swimming lane M:DL2000marker; Swimming lane 1:SOE-PCR expands duck IFN ��-linker-IFN �� result; Swimming lane 2: negative control.
Fig. 2 is the westernblot result figure detecting its expression; Wherein, swimming lane M: low molecular weight protein (LMWP) marker; Swimming lane 1:pET32a-IFN alpha expression product; Swimming lane 2:pET32a-IFN �� expression product; Swimming lane 3:pET32a-IFN ��/IFN �� expression product.
Fig. 3 is the SDS-PAGE result figure detecting its expression; Wherein, swimming lane M: low molecular weight protein (LMWP) marker; Swimming lane 1:pET32a empty carrier expresses precipitation; Swimming lane 2:pET32a empty carrier expresses supernatant; Swimming lane 3:pET32a-IFN alpha expression precipitates; Swimming lane 4:pET32a-IFN alpha expression supernatant; Swimming lane 5:pET32a-IFN �� expresses precipitation; Swimming lane 6:pET32a-IFN �� expresses supernatant; Swimming lane 7:pET32a-IFN ��/IFN �� expresses precipitation; Swimming lane 8:pET32a-IFN ��/IFN �� expresses supernatant.
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited to this.
Embodiment 1 expressing in series duck ��, gamma interferon genes the structure of prokaryotic expression plasmid
1. the design of primer and synthesis
Gene order (GenBankno.KF746069) according to the gene order (GenBankno.KJ874343) of duck IFN-�� provided in Genbank and IFN-��, separately design 2 couples of primer I FN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1, for expanding the duck IFN-�� after removing signal peptide and IFN-�� gene, and add BamHI and HindIII restriction enzyme site at the upstream and downstream of 2 pairs of primers respectively. Meanwhile, design is for the primer I FN ��-R2 and IFN ��-F2 of SOE-PCR, wherein, containing part linker sequence in IFN ��-R2, containing the linker sequence that part is complementary with IFN ��-R2 in IFN ��-F2.Primer sequence is as follows:
The amplimer of IFN-�� after removal signal peptide:
IFN ��-F1:CGGGATCCTTCTCCTGCAGCCCCCTGCG;
IFN ��-R1:CCCAAGCTTTTAGCGCATGGTGCGGGTGA;
IFN ��-R2:
CTCCGCTACCGCCTCCACCAGAGCCTCCTCCACCGCGCATGGTGCGGGTG; The amplimer of IFN-�� after removal signal peptide:
IFN ��-F1:CGGGATCCTCTGGAAGTGCTTTATTTCT;
IFN ��-F2:
TCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGTCTGGAAGTGCTTTATTTCT;
IFN ��-R1:CCCAAGCTTTTAACATCTGCATCTCTTTGGA.
2. the amplification of duck ��, gamma interferon genes
Extracting RNA from duck peripheral blood lymphocyte, after reverse transcription, obtain the cDNA template of amplification duck ��, gamma interferon genes, with this cDNA for template, respectively with above-mentioned IFN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1 primer, amplify required duck ��, IFN-�� genes of interest, PCR reaction system is 50 �� L, wherein ExTaq enzyme 1 �� L, 4 �� dNTPmix4 �� L, ddH2041.5 �� L, each 1 �� L, the cDNA1.5 �� L of upstream and downstream primer. Response parameter is: 94 DEG C of 4min of denaturation, then carries out 35 circulations, and circular response condition is 94 DEG C of 30s, 55 DEG C of 35s, 72 DEG C of 2min, and last 72 DEG C extend 10min. PCR primer carries out 1.0% agarose gel electrophoresis observation, it is seen that the amplified band of about 492kb and 435kb, size is consistent with expected result.
3.SOE-PCR expands duck IFN ��-linker-IFN �� gene
This process mainly comprises 3 PCR reactions, first PCR: go out the IFN-�� containing part linker sequence for primer amplification with IFN ��-F1 and IFN ��-R2, goes out the IFN-�� containing part linker sequence with IFN ��-F2 and IFN ��-R1 for primer amplification and carries out glue recovery (reaction system and method are as above described in 1.2) respectively; Second PCR: the gene gone out with first pcr amplification, for template, is not added with primer, carries out 10-15 PCR reaction, and other reaction condition is constant; 3rd PCR reaction, with second PCR primer for template, amplifies fusion gene IFN ��-linker-IFN �� with primer I FN ��-F1 and IFN ��-R1, and reaction system and method are ibid. PCR primer carries out 1.0% agarose gel electrophoresis observation, and result is as shown in Figure 1, it is seen that the amplified band of about 1029kb, size is consistent with expected results.
