CN103194455B - Efficiently-expressed porcine granulocyte macrophage-colony stimulating factor gene and application of expression protein of gene - Google Patents

Abstract

The invention relates to the field of gene expression in the biotechnology and in particular relates to an efficiently-expressed porcine granulocyte macrophage-colony stimulating factor gene expressed by a sequence 2 in a sequence table and further relates to an application of the expression protein of the porcine granulocyte macrophage-colony stimulating factor gene for improving the response of humoral immunity and cellular immunity of a pathogenicity PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) inactivated vaccine. A pGMCSF protein gene is expressed by an eukaryotic plasmid pMVAX<0> containing the sequence 2 in the sequence table, so that the limitations of low expression quantity and poor activity in the process of expressing the pGMCSF via a pMVAX<0> vector are broken, and the expression quantity is improved by 6.6 folds; and pig experiments prove that the expression activity of the expression protein pGMCSF of the gene in the sequence 2 in the sequence table is high, and the response of humoral immunity and cellular immunity of a pathogenicity PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) inactivated vaccine can be obviously improved, so that the expression protein pGMCSF is specially used for preventing diseases caused by high pathogenicity PRRSV and reducing financial loss of pig farms.

Description

The pig rHuGM-CSF gene of high efficient expression and the purposes of expressing protein thereof

technical field

The present invention relates to field of gene expression in biotechnology, particularly a kind of pig rHuGM-CSF gene of high efficient expression, also relates to the purposes of its expressing protein.

Background technology

Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS), be commonly called as " pig blue-ear disease ", by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV) cause, after virus infection, can cause sow miscarriage, return feelings, produce stillborn foetus or weak son, piglet death and the pig at various ages respiratory symptom in various degree, and can destroy the immunity system of pig, cause polyinfection or secondary infection.This disease is broken out at the bottom of nineteen ninety-five in China, and rapid spread is to national a plurality of provinces.At many large-scale pig farms, PRRS positive rate is very high, and what have reaches more than 80%.Since two thousand six, there is the high-pathogenicity blue ear disease being caused by PRRSV variant in pig farm, China some areas.It is principal character that this disease be take the high heat of morbidity pig, expiratory dyspnea, skin rubefaction clinically, has higher M & M, to the pig industry of China, has caused very serious financial loss.This disease has deactivation vaccine to use at present, but immune effect is desirable not to the utmost.

RHuGM-CSF (GMCSF) is to be produced under some antigen and cytokine stimulation by the T lymphocyte activating, bone-marrow-derived lymphocyte, scavenger cell, endotheliocyte, inoblast etc., propagation that can hemopoietic cell and differentiation, promotion granulocyte and Monocytes/Macrophages form colony, strengthen a type cytokines of its function.The biologic activity that GMCSF has has: induction hemopoietic forebody cell differentiation and proliferation, maintains the survival of hemopoietic forebody cell and mature blood cell; Strengthen the phagocytosis and killing function of neutrophil leucocyte and scavenger cell; Induction maturing dendritic cell, and gather to vaccination position, make it have the effect of obvious enhancing vaccine immunity reaction.Therefore it is in treatment, the prevention of disease and be with a wide range of applications aspect vaccine adjuvant.

First Inumaru and Takamatsu have cloned pGMCSF gene in nineteen ninety-five, Inumaru etc. in 1998 with baculovirus expression there is the pGMCSF of biologic activity, for Chinese scholars, escherichia coli prokaryotic expression carrier, plasmid carrier for expression of eukaryon, adenovirus etc. have been expressed pGMCSF subsequently, and its biologic activity has been carried out to large quantity research.This seminar was also once cloned into eukaryotic expression vector pVAX1 by pGMCSF , after transfection HEK-293A cell, expression amount and the activity of pGMCSF are lower.

Summary of the invention

In order to solve above rHuGM-CSF (GMCSF) expression amount and active low problem, the invention provides a kind of pig rHuGM-CSF gene that can high efficient expression.

The present invention also provides described pig rHuGM-CSF genetic expression albumen in the efficient purposes strengthening in highly pathogenic PRRSV inactivated vaccine humoral immunization and cellullar immunologic response.

The present invention is achieved by the following measures:

A pig rHuGM-CSF gene for high efficient expression, its nucleotide sequence is as shown in sequence in sequence table 2.

