CN102212539A - Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof - Google Patents
Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof Download PDFInfo
- Publication number
- CN102212539A CN102212539A CN 201110087551 CN201110087551A CN102212539A CN 102212539 A CN102212539 A CN 102212539A CN 201110087551 CN201110087551 CN 201110087551 CN 201110087551 A CN201110087551 A CN 201110087551A CN 102212539 A CN102212539 A CN 102212539A
- Authority
- CN
- China
- Prior art keywords
- pifn
- sequence
- gene
- pmvax1
- protein gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the field of gene expression, in particular to efficiently expressed series porcine alpha and gamma interferon genes. The nucleotide sequence of the interferon genes is shown as a sequence 2. The genes of the sequence 2 are cloned to eukaryotic expression vectors to obtain recombinant plasmids. A synthesis method of the series porcine alpha and gamma interferon genes comprises the following steps of: inserting Rabbit beta-GlobinIntronII, a pCMV immediate early promoter and a T7 promoter into pVAX1 to obtain pMVAX1, and inserting fusion protein genes pIFN-alpha/gamma into pMVAX1 to obtain pMVAX1-pIFN-alpha/gamma. The invention also relates to application of expression protein of the interferon genes in preparation of a medicament for treating porcine reproductive and respiratory syndrome. Through the interferon genes, the limitations of low expression quantity and poor activity when pIFN-alpha and pIFN-gamma are expressed through the pVAX1 are broken, the activity reaches 1*10<8.0>U/0.1mL, the multiplication of high pathogenic porcine reproductive and respiratory syndrome viruses (PRRSV) can be obviously inhibited, and the economic loss of a pig farm is reduced.
Description
Technical field
The present invention relates to the genetic expression of biological technical field, pig α, IFN-that particularly a kind of series connection high efficiency is expressed also relate to the purposes of the encoding gene and the expressing protein thereof of described Interferon, rabbit.
Background technology
Interferon, rabbit (IFN) is the cytokine that a class has broad-spectrum antiviral, antitumor, immunoregulation effect.IFN can be divided into two types (I type and II type), and IFN-α belongs to I type Interferon, rabbit, is the first line of defence of body cell opposing virus infection, has three big functions: antivirus action, antitumor action and immunoregulation effect.Nineteen nineties such as Lefevre at first cloned pig IFN-α (pIFN-α) gene and with its mature protein gene at expression in escherichia coli, have stronger antiviral activity.Chinese scholars has been expressed pIFN-α with intestinal bacteria, adenovirus, yeast etc. subsequently, and its biologic activity has been carried out big quantity research.This seminar also once was cloned into carrier for expression of eukaryon pVAX1 with pIFN-α
, the pIFN-alpha active of expressing behind the transfection HEK-293A cell is lower, only is 1 * 10
6.0U/0.1mL.
IFN-γ belongs to II type Interferon, rabbit, has antiviral, antitumor, immunoregulation effect.Yonger in 1973 and Slavin find from having a kind of and the different IFN of IFN antigenicity of discovery in the past, called after II type Interferon, rabbit in the lymphocyte culture supernatant.Foreign study shows that pig IFN-γ (pIFN-γ) can obviously suppress the propagation of porcine reproductive and respiratory syndrome virus (PRRSV), also has vital role in the cellular immunization of swine fever virus resistant.Domestic many scholars have expressed pIFN-γ with escherichia coli prokaryotic expression system, eucaryon plasmid expression system, adenovirus system, pichia spp etc., and its biologic activity has been carried out big quantity research.This seminar also once was cloned into carrier for expression of eukaryon pVAX1 with pIFN-γ
, the pIFN-gamma activity of expressing behind the transfection HEK-293A cell is lower, only is 1 * 10
5.0U/0.1mL.
Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS), be commonly called as " pig blue-ear disease ", by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV) cause, the sow miscarriage be can cause behind the virus infection, return feelings, stillborn foetus or weak son, piglet death and the pig respiratory symptom in various degree at various ages produced, and can destroy the immunity system of pig, cause polyinfection or secondary infection.This disease is broken out in China at the bottom of nineteen ninety-five, and rapid spread is to national a plurality of provinces.At many large-scale pig farms, the PRRS positive rate is very high, and what have reaches more than 80%.Since two thousand six, the high-pathogenicity blue ear disease that caused by the PRRSV variant has taken place in pig farm, China some areas.This disease is a principal character with the high heat of morbidity pig, expiratory dyspnea, skin rubefaction clinically, has higher M ﹠ M, has caused very serious economy loss for the pig industry of China.
Summary of the invention
In order to overcome the above problems, the invention provides a kind of can efficiently express, series connection pig α, IFN-gene of virus diseases such as high-pathogenicity blue ear disease being had fine prevention effect.
The present invention also provides described series connection pig α, IFN-gene to be cloned into the recombinant plasmid that carrier for expression of eukaryon obtains by Protocols in Molecular Biology.
The present invention also provides the preparation method of described series connection pig α, IFN-gene.
The present invention also provides described series connection pig α, the proteic purposes of IFN-expression of gene.
The present invention is achieved by the following measures:
A kind of series connection pig α, IFN-gene that efficiently expresses, its nucleotide sequence is shown in sequence in the sequence table 2.
A kind of gene of described sequence 2 is cloned into the recombinant plasmid that carrier for expression of eukaryon obtains by Protocols in Molecular Biology.