4. duck IFN ��-linker-IFN �� gene clone is to pMD-19TVector
Duck IFN ��-linker-IFN �� gene Omega company glue amplification obtained reclaims test kit and reclaims, then the genes of interest of recovery is connected on pMD-19T carrier, coupled reaction system is: LigationSolution I 5 �� L, pMD-19TVector0.5 �� L, PCR purified product 4.5 �� L, 16 DEG C connect overnight, product will be connected convert to DH5a competence antibacterial, it is inoculated on the LB flat board of amicillin resistance, 37 DEG C of incubated overnight. Choosing colony continues to cultivate 6h in the LB culture fluid of amicillin resistance, filters out positive colony by bacterium solution PCR method. Bacterium solution PCR reaction system is rTaq10 �� L, ddH2O8.4 �� L, upstream and downstream primer each 0.2 �� L, bacterium solution 1.2 �� L. Response parameter is: 94 DEG C of 4min of denaturation, then carries out 35 circulations, and circular response condition is 94 DEG C of 30s, 55 DEG C of 35s, 72 DEG C of 2min, and last 72 DEG C extend 10min.PCR primer carries out 1.0% agarose gel electrophoresis observation, and the order-checking of selected part positive is identified, by bacterium solution amplification culture correct for sequencing result, obtains positive plasmid pMD-19T-IFN ��-linker-IFN ��.
5. the structure of recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��.
With BamHI and HindIII restricted enzyme double digestion fusion gene IFN ��-linker-IFN �� and pET32a empty carrier respectively, glue reclaims the genetic fragment after obtaining enzyme action and carrier segments, application T4 ligase is attached reaction, wherein, T4DNA ligase 1 �� L, 10xT4DNALigasebuffer1 �� L, the purpose fragment after enzyme action adds than the ratio for 3:1 with mol with carrier, and reaction cumulative volume is 10 �� L. Converting to DH5 �� competence antibacterial after 16 DEG C of connection 4h, after cultivation, picking colony is cultivated in the LB culture medium of amicillin resistance, and application bacterium solution PCR method filters out positive colony, it is thus achieved that recombined pronucleus expression plasmid. PET32a-IFN �� and pET32a-IFN �� recombinant expression plasmid is constructed respectively by same method.
The qualification of embodiment 2 expression product, purification
By recombined pronucleus expression Plastid transformation BL21 competence antibacterial, after picking positive bacterium colony amplification culture, expression with IPTG induced protein, protein expression situation is identified respectively by SDS-PAGE and westernblot method, the testing result of westernblot as in figure 2 it is shown, the testing result of SDS-PAGE as shown in Figure 3. collect each bacterial sediment expressing bacterium, add PBS concussion mixing, after ultrasonic degradation, separation of supernatant and precipitation, with the phosphate solution dissolution precipitation containing 8mol/L carbamide, lysate is crossed after Ni column packing is in conjunction with 1h post, collect filtrate, repeated post 2 times, pillar is washed with the phosphate solution containing 30mmol/L imidazoles, stop when being 0 to eluent protein concentration, afterwards with the phosphate solution eluted protein containing 250mmol/L imidazoles, eluent is put into renaturation in bag filter, successively with containing 6, 4, 2, the PBS solution of 0mol/L urea concentration gradients is dialysed, and detect protein purification situation with SDS-PAGE.