A kind of gene of sequence 2 is cloned into by Protocols in Molecular Biology the recombinant plasmid that carrier for expression of eukaryon obtains.

A synthetic method for described pig rHuGM-CSF gene, comprises the following steps

1, by eucaryon plasmid pVAX1 transform pMVAX1 as :

Rabbit β-Globin Intron II gene order GenBank the No:V00882 being announced by GenBank, introduces in upstream ssti restriction enzyme site and pCMV be one section of sequence of early promoter at once, in downstream, introduce T7 promoter sequence and ecorI restriction enzyme site, artificial spliced nucleotide sequence, as shown in sequence in sequence table 1, passes through this fragment gene sequence ssti/ ecorI restriction enzyme site inserts pVAX1 in carrier, transformed competence colibacillus bacterium, extracts plasmid and obtains through screening ssti/ ecorI double digestion positive colony, called after pMVAX1 ;

Described pCMV at once one section of sequence of early promoter is: 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',

Described T7 promoter sequence is: 5 '-AATACGACTCACTATAGGG-3 ';

2, the restructuring eucaryon plasmid pMVAX1 of construction expression pGMCSF -pGMCSF:

The Auele Specific Primer of the gene order of 2.1 design pair for amplification pGMCSF albumen, primer sequence is as follows:

pGMCSF-Fwd：5’-TATGAATTCGGTACCACCATGGCTCCCACCCGCCCA-3’，

pGMCSF-Rev：5’-GAGCTCGAGAAGCTTACTTTTTGACTGGCCCC-3’，

5 ' the end at upstream primer pGMCSF-Fwd is introduced ecorI restriction endonuclease sites and Kozak sequence, introduce at the 5 ' end of downstream primer pGMCSF-Rev xhoi restriction endonuclease sites;

2.2 splenic lymphocyte from pig are extracted RNA, obtain cDNA after reverse transcription, adopt RT-PCR technology to amplify the PCR product of pGMCSF protein gene;

2.3 use ecorI/ xhoi double digestion pMVAX1 , glue reclaim comprise sequence 1 vector gene fragment 1, the PCR product warp of pGMCSF protein gene ecorI/ xhoi double digestion glue reclaim the gene fragment 2 of the pGMCSF albumen that obtains encoding, and vector gene fragment 1 is connected with gene fragment 2, and transformed competence colibacillus bacterium, cultivates, and picking colony is cultivated in the substratum of kalamycin resistance, and extraction plasmid, carries out ecorI/ xhoi double digestion is identified, filters out positive colony, obtains pMVAX1 -pGMCSF, at eucaryon plasmid pVAX1 the gene nucleotide series of middle insertion is as shown in sequence in sequence table 2, and insertion process schematic diagram as shown in Figure 1.

In step 2.2, PCR reaction system is 25 μ L, containing cDNA 1 μ L, and Mg ²⁺1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pGMCSF-Fwd and pGMCSF-Rev concentration are 400nmol/L, TaKaRa LA Taq 2U; Reaction conditions is: 95 ° of C 5min of denaturation, then carry out 35 circulations, and cycling condition is 95 ° of C 45s, 60 ° of C 45s, 72 ° of C 45s; Then 72 ° of C extend 10min, and taking-up product carries out 1% agarose gel electrophoresis.

The application of a kind of expressing protein of described pig rHuGM-CSF gene in strengthening highly pathogenic PRRSV inactivated vaccine humoral immunization and cellullar immunologic response.

The invention has the beneficial effects as follows:

(1) contain the eucaryon plasmid pMVAX1 of sequence 2 in ordered list -pGMCSF expresses pGMCSF protein gene, has broken through and has passed through pVAX1 lower and the active poor limitation of the expression amount that runs in vector expression pGMCSF process, expression amount has improved 6.6 times;

(2) pig body evidence, in sequence table, the expressing protein pGMCSF expression activity of sequence 2 genes is very high, can significantly strengthen humoral immunization and the cellullar immunologic response of highly pathogenic PRRSV inactivated vaccine, be exclusively used in the prevention of the disease that highly pathogenic PRRSV is caused and reduce the financial loss on pig farm.

accompanying drawing explanation

Fig. 1 is that the present invention is by eucaryon plasmid pVAX1 transform pMVAX1 as and clone pGMCSF protein gene enters pMVAX1 schematic diagram;