The synthetic method of a kind of described series connection pig α, IFN-gene may further comprise the steps
1, with eucaryon plasmid pVAX1
Transform pMVAX1 as
:
Rabbit β-Globin Intron II gene order GenBank No:V00882 by GenBank announces introduces in the upstream
SstI restriction enzyme site and pCMV be one section sequence of early promoter at once, introduce in the downstream T7 promoter sequence and
EcoRI restriction enzyme site, the nucleotide sequence behind the synthetic pass through this fragment gene sequence shown in sequence in the sequence table 1
SstI/
EcoThe RI restriction enzyme site inserts pVAX1
In the carrier, the transformed competence colibacillus bacterium is extracted plasmid and obtains through screening
SstI/
EcoRI double digestion positive colony, called after pMVAX1
Described pCMV one section sequence of early promoter at once is: 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',
Described T7 promoter sequence is: 5 '-AATACGACTCACTATAGGG-3 ';
2, the reorganization eucaryon plasmid pMVAX1 of construction expression pIFN-α/γ
-pIFN-α/γ:
2.1 primer design and synthetic:
Design the Auele Specific Primer of the gene order of a pair of amplification pIFN-α maturation protein and a pair of amplification pIFN-γ maturation protein respectively, primer sequence is as follows:
pIFN-α-Fwd：5’-TATGAATTCGGTACCACCATGGGCTGCGACCTGCCTCAGA-3’
pIFN-α-Rev：5’-CTGGCAGTAAGAGCCACCGCCACCGCCACCCTCCTTCTTCCTGAGT-3’
pIFN-γ-Fwd：
5’-ACTCAGGAAGAAGGAGGGTGGCGGTGGCGGTGGCTCTTACTGCCAG-3’
pIFN-γ-Rev：5’-GAGCTCGAGAAGCTTATTATTTTGATGCTCTCTG-3’；
2.2 from the spleen of pig or peripheral blood lymphocyte, extract RNA, after reverse transcription, obtain the mature protein gene of pIFN-α and pIFN-γ, mature protein gene with described pIFN-α and pIFN-γ is a template respectively, in two pipes, carry out pcr amplification with corresponding primer, amplify the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively;
2.3 the amplification of pIFN-α/γ antigen-4 fusion protein gene:
With the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively glue reclaim template as next step PCR reaction, generate pIFN-α/γ antigen-4 fusion protein gene in the PCR process, with primer pIFN-α-Fwd and pIFN-γ-Rev amplification pIFN-α/γ antigen-4 fusion protein gene, product carries out 1% agarose gel electrophoresis, gets the amplified production of pIFN-α/γ antigen-4 fusion protein gene;
2.4 eukaryotic expression recombinant plasmid pMVAX1
The structure of-pIFN-α/γ:
With
EcoRI and
XhoThe amplified production of I restriction enzymes double zyme cutting pIFN-α/γ antigen-4 fusion protein gene, glue reclaim the antigen-4 fusion protein gene fragment 1 of the pIFN-α/γ maturation protein that obtains encoding, and use
EcoRI and
XhoI restriction enzymes double zyme cutting plasmid pMVAX1
, glue reclaims the vector gene fragment 2 that obtains comprising sequence 1, and antigen-4 fusion protein gene fragment 1 is connected with vector gene fragment 2, and the transformed competence colibacillus bacterium is cultivated, and picking colony is cultivated in the substratum of kalamycin resistance, extracts plasmid, carries out
EcoRI/
XhoThe I double digestion is identified, filters out positive colony, gets eukaryotic expression recombinant plasmid pMVAX1
-pIFN-α/γ, eucaryon plasmid pVAX1
The middle gene nucleotide series that inserts is shown in sequence in the sequence table 2.
The PCR reaction system is among the 25 μ L in the step 2.2, contains cDNA 1 μ L, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pIFN-α-Fwd and each 400nmol/L of pIFN-α-Rev or pIFN-γ-Fwd and each 400nmol/L of pIFN-γ-Rev, TaKaRa LA Taq 2U; Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis.
The PCR reaction system is among the 25 μ L in the step 2.3, contains each 1 μ L of amplified production of the mature protein gene of pIFN-α and pIFN-γ, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pIFN-α-Fwd and pIFN-γ-Rev concentration are 400nmol/L, TaKaRa LA Taq 2U; Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis.
The extraction step of pig RNA is spleen or the peripheral blood of aseptic collection pig in the step 2.2, separates spleen or blood lymphocytes with lymphocyte separation medium, contains CO with 1640 liquid of 10% foetal calf serum at 37 ℃
2Cultivate 1h in the incubator of 5v%, after the PHA-P HA that adds 500 μ g/mL then stimulates 12h, extract total RNA with TRIzol reagent.
The described series connection pig α that efficiently expresses, the application of IFN-expression of gene albumen in the medicine of preparation treatment porcine reproductive and respiratory syndrome.
The invention has the beneficial effects as follows:
(1) with transformed eucaryon plasmid pVAX1
Be pMVAX1
Express pIFN-α/γ fused in tandem albumen, broken through and passed through pVAX1
Lower and the active relatively poor limitation of the expression amount that runs in vector expression pIFN-α, the pIFN-γ process;
(2) extracorporeal antivirus effect evidence, pIFN-α/γ expression activity that the present invention makes up is very high, transfection 1 μ g pMVAX1
The lysate of-pIFN-α/γ to HEK-293A cell detects the activity unit of IFN up to 1 * 10 with VSV
8.0U/0.1mL when activity can obviously suppress the propagation of highly pathogenic PRRSV on the Marc-145 cell when 100U is above, is exclusively used in the prophylactic treatment of virus diseases such as highly pathogenic PRRSV and the financial loss on minimizing pig farm.