Embodiment 3 expression product antiviral activity detects
Anti-viral activity in vitro detects: on DEF, according to animal interferon Anti-viral activity in vitro detection method, the detection fusion albumen rDuIFN �� anti-VSV of-linker-rDuIFN ��, AIV and DPV activity respectively, with rDuIFN-�� and rDuIFN-�� for matched group, result shows: the anti-VSV of fusion protein, AIV and DPV activity respectively 2.61 �� 107U/mg��1.12��107U/mg and 9.07 �� 106U/mg, hence it is evident that higher than the antiviral activity of single duck interferon; Interior resisting virus Activity determination: on Beijing duck, respectively anti-AIV and the DPV activity of detection fusion albumen rDuIFN ��-linker-rDuIFN ��, and with rDuIFN-�� and rDuIFN-�� for matched group. This experiment carries out at twice, experiment 1: filter out 1 age in days Beijing duck of bird flu (H5N1) negative antibody, it is randomly divided into 5 groups, often group 10, carries out intramuscular injection with rDuIFN ��-linker-rDuIFN �� albumen, rDuIFN-�� albumen, rDuIFN-�� albumen and PBS respectively, and injection dosage is 40ug/ time/, inject first during 2 age in days, carrying out second time injection after the 4h of interval, rear every day injects once, stops injection during to 6 age in days. After second time interferon is injected, 2h attacks bird flu virus. In experimentation, observe every day such as duck feed intake, the mental status etc., record mortality rate, within 1,3,5,7,9 days after counteracting toxic substances, gather larynx and cloacal swab, detect its shedding virus;Experiment 2: filter out the 1 age in days Beijing duck that Antibody To Duck Plague Virus is negative, it is randomly divided into 5 groups, often group 10, intramuscular injection is carried out respectively with rDuIFN ��-linker-rDuIFN �� albumen, rDuIFN-�� albumen, rDuIFN-�� albumen and PBS, method is with experiment 1, after second time interferon is injected, 2h attacks duck plague virus, and rear every day observes the duck mental status, feed intake and feces etc., and records its mortality rate. Test 1 result to show: the protective rate of influenza infected duck can be reached 100% by fusion protein rDuIFN ��-linker-rDuIFN ��, and the protective rate of single rDuIFN-�� and rDuIFN-�� respectively 90% and 70%, counteracting toxic substances group survival rate is 40%, and fused interferon treatment group disease duck shedding virus is lower than single interferon therapy group; In experiment 2, the protective rate of duck pestilence infected duck is 90% by fusion protein, and the protective rate of single rDuIFN �� and rDuIFN �� is 70%, and counteracting toxic substances group survival rate is 30%. Based on the above results it can be seen that compared with single rDuIFN-�� and rDuIFN-��, fusion protein rDuIFN ��-linker-rDuIFN �� has higher antiviral activity, can provide better protected effect to viral infection duck.
Above-described embodiment is the present invention preferably embodiment; but embodiments of the present invention are also not restricted to the described embodiments; the change made under other any spirit without departing from the present invention and principle, modification, replacement, combination, simplification; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Claims (5)
1. a series connection duck ��, gamma interferon genes, it is characterised in that: its nucleotide sequence is such as shown in SEQIDNO:1.
2. the preparation method of connect duck ��, the gamma interferon genes described in claim 1, it is characterised in that: specifically include following steps:
(1) design of primer and synthesis
According to the duck IFN-�� provided in Genbank and IFN-�� sequence, separately design 2 couples of primer I FN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1, for expanding the duck IFN-�� gene after removing signal peptide and IFN-�� gene, and add two restriction enzyme sites of BamHI and HindIII in IFN-�� upstream and IFN-�� downstream respectively; Meanwhile, design is for the primer I FN ��-R2 and IFN ��-F2 of SOE-PCR, wherein, containing part linker sequence in IFN ��-R2, containing the linker sequence complementary with IFN ��-R2 in IFN ��-F2; Primer sequence is as follows: the amplimer of IFN �� after removal signal peptide:
The sequence of IFN ��-F1 is such as shown in SEQIDNO:4;
The sequence of IFN ��-R1 is such as shown in SEQIDNO:5;
The sequence of IFN ��-R2 is such as shown in SEQIDNO:6;
The amplimer of IFN �� after removal signal peptide:
The sequence of IFN ��-F1 is such as shown in SEQIDNO:7;
The sequence of IFN ��-F2 is such as shown in SEQIDNO:8;
The sequence of IFN ��-R1 is such as shown in SEQIDNO:9;
(2) amplification of duck ��, gamma interferon genes
Extracting RNA from duck peripheral blood lymphocyte, after reverse transcription, obtains the cDNA template of amplification duck ��, gamma interferon genes; With this cDNA for template, respectively with above-mentioned primer I FN ��-F1, IFN ��-R1 and IFN ��-F1, IFN ��-R1, amplify required duck ��, IFN-�� genes of interest;
(3) SOE-PCR amplification series connection duck ��, gamma interferon genes
This process mainly comprises 3 PCR reactions, first PCR: go out the IFN-�� containing part linker sequence for primer amplification with IFN ��-F1 and IFN ��-R2, go out the IFN-�� containing part linker sequence with IFN ��-F2 and IFN ��-R1 for primer amplification, and carry out glue recovery respectively;Second PCR: the gene gone out with first pcr amplification, for template, is not added with primer, carries out 10-15 PCR reaction; 3rd PCR reaction, reacts the gene amplified for template with second PCR, amplifies fusion gene series connection duck ��, gamma interferon genes with primer I FN ��-F1 and IFN ��-R1.