Fig. 2 is recombinant plasmid pMVAX1 of the present invention ssti / EcorI double digestion is identified collection of illustrative plates, wherein

M is DL2,000 DNA Marker,

1 is restructuring positive plasmid pMVAX1 's ssti / EcorI double digestion result;

Fig. 3 is recombinant plasmid pMVAX1 of the present invention -pGMCSF's ecorI/ xhoi double digestion is identified collection of illustrative plates, wherein

M is DL2,000 DNA Marker,

1 and 2 is two different restructuring positive plasmid pMVAX1 -pGMCSF's ecorI/ xhoi double digestion result;

Fig. 4 is recombinant plasmid pMVAX1 of the present invention the Western-blot of the pGMCSF that-pGMCSF expresses detects, wherein

Swimming lane 1 is empty carrier plasmid pVAX1 western-blot test strip after transfection HEK-293A,

Swimming lane 2 is the empty carrier plasmid pMVAX1 of transformation western-blot test strip after transfection HEK-293A,

Swimming lane 3 is pVAX1 western-blot test strip after-pGMCSF transfection HEK-293A,

Swimming lane 4 is pMVAX1 western-blot test strip after-pGMCSF transfection HEK-293A;

Fig. 5 is for passing through the recombinant plasmid pMVAX1 of proliferation of bone marrow cells test determination the pGMCSF biologic activity that-pGMCSF expresses;

Fig. 6 is recombinant plasmid pMVAX1 the enhancement of the pGMCSF that-pGMCSF expresses to PRRSV inactivated vaccine neutralizing antibody;

Fig. 7 is for passing through the recombinant plasmid pMVAX1 of peripheral lymphocyte proliferation test determination the enhancement of the pGMCSF that-pGMCSF expresses to PRRSV inactivated vaccine cellular immunization.

Embodiment

Below in conjunction with embodiment, pig rHuGM-CSF gene of the present invention is further described.

. by eucaryon plasmid pVAX1 transform pMVAX1 as

1.1 insert the synthetic of gene

Rabbit β-Globin Intron II gene order (GenBank No:V00882) of announcing with reference to GenBank, introduces in upstream ssti restriction enzyme site and pCMV be one section of sequence of early promoter at once, in downstream, introduce T7 promoter sequence and ecorI restriction enzyme site is transferred to TaKaRa company synthetic by this fragment gene sequence assembly together, and the nucleotide sequence that comprises Rabbit β-Globin Intron II gene of specific coding is shown in sequence 1 in sequence table, and is cloned into T carrier.

Described pCMV at once one section of sequence of early promoter is 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',

Described T7 promoter sequence is 5 '-AATACGACTCACTATAGGG-3 ';

1.2 pMVAX1 structure and evaluation

From T carrier ssti/ ecorI double digestion goal gene glue reclaim, with same process ssti/ ecothe eucaryon plasmid pVAX1 of RI double digestion and the carrier segments that reclaims of glue is at 16 ° of C connections of spending the night, conversion DH5 α competence bacterium, 37 ° of C incubated overnight 16h.Picking colony 37 ° of C overnight shakings in the LB of kalamycin resistance substratum are cultivated, and second day extracts plasmid, carries out ssti/ ecorI double digestion is identified, is accredited as positive plasmid called after pMVAX1 , see Fig. 2, transfer to the order-checking of TaKaRa company, in the gene fragment order of insertion and sequence table, sequence 1 matches.

.pGMCSF the gene clone of albumen enters pMVAX1

The design of 2.1 primers and synthetic

The gene order (GenBank no. NM_213861) of the pGMCSF announcing according to GenBank, the Auele Specific Primer of the gene order of design pair for amplification pGMCSF albumen, introduces at the 5 ' end of upstream primer pGMCSF-Fwd ecorI restriction endonuclease sites and Kozak sequence, introduce at the 5 ' end of downstream primer pGMCSF-Rev xhoi restriction endonuclease sites, primer sequence is as follows:

pGMCSF-Fwd：5’-TATGAATTCGGTACCACCATGGCTCCCACCCGCCCA-3’，

pGMCSF-Rev：5’-GAGCTCGAGAAGCTTACTTTTTGACTGGCCCC-3’，

Article two, primer pGMCSF-Fwd and pGMCSF-Rev are across pGMCSF protein-coding region, and expectation expanding fragment length is 418bp, and primer is synthesized by TaKaRa company.