Description of drawings
Fig. 1 transforms eucaryon plasmid pVAX1 for the present invention
Be pMVAX1
And clone pIFN-α/γ antigen-4 fusion protein gene is gone into pMVAX1
Synoptic diagram,
Fig. 2 is recombinant plasmid pMVAX1 of the present invention
SstI
/ EcoThe RI double digestion is identified collection of illustrative plates, wherein
M is DL2,000 DNA Marker,
1 is reorganization positive plasmid pMVAX1
SstI
/ EcoRI double digestion result,
Fig. 3 is recombinant plasmid pMVAX1 of the present invention
-pIFN-α/γ's
EcoRI/
XhoThe I double digestion is identified collection of illustrative plates, wherein
M is DL2,000 DNA Marker,
1 and 2 is two different reorganization positive plasmid pMVAX1
-pIFN-α/γ's
EcoRI/
XhoI double digestion result.
Embodiment
. with eucaryon plasmid pVAX1
Transform pMVAX1 as
1.1 insert the synthetic of gene
By Rabbit β-Globin Intron II gene order (GenBank No:V00882) that GenBank announces, introduce in the upstream
SstI restriction enzyme site and pCMV be one section sequence of early promoter at once, introduce in the downstream T7 promoter sequence and
EcoRI restriction enzyme site, described pCMV one section sequence of early promoter at once are 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',
Described T7 promoter sequence is 5 '-AATACGACTCACTATAGGG-3 ';
This fragment gene sequence assembly is transferred to TaKaRa company synthetic together, and the nucleotide sequence behind the synthetic and is gone into the T carrier with this fragment gene sequence clone shown in sequence in the sequence table 1.
1.2 pMVAX1
Structure and evaluation
From the T carrier
SstI/
EcoRI double digestion goal gene and glue reclaim, with same process
SstI/
EcoThe eucaryon plasmid pVAX1 of RI double digestion
And the carrier segments that glue reclaims transforms DH5 α competence bacterium, 37 ℃ of incubated overnight 16h 16 ℃ of connections of spending the night.Picking colony 37 ℃ of overnight shakings in the LB of kalamycin resistance substratum are cultivated, and extract plasmid, and carry out in second day
SstI/
EcoThe RI double digestion is identified.Be accredited as male plasmid called after pMVAX1
, transfer to the order-checking of TaKaRa company, pVAX1
Middle gene order and the sequence of inserting in the sequence table 1 matches.
.pIFN-pMVAX1 is gone in the gene clone of α/γ fusion rotein
2.1 primer design and synthetic
The gene order (GenBank no. X57191) of the pIFN-α that announces according to GenBank and the gene order (GenBank no. DQ839398) of pIFN-γ design Auele Specific Primer pIFN-α-Fwd, pIFN-α-Rev and pIFN-γ-Fwd, the pIFN-γ-Rev of the gene order of a pair of increase pIFN-α maturation protein and a pair of amplification pIFN-γ maturation protein respectively.5 ' end at primer pIFN-α-Fwd is introduced
EcoRI restriction enzyme site and Kozak sequence; The design of primer pIFN-α-Rev and pIFN-γ-Fwd is introduced 5 glycine (Gly) sequence as linker according to the principle of design of SOE-PCR and between the gene order of pIFN-α and pIFN-γ; 5 ' end at primer pIFN-γ-Rev is introduced
XhoThe I restriction enzyme site, primer sequence is as follows:
pIFN-α-Fwd: 5’-TATGAATTCGGTACCACCATGGGCTGCGACCTGCCTCAGA-3’
pIFN-α-Rev: 5’-CTGGCAGTAAGAGCCACCGCCACCGCCACCCTCCTTCTTCCTGAGT-3’
pIFN-γ-Fwd:5’-ACTCAGGAAGAAGGAGGGTGGCGGTGGCGGTGGCTCTTACTGCCAG-3’
pIFN-γ-Rev: 5’-GAGCTCGAGAAGCTTATTATTTTGATGCTCTCTG-3’
Two pairs of primers estimate that respectively across pIFN-α and pIFN-γ mature protein coding region expanding fragment length is respectively about 550bp and 490bp, and primer is synthetic by TaKaRa company.
2.2 the separation and Culture of pig splenic lymphocyte, induce and the extraction of total RNA
Spleen of aseptic collection yorker or peripheral blood separate splenic lymphocyte or peripheral blood lymphocyte with lymphocyte separation medium, with 1640 liquid of the 10% foetal calf serum CO at 37 ℃ of 5v%
2Cultivate 1h.After adding the PHA-P HA stimulation 12h of 500 μ g/mL then, extract total RNA with TRIzol reagent, as the template of RT-PCR.
2.3 RT-PCR amplification
RNA obtains the mature protein gene of pIFN-α and pIFN-γ after Oligo d (T) reverse transcription, mature protein gene with pIFN-α and pIFN-γ is a template, in two pipes, carry out pcr amplification with pIFN-α-Fwd/pIFN-α-Rev and pIFN-γ-two pairs of primers of Fwd/pIFN-γ-Rev respectively, the PCR reaction system is among the 25 μ L, contain cDNA 1 μ L, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pIFN-α-Fwd and each 400nmol/L of pIFN-α-Rev or pIFN-γ-Fwd and each 400nmol/L of pIFN-γ-Rev, TaKaRa LA Taq 2U.Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis.Adopt the RT-PCR technology to amplify the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively like this.
2.4 the amplification of pIFN-α/γ antigen-4 fusion protein gene
With the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively glue reclaim template as next step PCR reaction, generate pIFN-α/γ antigen-4 fusion protein gene in the PCR process, with the gene of primer pIFN-α-Fwd and pIFN-γ-Rev amplification pIFN-α/γ fusion rotein.The PCR reaction system is 25 μ L, contains each 1 μ L of maturation protein cDNA template of pIFN-α and pIFN-γ, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, the concentration of pIFN-α-Fwd and pIFN-γ-Rev is 400nmol/L, TaKaRa LA Taq 2U.Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis, and glue reclaims the PCR product that obtains pIFN-α/γ antigen-4 fusion protein gene.