3. the prokaryotic expression plasmid pET32a-IFN ��-linker-IFN �� expressing series connection duck ��, gamma interferon genes, it is characterised in that: by BamHI and HindIII restriction enzyme site the series connection duck �� described in claim 1, gamma interferon genes be connected to prokaryotic expression plasmid pET32a (+) on.
4. the preparation method of the prokaryotic expression plasmid pET32a-IFN ��-linker-IFN �� described in claim 3, it is characterised in that: specifically comprise the following steps that
1) duck series connection duck ��, gamma interferon genes are cloned into pMD-19T carrier:
Duck series connection duck �� described in claim 1, gamma interferon genes are connected into pMD-19T carrier, and 16 DEG C of connections overnight convert afterwards; Picking colony is inoculated in the LB culture medium of amicillin resistance and continues to cultivate, filter out positive colony by the method for bacterium solution PCR, and amplification culture after order-checking is correct obtains the positive plasmid pMD-19T-IFN ��-linker-IFN �� of this gene;
2) structure of recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��:
Respectively pMD-19T-IFN ��-linker-IFN �� and pET32a empty carrier is carried out double digestion with BamHI and HindIII restricted enzyme, glue reclaims the genetic fragment after obtaining enzyme action and carrier segments, application T4 ligase, purpose fragment is connected to pET32a (+) on carrier, construct recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��; By the above-mentioned Plastid transformation DH5 �� competence antibacterial built, after cultivation, picking colony is inoculated in the LB culture medium of amicillin resistance and cultivates, and application bacterium solution PCR method filters out positive colony, it is thus achieved that recombined pronucleus expression plasmid pET32a-IFN ��-linker-IFN ��.
5. the application of connect duck ��, the gamma interferon genes described in claim 1, it is characterised in that: the fusion protein that the series connection duck �� described in claim 1, gamma interferon genes are expressed application in the antiviral drugs of preparation duck.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610133500.1A CN105647945A (en) | 2016-03-09 | 2016-03-09 | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610133500.1A CN105647945A (en) | 2016-03-09 | 2016-03-09 | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105647945A true CN105647945A (en) | 2016-06-08 |
Family
ID=56492459
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610133500.1A Pending CN105647945A (en) | 2016-03-09 | 2016-03-09 | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105647945A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106674354A (en) * | 2017-02-14 | 2017-05-17 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| CN106892976A (en) * | 2017-02-14 | 2017-06-27 | 华南农业大学 | A kind of recombination chicken interferon lambda（rChIFN‑λ）Clonal expression of gene and its preparation method and application |
| CN108486127A (en) * | 2018-01-12 | 2018-09-04 | 中国农业科学院北京畜牧兽医研究所 | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof |
| CN109517779A (en) * | 2019-01-28 | 2019-03-26 | 大连三仪动物药品有限公司 | The building and its application of one plant weight group duck interferon-' alpha ' lactobacillus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0658627B1 (en) * | 1993-12-15 | 2003-03-26 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Recombinant DNA with interferon-alpha promoter |
| CN1408436A (en) * | 2001-09-30 | 2003-04-09 | 扬州大学 | Recombinant Borrel virus combined vaccine |
| CN1821397A (en) * | 2005-12-22 | 2006-08-23 | 东北农业大学 | Method for preparing recombinant goose interferon I and II |
| CN102212539A (en) * | 2011-04-08 | 2011-10-12 | 山东省农业科学院畜牧兽医研究所 | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof |
-
2016
- 2016-03-09 CN CN201610133500.1A patent/CN105647945A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0658627B1 (en) * | 1993-12-15 | 2003-03-26 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Recombinant DNA with interferon-alpha promoter |