The extraction of the separation and Culture of 2.2 pig splenic lymphocyte, induction and total RNA

The spleen of aseptic collection yorker, by the separated splenic lymphocyte of lymphocyte separation medium, with 1640 liquid of 10% foetal calf serum at 37 ° of C, contain CO ₂in the incubator of 5v%, cultivate 1h, then add the phytohaemagglutinin (PHA) of 500 μ g/mL to stimulate after 12h, with TRIzol reagent, extract total RNA, as the template of RT-PCR.

2.3 RT-PCR amplifications

The cDNA that the RNA of take obtains through ThermoScript II Oligo d (T) reverse transcription is template, and pGMCSF-Fwd and pGMCSF-Rev are that primer carries out pcr amplification, and PCR reaction system is 25 μ L, containing cDNA 1 μ L, and Mg ²⁺1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, the concentration of pGMCSF-Fwd and pGMCSF-Rev is 400nmol/L, TaKaRa LA Taq 2U.Reaction conditions is: 95 ° of C 5min of denaturation; Then carry out 35 circulations, cycling condition is 95 ° of C 45s, 60 ° of C 45s, 72 ° of C 45s; Then 72 ° of C extend 10min, and taking-up product carries out 1% agarose gel electrophoresis, and glue reclaims the PCR product that obtains pGMCSF protein gene.

The structure of 2.4 eukaryotic expression recombinant plasmids and evaluation

With ecorI/ xhoi double digestion pMVAX1 , glue recovery obtains the vector gene fragment 1 that comprises sequence 1, the PCR product warp of the protein gene of pGMCSF ecorI/ xhoi double digestion glue reclaim the gene fragment 2 of the pGMCSF albumen that obtains encoding, and vector gene fragment 1 are connected to conversion DH5 α competence bacterium, 37 ° of C incubated overnight 16h with gene fragment 2.Picking colony 37 ° of C overnight shakings in the LB of kalamycin resistance substratum are cultivated, and second day extracts plasmid, carries out ecorI/ xhoi double digestion is identified.Be accredited as positive plasmid pMVAX1 -pGMCSF transfers to the order-checking of TaKaRa company, and enzyme is cut qualification result as shown in Figure 3.Building process schematic diagram as shown in Figure 1.The gene order of inserting with Vector NTI and DNAStar software analysis and derivation aminoacid sequence, be compared to eucaryon plasmid pVAX1 , pMVAX1 the nucleotide sequence inserting in-pGMCSF is as shown in sequence in sequence table 2, and derivation aminoacid sequence is as shown in sequence in sequence table 3.

restructuring eucaryon plasmidpMVAX1 -pGMCSF expression identification

3.1 recombinant plasmid pMVAX1 -pGMCSF transfection human embryonic kidney epithelial cells HEK-293A

Experimental group: Lipofectamine is pressed in concrete operations ^tM2000(Invitrogen) specification sheets carries out.Transfection is carried out on 6 porocyte plates, in the day before yesterday of transfection, and digestion HEK-293A cell, the foetal calf serum DMEM(with 10% is not containing microbiotic) diluting cells, make its density reach 2.5 * 10 ⁵individual cell/mL, every hole inoculation 2.5mL on 6 porocyte plates, in 37 ° of C, containing CO ₂in the incubator of 5v%, cultivate.The OPTI-MEM serum free medium that first adds 37 ° of C preheatings of 500 μ L in the centrifuge tube of the 1.5mL of sterilizing, then adds the recombinant plasmid pMVAX1 of 1.0 μ g -pGMCSF, mixes gently; The OPTI-MEM serum free medium that first adds 37 ° of C preheatings of 500 μ L in the centrifuge tube of the 1.5mL of another sterilizing, then adds 2.5 μ L Lipofectamine ^tM2000 transfection reagents, mix gently, in room temperature, place 5min; Then by the liquid blending in the centrifuge tube of two 1.5mL together, room temperature is placed 20min; From CO ₂in incubator, take out cell plate, supernatant discarded, joins liquid mixture on cell face gently, then immediately cell plate is put into CO ₂in incubator; After incubation 6h, sop up supernatant, add gently 10% foetal calf serum DMEM of 37 ° of C preheatings of 2.0mL, put into CO ₂incubator continues to cultivate 24h, and then multigelation cell transfecting thing is 2 times, and the centrifugal 5min of 12000rpm, obtains freezing-thawing and cracking supernatant, to be checked.