2.5 the structure of eukaryotic expression recombinant plasmid and evaluation
With
EcoRI and
XhoThe amplified production of I restriction enzymes double zyme cutting pIFN-α/γ antigen-4 fusion protein gene, glue reclaim the antigen-4 fusion protein gene fragment 1 of the pIFN-α/γ maturation protein that obtains encoding, and use
EcoRI and
XhoI restriction enzymes double zyme cutting plasmid pMVAX1
, glue reclaims the vector gene fragment 2 that obtains comprising sequence 1, and antigen-4 fusion protein gene fragment 1 is spent the night at 16 ℃ with vector gene fragment 2 and is connected, and transforms DH5 α competence bacterium, 37 ℃ of incubated overnight 16h.Picking colony 37 ℃ of overnight shakings in the LB of kalamycin resistance substratum are cultivated, and extract plasmid, and carry out in second day
EcoRI/
XhoThe I double digestion is identified.Be accredited as male plasmid pMVAX1
-pIFN-α/γ transfers to the order-checking of TaKaRa company.The gene order and the derivation aminoacid sequence that are inserted with Vector NTI and DNAStar software analysis.Eucaryon plasmid pVAX1
The middle nucleotide sequence that inserts is shown in sequence in the sequence table 2, and the derivation aminoacid sequence is shown in sequence in the sequence table 3.
The antiviral activity of pIFN-α/γ fusion rotein that the reorganization eucaryon plasmid is expressed is measured
3.1 recombinant plasmid pMVAX1
-pIFN-α/γ transfection HEK-293A cell
Experimental group: Lipofectamine is pressed in concrete operations
TM2000(Invitrogen) specification sheets carries out.Transfection is carried out on 6 porocyte plates, in the day before yesterday of transfection, and digestion HEK-293A cell, the foetal calf serum DMEM(with 10% does not contain microbiotic) diluting cells, make its density reach 2.5 * 10
5Individual cell/mL, every hole inoculation 2.5mL on 6 porocyte plates is in the CO of 37 ℃ of 5v%
2Cultivate in the incubator.Elder generation adds the OPTI-MEM serum free medium of 37 ℃ of preheatings of 500 μ L in the centrifuge tube of the 1.5mL that sterilizes, adds the recombinant plasmid pMVAX1 of 1.0 μ g then
-pIFN-α/γ, mixing gently; In the centrifuge tube of the 1.5mL of another sterilization, add the OPTI-MEM serum free medium of 37 ℃ of preheatings of 500 μ L earlier, add 2.5 μ L Lipofectamine then
TM2000 transfection reagents, mixing is placed 5min in room temperature gently; Then with the liquid mixing in the centrifuge tube of two 1.5mL together, room temperature is placed 20min; From CO
2Take out cell plate in the incubator, supernatant discarded joins mixture on the cell face gently, immediately cell plate is put into CO then
2In the incubator; Behind the incubation 6h, sop up supernatant, add 10% foetal calf serum DMEM of 37 ℃ of preheatings of 2.0mL gently, put into CO
2Incubator continues to cultivate 24h, and multigelation cell transfecting thing is 2 times then, the centrifugal 5min of 12000rpm, and it is to be checked to get supernatant.
Control group 1: with the pMVAX1 of experimental group
-pIFN-α/γ replaces with empty carrier plasmid pMVAX1
, all the other methods are with the experimental group unanimity, in contrast.
Control group 2: with the pMVAX1 of experimental group
-pIFN-α/γ replaces with pVAX1
-pIFN-α, all the other methods are with the experimental group unanimity, in contrast.
Control group 3: with the pMVAX1 of experimental group
-pIFN-α/γ replaces with pVAX1
-pIFN-γ, all the other methods are with the experimental group unanimity, in contrast.
Described pVAX1
-pIFN-α and pVAX1
-pIFN-γ is eucaryon plasmid carrier pVAX1
In only insert pIFN-α or pIFN-γ gene, and do not insert Rabbit β-Globin Intron II gene.
3.2 recombinant plasmid pMVAX1
The anti-VSV of the fusion rotein that-pIFN-α/γ expresses is active to be detected
Add the freezing-thawing and cracking supernatant that multiple proportions that above-mentioned experimental group, control group 1, control group 2 and control group 3 obtain is kept the liquid dilution respectively to growing in Marc-145 cell monolayer on 96 orifice plates, 4 holes of each extent of dilution, in 37 ℃ of effect 24h, inhale and remove supernatant, every hole inoculation 100TCID
50VSV, contain CO in 37 ℃
2Cultivate in the incubator of 5v%.24-36h observes each porocyte pathology, is defined as 1 activity unit (1U) of IFN with the high dilution that can suppress 50% cytopathic sample.
After testing, the recombinant plasmid pMVAX1 of 1.0 μ g
In the cracking supernatant behind-pIFN-α/γ transfection HEK-293A cell, the activity unit of IFN is up to 1 * 10
8.0U/0.1mL; And control group 1 empty carrier plasmid pMVAX1
Cracking supernatant nonreactive VSV activity behind the transfection HEK-293A cell; Control group 2 vector plasmid pVAX1
In the cracking supernatant behind the-pIFN-α transfection HEK-293A cell, the activity unit of IFN has only 1 * 10
6.0U/0.1mL; Control group 3 vector plasmid pVAX1
In the cracking supernatant behind the-pIFN-γ transfection HEK-293A cell, the activity unit of IFN has only 1 * 10
5.0U/0.1mL therefore, recombinant plasmid pMVAX1
The IFN activity that-pIFN-α/γ expresses is compared pVAX1
-pIFN-α has improved 100 times, compares pVAX1
-pIFN-γ has improved 1000 times.