| CN1408436A (en) * | 2001-09-30 | 2003-04-09 | 扬州大学 | Recombinant Borrel virus combined vaccine |
| CN1821397A (en) * | 2005-12-22 | 2006-08-23 | 东北农业大学 | Method for preparing recombinant goose interferon I and II |
| CN102212539A (en) * | 2011-04-08 | 2011-10-12 | 山东省农业科学院畜牧兽医研究所 | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof |
Non-Patent Citations (2)
| Title |
|---|
| 无: "KF746069.1", 《GENBANK》 * |
| 无: "KJ874343.1", 《GENBANK》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106674354A (en) * | 2017-02-14 | 2017-05-17 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| CN106892976A (en) * | 2017-02-14 | 2017-06-27 | 华南农业大学 | A kind of recombination chicken interferon lambda（rChIFN‑λ）Clonal expression of gene and its preparation method and application |
| CN106674354B (en) * | 2017-02-14 | 2020-10-16 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| CN108486127A (en) * | 2018-01-12 | 2018-09-04 | 中国农业科学院北京畜牧兽医研究所 | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof |
| CN109517779A (en) * | 2019-01-28 | 2019-03-26 | 大连三仪动物药品有限公司 | The building and its application of one plant weight group duck interferon-' alpha ' lactobacillus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102041263B (en) | Chicken alpha interferon/interleukin 2 chimeric gene | |
| CN105647945A (en) | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof | |
| CN106282216A (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN106139140B (en) | A kind of Muscovy duck parvovirus subunit vaccine | |
| CN103290021A (en) | A preparation method for recombinant chicken interferon alpha | |
| CN101818154A (en) | Gene segments for coding alpha, beta or gamma interferons of pigs and application thereof | |
| CN106674354A (en) | Fusion protein of chicken interferon IFN-lambda and IFN-alpha | |
| JP5132780B2 (en) | Fishery subunit vaccine | |
| CN105816871A (en) | Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof | |
| CN104356210A (en) | High-efficiency expression and application of VP28 protein fragment having binding activity with litopenaeus vannamei protein molecule Rab7 | |
| CN101570757A (en) | Porcine alpha interferon and interleukin 2 chimeric gene, construction method and protein purification method thereof | |
| CN108395470B (en) | Short peptide with dengue virus replication inhibition effect and application thereof | |
| CN113121672B (en) | Soluble prokaryotic expression and purification method of cat interferon gamma and application | |
| CN102406929A (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| CN103495182A (en) | Newcastle disease diad vaccine and preparation method thereof | |
| CN103933554B (en) | A kind of for preventing the interferon white oil compositions of Schweineseuche | |
| CN103014015B (en) | Gene segment for coding porcine interferon-gamma and application of gene segment | |
| CN101434958A (en) | Method for preparing porcine alpha-interferon | |
| CN114539426A (en) | Fusion protein containing interferon alpha, recombinant strain expressing fusion protein and preparation method thereof | |
| CN110101854B (en) | Carp herpesvirus III type vaccine and preparation method thereof | |
| König et al. | A novel protein expression strategy using recombinant bovine respiratory syncytial virus (BRSV): modifications of the peptide sequence between the two furin cleavage sites of the BRSV fusion protein yield secreted proteins, but affect processing and function of the BRSV fusion protein | |
| CN103173479B (en) | Mouse model capable of monitoring activity of IFN-beta (interferon-beta) or NF-kappa B (nuclear factor-kappa B) in liver via living imaging and construction method for same | |
| CN104531691A (en) | Primers for obtaining genes of bovine interferon alpha and preparation method for recombinant bovine interferon alpha | |
| CN106892976A (en) | A kind of recombination chicken interferon lambda（rChIFN‑λ）Clonal expression of gene and its preparation method and application | |
| CN103937828A (en) | Preparation method of fusion protein of porcine interferon-alpha 1 and thymosin-alpha 1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160608 |