Control group 1: by the pMVAX1 of experimental group -pGMCSF replaces with empty carrier plasmid pVAX1 , all the other methods are consistent with experimental group, in contrast.

Control group 2: by the pMVAX1 of experimental group -pGMCSF replaces with the empty carrier plasmid pMVAX1 of transformation , all the other methods are consistent with experimental group, in contrast.

Control group 3: by the pMVAX1 of experimental group -pGMCSF replaces with pVAX1 -pGMCSF, all the other methods are consistent with experimental group, in contrast.

Described pVAX1 -pGMCSF is at eucaryon plasmid carrier pVAX1 in only insert pGMCSF gene, and do not insert Rabbit β-Globin Intron II gene.

3.2 recombinant plasmid pMVAX1 the Western-blot of the pGMCSF that-pGMCSF expresses detects

With reference to Bio-Rad company half-dried transfer printing instrument operation instructions, carry out electric transfer printing, then carry out immunodetection.NC film after ponceau dyeing is transferred in confining liquid, and after room temperature jog 1h, 4 ° of C sealings are spent the night; The deblocking liquid that inclines, washes film 5 times with washings TBST, and each 5 min, then add pGMCSF monoclonal antibody (R & D Systems company), and 1h vibrates under room temperature; With TBST, wash film 5 times again, each 5min, then adds the goat anti-mouse igg-HRP with confining liquid 1:5000 dilution, room temperature vibration 1h; With TBST, wash film 5 times again, each 5min, finally uses chemoluminescence colouring reagents box (Supersignal west Pico Trial Kit) develop the color, exposure on X film, development and photographic fixing are observed.

β-actin contrast is set up in test simultaneously, and primary antibodie is β-actin monoclonal antibody (Santa Cruz company), and two resist the goat anti-mouse igg-HRP for 1:5000 dilution.

After testing, pGMCSF has obtained correct expression, the about 25kD of molecular weight.PMVAX1 the pGMCSF that-pGMCSF expresses is apparently higher than pVAX1 -pGMCSF.Through Bio-Rad ChemiDoc XRS System, analyze pMVAX1 the amount of the pGMCSF that-pGMCSF expresses is pVAX1 7.6 times (having improved 6.6 times) of-pGMCSF.Control group 1 and control group 2 are all without expressing.As shown in Figure 4.

3.3 recombinant plasmid pMVAX1 the pGMCSF biologic activity that-pGMCSF expresses detects

With reference to methods such as Maliszewski, adopt the activity of proliferation of bone marrow cells test determination GMCSF.Step is as follows:

Aseptic taking-up pig femur, is used autoclaved operation bone forceps cross-section, with sterilizing tweezers, from transverse section, inserts, make it to form larger space, then by the PBS(distilled water preparation of sterilizing) add in space, piping and druming, is evenly distributed in PBS medullary cell repeatedly; Bone marrow cell suspension is placed in to the sterilizing centrifuge tube of 10mL, the centrifugal 5～10min of 1500～2000rpm; Suck supernatant liquor, precipitation, after PBS is resuspended, with erythrocyte cracked liquid cracking 15～30min, with the centrifugal 5～10min of 1500～2000rpm, precipitates and obtains required medullary cell;

Cell counting, regulates cell density to 7.5 * 10 with DMEM perfect medium ⁵individual/mL; Bed board, is added to cell suspension in 96 porocyte plates, 100 μ L/ holes; The HEK-293A cell freezing-thawing and cracking supernatant that adds 10 doubling dilutions, 100 μ L/ holes, each extent of dilution repeats 3 holes; Under 37 ° of C, cultivate 7d, then with mtt assay, measure the propagation degree of cell, measure OD _570nmvalue, calculate the OD value in the stimulation hole of stimulation index SI=HEK-293A cell freezing-thawing and cracking supernatant/only the contain OD value that does not stimulate hole of DMEM perfect medium.