3.3 recombinant plasmid pMVAX1
The active detection of the anti-highly pathogenic PRRSV of the fusion rotein that-pIFN-α/γ expresses
Add the freezing-thawing and cracking supernatant that multiple proportions that above-mentioned experimental group, control group 1, control group 2 and control group 3 obtain is kept the liquid dilution respectively to growing in Marc-145 cell monolayer on 96 orifice plates, 4 holes of each extent of dilution, in 37 ℃ of effect 24h, inhale and remove supernatant, every hole inoculation 100TCID
50Highly pathogenic PRRSV, contain CO in 37 ℃
2Cultivate in the incubator of 5v%.After 3 days, observation of cell pathology situation, control group 1 empty carrier pMVAX1
Cell all produces tangible cytopathy; Control group 2 pVAX1
-pIFN-α is 1:10 at extent of dilution
4.0Below, control group 3 pVAX1
-pIFN-γ is 1:10 at extent of dilution
3.0Below, and pMVAX1
-pIFN-α/γ experimental group is 1:10 at extent of dilution
6.0(extent of dilution 1:10 when following
6.0Be 100U), all acellular pathology.Recombinant plasmid pMVAX1 of the present invention is described
The IFN that-pIFN-α/γ expresses has the effect of very strong anti-highly pathogenic PRRSV.The amount of pIFN-α is 100U(extent of dilution 1:10
6.0Be 100U) when above, to 100TCID
50Highly pathogenic PRRSV have the obvious suppression effect, can be applied to prepare in the medicine for the treatment of highly pathogenic PRRSV.
＜110〉Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricul
The purposes of series connection pig α, IFN-gene and the expressing protein thereof that＜120〉efficiently expresses
<160>3
<210>1
<211>818
<212>DNA
＜213〉synthetic
<220>
<221>intron
<222>（1）...（818）
<440>1
gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc 60
atagaagaca ccgggaccga tccagcctcc gcggccggga acggtgcatt ggaacggacc 120
cctaggcttt tgcaaaaagc tggatcgatc ctgagaactt cagggtgagt ttggggaccc 180
ttgattgttc tttctttttc gctattgtaa aattcatgtt atatggaggg ggcaaagttt 240
tcagggtgtt gtttagaatg ggaagatgtc ccttgtatca ccatggaccc tcatgataat 300
tttgtttctt tcactttcta ctctgttgac aaccattgtc tcctcttatt ttcttttcat 360
tttctgtaac tttttcgtta aactttagct tgcatttgta acgaattttt aaattcactt 420
ttgtttattt gtcagattgt aagtactttc tctaatcact tttttttcaa ggcaatcagg 480
gtatattata ttgtacttca gcacagtttt agagaacaat tgttataatt aaatgataag 540
gtagaatatt tctgcatata aattctggct ggcgtggaaa tattcttatt ggtagaaaca 600
actacatcct ggtcatcatc ctgcctttct ctttatggtt acaatgatat acactgtttg 660
agatgaggat aaaatactct gagtccaaac cgggcccctc tgctaaccat gttcatgcct 720
tcttcttttt cctacagctc ctgggcaacg tgctggttat tgtgctgtct catcattttg 780
gcaaagaatt gtaatacgac tcactatagg gcgaattc 818
<210>2
<211>1803
<212>DNA
＜213〉synthetic
<220>
<221>intron
<222>（1）...（818）
<220>
<221>mat_peptide
<222>（828）...（1787）
<440>2
gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc 60
atagaagaca ccgggaccga tccagcctcc gcggccggga acggtgcatt ggaacggacc 120
cctaggcttt tgcaaaaagc tggatcgatc ctgagaactt cagggtgagt ttggggaccc 180
ttgattgttc tttctttttc gctattgtaa aattcatgtt atatggaggg ggcaaagttt 240
tcagggtgtt gtttagaatg ggaagatgtc ccttgtatca ccatggaccc tcatgataat 300
tttgtttctt tcactttcta ctctgttgac aaccattgtc tcctcttatt ttcttttcat 360
tttctgtaac tttttcgtta aactttagct tgcatttgta acgaattttt aaattcactt 420
ttgtttattt gtcagattgt aagtactttc tctaatcact tttttttcaa ggcaatcagg 480
gtatattata ttgtacttca gcacagtttt agagaacaat tgttataatt aaatgataag 540
gtagaatatt tctgcatata aattctggct ggcgtggaaa tattcttatt ggtagaaaca 600
actacatcct ggtcatcatc ctgcctttct ctttatggtt acaatgatat acactgtttg 660
agatgaggat aaaatactct gagtccaaac cgggcccctc tgctaaccat gttcatgcct 720
tcttcttttt cctacagctc ctgggcaacg tgctggttat tgtgctgtct catcattttg 780
gcaaagaatt gtaatacgac tcactatagg gcgaattcgg taccaccatg ggctgcgacc 840
tgcctcagac ccacagcctg gctcacacca gggccctgag gctcctggca caaatgagga 900
gaatctcccc cttctcctgc ctggaccaca gaagggactt tgggttcccc caagaggcct 960
tggggggcaa ccaggtccag aaggctcaag ccatggctct ggtgcatgag atgctccagc 1020
agaccttcca gctcttcagc acagagggct cggctgctgc ctggaatgag agcctcctgc 1080
accagttctg cactggactg gatcagcagc tcagggacct ggaagcctgt gtcatgcagg 1140
aggtggggct ggaagggacg cccctgctgg aggaggactc catcctggct gtgaggaaat 1200
acttccacag actcaccctc tatctgcaag agaagagcta cagcccctgt gcctgggaga 1260
tcgtcagggc agaagtcatg agagccttct cttcctccac aaacctgcaa gacagactca 1320
ggaagaagga gggtggcggt ggcggtggct cttactgcca ggcgcccttt tttaaagaaa 1380
taacgatcct aaaggactat tttaatgcaa gtacctcaga tgtacctaat ggtggacctc 1440
ttttcttaga aattttgaag aattggaaag aggagagtga caaaaaaata attcagagcc 1500
aaattgtctc cttctacttc aaattctttg aaatcttcag agataaccag gccattcaaa 1560
ggagcatgga tgtgatcaag caagacatgt ttcagaggtt cctaaatggt agctctggga 1620
aactgaatga cttcgaaaag ctgattaaaa ttccggtaga taatctgcag atccagcgca 1680
aagccatcag tgaactcatc aaagtgatga atgatctgtc accaagatct aacctaagaa 1740
agcggaagag aagtcagact atgttccaag gccagagagc atcaaaataa taagcttctc 1800
gag 1803
<210>3
<211>320
<212>PRT
＜213〉synthetic
<440>3
Met Gly Cys Asp Leu Pro Gln Thr His Ser Leu Ala His Thr Arg
1 5 10 15
Ala Leu Arg Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser
20 25 30
Cys Leu Asp His Arg Arg Asp Phe Gly Phe Pro Gln Glu Ala Leu
35 40 45
Gly Gly Asn Gln Val Gln Lys Ala Gln Ala Met Ala Leu Val His
50 55 60
Glu Met Leu Gln Gln Thr Phe Gln Leu Phe Ser Thr Glu Gly Ser
65 70 75
Ala Ala Ala Trp Asn Glu Ser Leu Leu His Gln Phe Cys Thr Gly
80 85 90
Leu Asp Gln Gln Leu Arg Asp Leu Glu Ala Cys Val Met Gln Glu
95 100 105
Val Gly Leu Glu Gly Thr Pro Leu Leu Glu Glu Asp Ser Ile Leu
110 115 120
Ala Val Arg Lys Tyr Phe His Arg Leu Thr Leu Tyr Leu Gln Glu
125 130 135
Lys Ser Tyr Ser Pro Cys Ala Trp Glu Ile Val Arg Ala Glu Val
140 145 150
Met Arg Ala Phe Ser Ser Ser Thr Asn Leu Gln Asp Arg Leu Arg
155 160 165
Lys Lys Glu Gly Gly Gly Gly Gly Gly Ser Tyr Cys Gln Ala Pro
170 175 180
Phe Phe Lys Glu Ile Thr Ile Leu Lys Asp Tyr Phe Asn Ala Ser
185 190 195
Thr Ser Asp Val Pro Asn Gly Gly Pro Leu Phe Leu Glu Ile Leu
200 205 210
Lys Asn Trp Lys Glu Glu Ser Asp Lys Lys Ile Ile Gln Ser Gln
215 220 225
Ile Val Ser Phe Tyr Phe Lys Phe Phe Glu Ile Phe Arg Asp Asn
230 235 240
Gln Ala Ile Gln Arg Ser Met Asp Val Ile Lys Gln Asp Met Phe
245 250 255
Gln Arg Phe Leu Asn Gly Ser Ser Gly Lys Leu Asn Asp Phe Glu
260 265 270
Lys Leu Ile Lys Ile Pro Val Asp Asn Leu Gln Ile Gln Arg Lys
275 280 285
Ala Ile Ser Glu Leu Ile Lys Val Met Asn Asp Leu Ser Pro Arg
290 295 300
Ser Asn Leu Arg Lys Arg Lys Arg Ser Gln Thr Met Phe Gln Gly
305 310 315
Gln Arg Ala Ser Lys
320
Claims (7)
1. series connection pig α, IFN-gene that efficiently expresses, its nucleotide sequence is shown in sequence in the sequence table 2.
2. the gene of the described sequence 2 of claim 1 is cloned into the recombinant plasmid that carrier for expression of eukaryon obtains by Protocols in Molecular Biology.