After using the supernatant dilution obtaining in above-mentioned steps 3.1, detect respectively, the results are shown in Figure 5.As can be seen from the figure pMVAX1 the pGMCSF that-pGMCSF expresses has very high biologic activity, and during 1:25 dilution, concentration is too high has a side effect, and during 1:200 dilution, activity is the highest, and along with dilution raising is dose-dependently, the minimum dose that stimulates proliferation of bone marrow cells is 1:1600 dilution; And pVAX1 it is 1:200 dilution that the pGMCSF that-pGMCSF expresses stimulates the minimum dose of proliferation of bone marrow cells.

the enhancement of the pGMCSF that restructuring eucaryon plasmid is expressed to highly pathogenic PRRSV inactivated vaccine immunne response

4.1 pig body experiment groupings

Choose 50 of the sodium selenites (PRRS virus, porcine circovirus 2 type, pig parvoviral, PRV (Pseudorabies virus) and Actinobacillus pleuropneumoniae etc. are antigen negative and negative antibody) in 3 week age, 5 every group.

Experimental group: by pMVAX1 1 part of-pGMCSF 500ug/ head and highly pathogenic PRRSV inactivated vaccine (SD-JN strain, is prepared voluntarily by this laboratory, and preparation method is with highly pathogenic PRRS deactivation vaccine NVDC-JXA1 strain) is share the immunity sodium selenite in 3 week age, musculi colli injection.One exempts from latter 28 days, with identical dosage method booster immunization once.In one exempt from latter 28 days (two exempt from before), one exempt from after 42,56 days respectively blood sampling measure neutralizing antibody; One exempts within 42,56 days, to gather respectively heparin anti-coagulating afterwards, with PRRSV SD-JN strain concentrated antigen, stimulates, and it is active that mtt assay is measured peripheral lymphocyte proliferation.

Control group 1: by the pMVAX1 of experimental group -pGMCSF replaces with pVAX1 -pGMCSF, all the other methods are consistent with experimental group.

Control group 2: by the pMVAX1 of experimental group -pGMCSF replaces with PBS, and all the other methods are consistent with experimental group.

Control group 3: by the pMVAX1 of experimental group -pGMCSF replaces with empty carrier plasmid pVAX1 , all the other methods are consistent with experimental group.

Control group 4: by the pMVAX1 of experimental group -pGMCSF replaces with the empty carrier plasmid pMVAX1 of transformation , all the other methods are consistent with experimental group.

Control group 5: only inject PBS, do not inject deactivation vaccine.

Control group 6: only according to the dosage injection empty carrier plasmid pVAX1 of 500ug/ head , do not inject deactivation vaccine.

Control group 7: only according to the dosage injection empty carrier plasmid pMVAX1 of 500ug/ head , do not inject deactivation vaccine.

Control group 8: only according to the dosage injection pVAX1 of 500ug/ head -pGMCSF, does not inject deactivation vaccine.

Control group 9: only according to the dosage injection pMVAX1 of 500ug/ head -pGMCSF, does not inject deactivation vaccine.

4.2 humoral immune reactions detect

As Fig. 6, after testing, one exempt from after the neutralizing antibody of 42,56 days experimental group is significantly higher than control group 1, average neutralizing antibody one exempt from after 42 days experimental group be 1:16, control group 1 is 1:9; One exempt from after 56 days experimental group be 1:26, control group 1 is 1:13; The neutralizing antibody that control group 2-4 produces is very low, is the neutralizing antibody that inactivated vaccine produces, and one exempts from latter 42 days for 1:4, and one exempts from latter 56 days for 1:8, and control group 5-9 produces without neutralizing antibody.

4.3 cell immune responses detect

As Fig. 7, after testing, a specific peripheral lymphocyte proliferation activity of PRRSV of exempting from rear 42,56 days experimental group is significantly higher than control group 1, and control group 1 is also significantly higher than control group 2-9.

<110> Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricul

The pig rHuGM-CSF gene of the high efficient expression of <120> and the purposes of expressing protein thereof

<160>3

<210>1

<211>818

<212>DNA

<213> synthetic

<220>

<221>intron

<222>（1）...（818）

<440>1

gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc 60

atagaagaca ccgggaccga tccagcctcc gcggccggga acggtgcatt ggaacggacc 120

cctaggcttt tgcaaaaagc tggatcgatc ctgagaactt cagggtgagt ttggggaccc 180

ttgattgttc tttctttttc gctattgtaa aattcatgtt atatggaggg ggcaaagttt 240

tcagggtgtt gtttagaatg ggaagatgtc ccttgtatca ccatggaccc tcatgataat 300

tttgtttctt tcactttcta ctctgttgac aaccattgtc tcctcttatt ttcttttcat 360

tttctgtaac tttttcgtta aactttagct tgcatttgta acgaattttt aaattcactt 420

ttgtttattt gtcagattgt aagtactttc tctaatcact tttttttcaa ggcaatcagg 480

gtatattata ttgtacttca gcacagtttt agagaacaat tgttataatt aaatgataag 540

gtagaatatt tctgcatata aattctggct ggcgtggaaa tattcttatt ggtagaaaca 600

actacatcct ggtcatcatc ctgcctttct ctttatggtt acaatgatat acactgtttg 660

agatgaggat aaaatactct gagtccaaac cgggcccctc tgctaaccat gttcatgcct 720

tcttcttttt cctacagctc ctgggcaacg tgctggttat tgtgctgtct catcattttg 780

gcaaagaatt gtaatacgac tcactatagg gcgaattc 818

<210>2

<211>1224

<212>DNA

<213> synthetic

<220>

<221>intron

<222>（1）...（818）

<220>

<221>mat_peptide

<222>（828）...（1211）

<440>2

gagctcgttt agtgaaccgt cagatcgcct ggagacgcca tccacgctgt tttgacctcc 60

atagaagaca ccgggaccga tccagcctcc gcggccggga acggtgcatt ggaacggacc 120

cctaggcttt tgcaaaaagc tggatcgatc ctgagaactt cagggtgagt ttggggaccc 180

ttgattgttc tttctttttc gctattgtaa aattcatgtt atatggaggg ggcaaagttt 240

tcagggtgtt gtttagaatg ggaagatgtc ccttgtatca ccatggaccc tcatgataat 300

tttgtttctt tcactttcta ctctgttgac aaccattgtc tcctcttatt ttcttttcat 360

tttctgtaac tttttcgtta aactttagct tgcatttgta acgaattttt aaattcactt 420

ttgtttattt gtcagattgt aagtactttc tctaatcact tttttttcaa ggcaatcagg 480

gtatattata ttgtacttca gcacagtttt agagaacaat tgttataatt aaatgataag 540

gtagaatatt tctgcatata aattctggct ggcgtggaaa tattcttatt ggtagaaaca 600

actacatcct ggtcatcatc ctgcctttct ctttatggtt acaatgatat acactgtttg 660

agatgaggat aaaatactct gagtccaaac cgggcccctc tgctaaccat gttcatgcct 720

tcttcttttt cctacagctc ctgggcaacg tgctggttat tgtgctgtct catcattttg 780

gcaaagaatt gtaatacgac tcactatagg gcgaattcgg taccaccatg gctcccaccc 840

gcccacccag ccctgtcacc cggccctggc agcatgtgga tgccatcaaa gaagccctga 900

gccttctaaa caacagtaat gacacagcgg ctgtgatgaa tgaaaccgta gacgtcgtct 960

gtgaaatgtt tgacccccag gagccgacat gcgtgcagac tcgcctgaac ctgtacaagc 1020

agggcctgcg gggcagcctc actaggctca agagcccctt gactctgttg gccaagcact 1080

atgagcagca ctgccccctc accgaggaaa cttcctgtga aacccagtct atcaccttca 1140

aaagtttcaa agacagtctg aacaaatttc tttttaccat cccctttgac tgctgggggc 1200

cagtcaaaaa gtaagcttct cgag 1224

<210>3

<211>128

<212>PRT

<213> synthetic

<440>3

Met Ala Pro Thr Arg Pro Pro Ser Pro Val Thr Arg Pro Trp Gln

1 5 10 15

His Val Asp Ala Ile Lys Glu Ala Leu Ser Leu Leu Asn Asn Ser

20 25 30

Asn Asp Thr Ala Ala Val Met Asn Glu Thr Val Asp Val Val Cys

35 40 45

Glu Met Phe Asp Pro Gln Glu Pro Thr Cys Val Gln Thr Arg Leu

50 55 60

Asn Leu Tyr Lys Gln Gly Leu Arg Gly Ser Leu Thr Arg Leu Lys

65 70 75

Ser Pro Leu Thr Leu Leu Ala Lys His Tyr Glu Gln His Cys Pro

80 85 90

Leu Thr Glu Glu Thr Ser Cys Glu Thr Gln Ser Ile Thr Phe Lys

95 100 105

Ser Phe Lys Asp Ser Leu Asn Lys Phe Leu Phe Thr Ile Pro Phe

110 115 120

Asp Cys Trp Gly Pro Val Lys Lys

125

Claims (4)

1. polynucleotide that can high efficient expression pig rHuGM-CSF gene, its sequence is as shown in sequence in sequence table 2.

2. described in a claim 1, the polynucleotide of sequence 2 are cloned into by Protocols in Molecular Biology the recombinant plasmid that carrier for expression of eukaryon obtains.

3. a synthetic method for polynucleotide claimed in claim 1, is characterized in that comprising the following steps:

(1) by eucaryon plasmid pVAX1 transform pMVAX1 as :

Rabbit β-Globin Intron II gene order GenBank the No:V00882 being announced by GenBank, introduces in upstream ssti restriction enzyme site and pCMV be one section of sequence of early promoter at once, in downstream, introduce T7 promoter sequence and ecor I restriction enzyme site, artificial spliced nucleotide sequence, as shown in sequence in sequence table 1, passes through this section of nucleotide sequence ss tI/EcoRi restriction enzyme site inserts pVAX1 in carrier, transformed competence colibacillus bacterium, extracts plasmid and obtains through screening ssti/ ecor I double digestion positive colony, called after pMVAX1 ;

Described pCMV at once one section of sequence of early promoter is: 5 '-GTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCAT AGAAGACACCGGGACCGATCCAGCCTCCGC-3 ',

Described T7 promoter sequence is: 5 '-AATACGACTCACTATAGGG-3 ';

(2) the restructuring eucaryon plasmid pMVAX1 of construction expression pGMCSF -pGMCSF:

1. the Auele Specific Primer that designs pair for amplification pGMCSF gene order, primer sequence is as follows:

pGMCSF-Fwd：5’-TATGAATTCGGTACCACCATGGCTCCCACCCGCCCA-3’，

pGMCSF-Rev：5’-GAGCTCGAGAAGCTTACTTTTTGACTGGCCCC-3’，

5 ' the end at upstream primer pGMCSF-Fwd is introduced ecor I restriction endonuclease sites and Kozak sequence, introduce at the 5 ' end of downstream primer pGMCSF-Rev xhoi restriction endonuclease sites;

2. from the spleen of pig, extract RNA, after reverse transcription, obtain cDNA, adopt RT-PCR technology to amplify the PCR product of pGMCSF gene;

3. use ecor I/ xhoi double digestion pMVAX1 , glue reclaim comprise sequence 1 vector gene fragment 1, the PCR product warp of pGMCSF gene ecor I/ xhoi double digestion glue reclaim the gene fragment 2 of the pGMCSF albumen that obtains encoding, and vector gene fragment 1 is connected with gene fragment 2, and transformed competence colibacillus bacterium, cultivates, and picking colony is cultivated in the substratum of kalamycin resistance, and extraction plasmid, carries out ecor I/ xhoi double digestion is identified, filters out positive colony, obtains pMVAX1 -pGMCSF, eucaryon plasmid pVAX1 the gene nucleotide series of middle insertion is as shown in sequence in sequence table 2.

4. synthetic method according to claim 3, is characterized in that during step is 2. that PCR reaction system is 25 μ L, containing cDNA 1 μ L, and Mg ²⁺1.5mmol/L, dNTP 200 μ mol/L, 10 * LA PCR Buffer, 2.5 μ L, pGMCSF-Fwd and pGMCSF-Rev concentration are 400nmol/L, TaKaRa LA Taq 2U; Reaction conditions is: 95 ° of C 5min of denaturation, then carry out 35 circulations, and cycling condition is 95 ° of C 45s, 60 ° of C 45s, 72 ° of C 45s; Then 72 ° of C extend 10min, and taking-up product carries out 1% agarose gel electrophoresis.