3. the synthetic method of a claim 1 described connect pig α, IFN-gene is characterized in that may further comprise the steps
3.1 with eucaryon plasmid pVAX1
Transform pMVAX1 as
:
Rabbit β-Globin Intron II gene order GenBank No:V00882 by GenBank announces introduces in the upstream
SstI restriction enzyme site and pCMV be one section sequence of early promoter at once, introduce in the downstream T7 promoter sequence and
EcoRI restriction enzyme site, the nucleotide sequence behind the synthetic pass through this fragment gene sequence shown in sequence in the sequence table 1
SstI/
EcoThe RI restriction enzyme site inserts pVAX1
In the carrier, the transformed competence colibacillus bacterium is extracted plasmid and obtains through screening
SstI/
EcoRI double digestion positive colony, called after pMVAX1
Described pCMV one section sequence of early promoter at once is: 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',
Described T7 promoter sequence is: 5 '-AATACGACTCACTATAGGG-3 ';
3.2 the reorganization eucaryon plasmid pMVAX1 of construction expression pIFN-α/γ
-pIFN-α/γ:
3.2.1 primer design and synthetic:
Design the Auele Specific Primer of the gene order of a pair of amplification pIFN-α maturation protein and a pair of amplification pIFN-γ maturation protein respectively, primer sequence is as follows:
pIFN-α-Fwd：5’-TATGAATTCGGTACCACCATGGGCTGCGACCTGCCTCAGA-3’
pIFN-α-Rev：5’-CTGGCAGTAAGAGCCACCGCCACCGCCACCCTCCTTCTTCCTGAGT-3’
pIFN-γ-Fwd：
5’-ACTCAGGAAGAAGGAGGGTGGCGGTGGCGGTGGCTCTTACTGCCAG-3’
pIFN-γ-Rev：5’-GAGCTCGAGAAGCTTATTATTTTGATGCTCTCTG-3’；
3.2.2 from the spleen of pig or peripheral blood lymphocyte, extract RNA, after reverse transcription, obtain the mature protein gene of pIFN-α and pIFN-γ, mature protein gene with described pIFN-α and pIFN-γ is a template respectively, in two pipes, carry out pcr amplification with corresponding primer, amplify the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively;
3.2.3 the amplification of pIFN-α/γ antigen-4 fusion protein gene:
With the PCR product of the mature protein gene of pIFN-α and pIFN-γ respectively glue reclaim template as next step PCR reaction, generate pIFN-α/γ antigen-4 fusion protein gene in the PCR process, with primer pIFN-α-Fwd and pIFN-γ-Rev amplification pIFN-α/γ antigen-4 fusion protein gene, product carries out 1% agarose gel electrophoresis, gets the amplified production of pIFN-α/γ antigen-4 fusion protein gene;
3.2.4 eukaryotic expression recombinant plasmid pMVAX1
The structure of-pIFN-α/γ:
With
EcoRI and
XhoThe amplified production of I restriction enzymes double zyme cutting pIFN-α/γ antigen-4 fusion protein gene, glue reclaim the antigen-4 fusion protein gene fragment 1 of the pIFN-α/γ maturation protein that obtains encoding, and use
EcoRI and
XhoI restriction enzymes double zyme cutting plasmid pMVAX1
, glue reclaims the vector gene fragment 2 that obtains comprising sequence 1, and antigen-4 fusion protein gene fragment 1 is connected with vector gene fragment 2, and the transformed competence colibacillus bacterium is cultivated, and picking colony is cultivated in the substratum of kalamycin resistance, extracts plasmid, carries out
EcoRI/
XhoThe I double digestion is identified, filters out positive colony, gets eukaryotic expression recombinant plasmid pMVAX1
-pIFN-α/γ, eucaryon plasmid pVAX1
The middle gene nucleotide series that inserts is shown in sequence in the sequence table 2.
4. synthetic method according to claim 3 is characterized in that the PCR reaction system is among the 25 μ L among the step 3.2.2, contains cDNA 1 μ L, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pIFN-α-Fwd and each 400nmol/L of pIFN-α-Rev or pIFN-γ-Fwd and each 400nmol/L of pIFN-γ-Rev, TaKaRa LA Taq 2U; Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis.
5. synthetic method according to claim 3 is characterized in that the PCR reaction system is among the 25 μ L among the step 3.2.3, contains each 1 μ L of amplified production of the mature protein gene of pIFN-α and pIFN-γ, Mg
2+1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pIFN-α-Fwd and pIFN-γ-Rev concentration are 400nmol/L, TaKaRa LA Taq 2U; Reaction conditions is: pre-95 ℃ of 5min of sex change; Carry out 35 circulations then, cycling condition is 95 ℃ of 45s, 62 ℃ of 45s, 72 ℃ of 1min; 72 ℃ are extended 10min then, and the taking-up product carries out 1% agarose gel electrophoresis.
6. synthetic method according to claim 3, the extraction step that it is characterized in that pig RNA among the step 3.2.2 is spleen or the peripheral blood of aseptic collection pig, separate spleen or blood lymphocytes with lymphocyte separation medium, contain CO at 37 ℃ with 1640 liquid of 10% foetal calf serum
2Cultivate 1h in the incubator of 5v%, after the PHA-P HA that adds 500 μ g/mL then stimulates 12h, extract total RNA with TRIzol reagent.
7. the described series connection pig α who efficiently expresses of claim 1, the application of IFN-expression of gene albumen in the medicine of preparation treatment porcine reproductive and respiratory syndrome.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110087551 CN102212539B (en) | 2011-04-08 | 2011-04-08 | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110087551 CN102212539B (en) | 2011-04-08 | 2011-04-08 | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102212539A true CN102212539A (en) | 2011-10-12 |
| CN102212539B CN102212539B (en) | 2012-10-24 |
Family
ID=44744073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110087551 Active CN102212539B (en) | 2011-04-08 | 2011-04-08 | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102212539B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102776222A (en) * | 2011-12-21 | 2012-11-14 | 河南科技大学 | Preparation and application of fused oral interferon for fowl |
| CN105647945A (en) * | 2016-03-09 | 2016-06-08 | 华南农业大学 | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof |
| CN106674354A (en) * | 2017-02-14 | 2017-05-17 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| CN108486127A (en) * | 2018-01-12 | 2018-09-04 | 中国农业科学院北京畜牧兽医研究所 | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof |
| EP3618618A4 (en) * | 2017-05-01 | 2020-03-25 | Rutgers, The State University of New Jersey | Type i and type iii interferon fusion molecules and methods for use thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194454A (en) * | 2013-04-08 | 2013-07-10 | 山东省农业科学院畜牧兽医研究所 | Efficiently-expressed porcine interleukin-2 gene and application of expression protein of porcine interleukin-2 gene |
| CN107286257A (en) * | 2017-08-09 | 2017-10-24 | 芜湖英特菲尔生物制品产业研究院有限公司 | A kind of Recombinant Swine long-acting interferon α and prepare fusion protein of this long-acting interferon and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003031630A1 (en) * | 2001-10-12 | 2003-04-17 | Keryos Spa | Multi-cistronic vectors for gene transfer protocols |
| WO2007038862A1 (en) * | 2005-10-03 | 2007-04-12 | Seneca College Of Applied Arts & Technology | Nucleic acid immunological composition for human metapneumovirus |
| CN101209345A (en) * | 2006-12-26 | 2008-07-02 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method and clinical application thereof |
-
2011
- 2011-04-08 CN CN 201110087551 patent/CN102212539B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003031630A1 (en) * | 2001-10-12 | 2003-04-17 | Keryos Spa | Multi-cistronic vectors for gene transfer protocols |
| WO2007038862A1 (en) * | 2005-10-03 | 2007-04-12 | Seneca College Of Applied Arts & Technology | Nucleic acid immunological composition for human metapneumovirus |
| CN101209345A (en) * | 2006-12-26 | 2008-07-02 | 河南农业大学 | Animal genetic engineering interferon alpha and gamma composite preparations and production method and clinical application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 《Molecular Microbiology》 20060731 David Kentner等 Determinants of chemoreceptor cluster formation in Escherichia coli 第407-417页 1-7 第61卷, 第2期 * |
| 《生物工程学报》 20090625 陈雪梅 等 猪Ⅰ型与Ⅱ型干扰素的克隆、表达及抗病毒活性比较 第806-812页 1-7 第25卷, 第6期 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102776222A (en) * | 2011-12-21 | 2012-11-14 | 河南科技大学 | Preparation and application of fused oral interferon for fowl |
| CN102776222B (en) * | 2011-12-21 | 2014-04-02 | 河南科技大学 | Preparation and application of fused oral interferon for fowl |
| CN105647945A (en) * | 2016-03-09 | 2016-06-08 | 华南农业大学 | Tandem duck Alpha and Nu interferon genes and preparation method and application thereof |
| CN106674354A (en) * | 2017-02-14 | 2017-05-17 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| CN106674354B (en) * | 2017-02-14 | 2020-10-16 | 华南农业大学 | Fusion protein of chicken interferon IFN-lambda and IFN-alpha |
| EP3618618A4 (en) * | 2017-05-01 | 2020-03-25 | Rutgers, The State University of New Jersey | Type i and type iii interferon fusion molecules and methods for use thereof |
| US11292823B2 (en) | 2017-05-01 | 2022-04-05 | Rutgers, The State University Of New Jersey | Type I and type III interferon fusion molecules and methods for use thereof |
| CN108486127A (en) * | 2018-01-12 | 2018-09-04 | 中国农业科学院北京畜牧兽医研究所 | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102212539B (en) | 2012-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102212539B (en) | Efficiently expressed series porcine alpha and gamma interferon genes and application of expressed protein thereof | |
| CN101818154B (en) | Gene segments for coding alpha interferons of pigs and application thereof | |
| Raggo et al. | The in vivo effects of recombinant bovine herpesvirus-1 expressing bovine interferon-γ | |
| Detournay et al. | Genomic analysis and mRNA expression of equine type I interferon genes | |
| CN104311671A (en) | Cat long-acting fusion interferon as well as preparation method and application thereof | |
| CN104059927A (en) | Preparation method of newcastle disease glucoprotein virus antigen and product thereof | |
| CN108840947A (en) | Bovine albumin-interferon-' alpha '-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of ox long-acting interferon | |
| CN106399266A (en) | Recombinant baculovirus for expressing dog serum albumin fused interferon gamma and application of recombinant baculovirus | |
| CN102492714A (en) | Method for preparing recombinant Chinese rural dog interferon-alpha | |
| CN107286254A (en) | Dog albumin interferon-' alpha ' interleukin-22 fusion protein, preparation method and its encoding gene, a kind of dog long-acting interferon | |
| CN107286255A (en) | It is a kind of by OVA, chicken interferon gamma and chicken interferon α fusion protein constituted and preparation method thereof | |
| CN102212527B (en) | Porcine alpha-interferon gene with efficient expression and high antiviral activity and application of expression protein thereof | |
| CN101570757A (en) | Porcine alpha interferon and interleukin 2 chimeric gene, construction method and protein purification method thereof | |
| CN103613668B (en) | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof | |
| CN103602684B (en) | Enhanced subsample gene capable of improving expression of foreign protein and application thereof | |
| CN103014015B (en) | Gene segment for coding porcine interferon-gamma and application of gene segment | |
| CN107253996A (en) | Sheep albumin interferon-tau interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon | |
| CN103194455B (en) | Efficiently-expressed porcine granulocyte macrophage-colony stimulating factor gene and application of expression protein of gene | |
| Riffault et al. | Transient IFN-γ synthesis in the lymph node draining a dermal site loaded with UV-irradiated herpes simplex virus type 1: an NK-and CD3-dependent process regulated by IL-12 but not by IFN-α/β | |
| CN103937828A (en) | Preparation method of fusion protein of porcine interferon-alpha 1 and thymosin-alpha 1 | |
| CN103194454A (en) | Efficiently-expressed porcine interleukin-2 gene and application of expression protein of porcine interleukin-2 gene | |
| CN107253995A (en) | It is a kind of by bovine albumin, Bov IFN γ and Bov IFN α fusion protein constituted and preparation method thereof | |
| CN105754957B (en) | Preparation method of recombinant baculovirus vaccine for preventing and treating avian influenza H5N1 | |
| CN107337738A (en) | A kind of canine recombinant long-acting interferon and prepare fusion protein of this long-acting interferon and preparation method thereof | |
| CN107286251A (en) | It is a kind of by cattle interleukins-2 2, Bov IFN γ and Bov IFN α fusion protein constituted and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |